Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI462.3.5                          23 END     2          66        8                (no blast hit)
     2   2.0    0Xt7.1-CAAK1324.3                            2 END     1          33       50                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012101320 Xt7.1-CAAJ16163.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ16163.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACACCATTCTTTGTTGCAGTTGATCATGATAAGAAGAAAGTGGTGATTAGCATTCGAGGGACACTCTCTCCCAAGGATGCCTTGACAGATCTGACAGGAGATGCGGAACGGTTGCCAGTGGAAGGGCATCATGGCACCTGGTTGGGACACAAGGGAATGGTTCTGTCAGCTGAATACATTAAAAAGAAGCTGGAGCAAGAGATGGTTCTTTCCCAAGCATTTGGCCGTGACCTGGCACGTGGGACCAAACACTATGAACTGATTGTGGTTGGCCATTCGCTTGGAGCTGGAACAGCTGCCATCTTGTCCTTCCTGTTACGCCCGCAGTATCCTTCCCTGAAGTGCTTTGCATATTCCCCACCTGGTGGCTTGTTAAGTGAGGATGCGATGGAATATTCTAAGGAATTTGTTACCTCTGTGGTGCTTGGAAAGGATCTAGTTCCAAGAATCGGCCTCTCGCAGCTGGAGGGTTTTCGCAGGCACTTGCTTGATGTTCTTCAGAGAAGCAACAAGCCTAAGTGGCGCATCATACTTGGCGGAACCAAATGCATACCTAAATCAGAACTCCCGGAAGAGTCAGAGGCTATAACGATACCCAGTAATCGCCTATGGACGCACCCCAGTGACCTGACCATAGCACTTTCAGCTAGCACACCCCTTTACCCACCGGGGCGTATCATTCATGTGGTTCACAACCATCCAGTTGAGCAATGCTGTTTCTGGAATCAGGAAGAACCCACCTACTTTGCCATCTGGGGTGATAATAAGGCATTTGAGGAGGTCATAATCTCTCCAGCCATGTTGCATGAACATCTCCCACACGTGGTAATGGAAGGACTGAACAAGGTCCTAGAGAATTACAACAAGGGGAAAACCGCGCTGCTCTCCGCTGCCAAGGTCATGGTGAGTCCAACGGAAGTGGATCTGAACCCAGAGCTGATTTTCCAACAGCAACCTCACCCGCCTCCCCCAATCCTGGAGGTAATTCCTGCCATCATGCCTGGAGCCCACAACAGGAGGAACAGCAGCACCAAGAGTAAGCAGTCAGACATCAGCCTGGAAGGTTTCTATGACTCTCGCCTTCTGTCACCAATTCTAAAAGACCCAGTAGAGCTCCTTTTGATGAGCACAAAAGATTGCCTGGCTGTATCTCTCCAAGATCGCAGGGCACCTCTCGCCACCATGGAGAGCCTCTCAGATAATGAATCTGTTTACAGCTTTGATTCACGGCGCTCTTCTGGTTTCCGCAGTATACGAGGCTCACCGAGCCTGAGAGCAGTGTTGGAGCGCGATGAGAGTCATTGTTTCTTCATTGACCCCACGATCCCTGAGGAAAACCCCTCTTTGAGCTCACGGACAGAGCTTCTAGGAGCAGATGCGCTCTCAAAGCATTCGCAGGAGAGCCAGCCGACTGAGGTTGCTCACAATAGTGGCAGATCTTCACCAGGTGACCTGCCTCCTTGGGATGAGGAGGCCTTAGCAGGAGTAGAGAGCAGCAGGGCTCTCACACCAGCTAAAGAAGAATTGGCACTGCAGAATGGGCGCTTGAATGAGGTACCTAGTCCCCAGGTGCTGGAGTTTGCAGAATTTATAGACAGCCTTTTTAATCTGGACAACAAAAGTGGTTCTCTGCAGGATCTTTA
                                                  Xt7.1-CHK-1008247282                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTCTTTGTTGCAGTTGATCATGATAAGAAGAAAGTGGTGATTAGCATTCGAGGGACACTCTCTCCCAAGGATGCCTTGACAGATCTGACAGGAGATGCGGAACGGTTGCCAGTGGAAGGGCATCATGGCACCTGGTTGGGACACAAGGGAATGGTTCTGTCAGCTGAATACATTAAAAAGAAGCTGGAGCAAGAGATGGTTCTTTCCCAAGCATTTGGCCGTGACCTGGCACGTGGGACCAAACACTATGAACTGATTGTGGTTGGCCATTCGCTTGGAGCTGGAACAGCTGCCATCTTGTCCTTCCTGTTACGCCCGCAGTATCCTTCCCTGAAGTGCTTTGCATATTCCCCACCTGGTGGCTTGTTAAGTGAGGATGCGATGGAATATTCTAAGGAATTTGTTACCTCTGTGGTGCTTGGAAAGGATCTAGTTCCAAGAATCGGCCTCTCGCAGCTGGAGGGTTTTCGCAGGCACTTGCTTGATGTTCTTCAGAGAAGCAACAAGCCTAAGTGGCGCATCATACTTGGCGGAACCAAATGCATACCTAAATCAGAACTCCCGGAAGAGTCAGAGGCTATAACGATACCCAGTAATCGCCTATGGACGCACCCCAGTGACCTGACCATAGCACTTTCAGCTAGCACACCCCTTTACCCACCGGGGCGTATCATTCATGTGGTTCACAACCATCCAGTTGAGCAATGCTGTTTCTGGAATCAGGAAGAACCCACCTACTTTGCCATCTGGGGTGATAATAAGGCATTTGAGGAGGTCATAATCTCTCCAGCCATGTTGCATGAACATCTCCCACACGTGGTAATGGAAGGACTGAACAAGGTCCTAGAGAATTACAACAAGGGGAAAACCGCGCTGCTCTCCGCTGCCAAGGTCATGGTGAGTCCAACGGAAGTGGATCTGAACCCAGAGCTGATTTTCCAACAGCAACCTCACCCGCCTCCCCCAATCCTGGAGGTAATTCCTGCCATCATGCCTGGAGCCCACAACAGGAGGAACAGCAGCACCAAGAGTAAGCAGTCAGACATCAGCCTGGAAGGTTTCTATGACTCTCGCCTTCTGTCACCAATTCTAAAAGACCCAGTAGAGCTCCTTTTGATGAGCACAAAAGATTGCCTGGCTGTATCTCTCCAAGATCGCAGGGCACCTCTCGCCACCATGGAGAGCCTCTCAGATAATGAATCTGTTTACAGCTTTGATTCACGGCGCTCTTCTGGTTTCCGCAGTATACGAGGCTCACCGAGCCTGAGAGCAGTGTTGGAGCGCGATGAGAGTCATTGTTTCTTCATTGACCCCACGATCCCTGAGGAAAACCCCTCTTTGAGCTCACGGACAGAGCTTCTAGGAGCAGATGCGCTCTCAAAGCATTCGCAGGAGAGCCAGCCGACTGAGGTTGCTCACAATAGTGGCAGATCTTCACCAGGTGACCTGCCTCCTTGGGATGAGGAGGCCTTAGCAGGAGTAGAGAGCAGCAGGGCTCTCACACCAGCTAAAGAAGAATTGGCACTGCAGAATGGGCGCTTGAATGAGGTACCTAGTCCCCAGGTGCTGGAGTTTGCAGAATTTATAGACAGCCTTTTTAATCTGGACAACAAAAGTGGTTCTCTGCAGGATCTTTACCATGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = ?? ==== 3e-027     XP_696704.1 PREDICTED: similar to neural stem cell-derived dendrite regulator, partial [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                               PROTEIN --- Ce ---- 1e-031     NP_741084.1 triacylglycerol lipase and aldehyde dehydrogenase ALDH9B1, with some 3' 5' overlap, ALdehyde deHydrogenase (alh-11Co) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 7e-073     XP_001185766.1 PREDICTED: similar to GA17341-PA [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-076     NP_788900.1 CG33174-PD [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 0          XP_697873.1 PREDICTED: similar to neural stem cell-derived dendrite regulator [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_932782.1 neural stem cell-derived dendrite regulator [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_006124.1 chromosome 11 open reading frame 11 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_423696.2 PREDICTED: similar to KIAA0659 protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ16163.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2       bld Brn2      out                       CAAJ12010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACACCATTCTTTGTTGCAGTTGATCATGATAAGAAGAAAGTGGTGATTAGCATTCGAGGGACACTCTCTCCCAAGGATGCCTTGACAGATCTGACAGGAGATGCGGAACGGTTGCCAGTGGAAGGGCATCATGGCACCTGGTTGGGACACAAGGGAATGGTTCTGTCAGCTGAATACATTAAAAAGAAGCTGGAGCAAGAGATGGTTCTTTCCCAAGCATTTGGCCGTGACCTGGCACGTGGGACCAAACACTATGAACTGATTGTGGTTGGCCATTCGCTTGGAGCTGGAACAGCTGCCATCTTGTCCTTCCTGTTACGCCCGCAGTATCCTTCCCTGAAGTGCTTTGCATATTCCCCACCTGGTGGCTTGTTAAGTGAGGATGCGATGGAATATTCTAAGGAATTTGTTACCTCTGTGGTGCTTGGAAAGGATCTAGTTCCAAGAATCGGCCTCTCGCAGCTGGAGGGTTTTCGCAGGCACTTGCTTGATGTTCTTCAGAGAAGCAACAAGCCTAAGTGGCGCATCATACTTGGCGGAACCAAATGCATACCTAAATCAGAACTCCCGGAAGAGTCAGAGGCTATAACGATACCCAGTAATCGCCTATGGACGCACCCCAGTGACCTGACCATAGCACTTTCAGCTAGCACACCCCTTTACCCACCGGGGCGTATCATTCATGTGGTTCACAACCATCCAGTTGAGCAATGCTGTTTCTGGAATCAGGAAGAACCCACCTACTTTGCCATCTGGNGTGATAATAAGGCATTTGAGGAGGTCATAATCTCTCCAGCCATGTTGCATGAACATCTCCCACACGTGGTAATGGGAGGACTGAACAGGGTCTAGAGAATTACACAGGG
  5   1   2      seed Brn2      out                       CAAJ16163.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCATCTTGTCCTTCCTGTTACGCCCGCAGTATCCTTCCCTGAAGTGCTTTGCATATTCCCCACCTGGTGGCTTGTTAAGTGAGGATGCGATGGAATATTCTAAGGAATTTGTTACCTCTGTGGTGCTTGGAAAGGATCTAGTTCCAAGAATCGGCCTCTCGCAGCTGGAGGGTTTTCGCAGGCACTTGCTTGATGTTCTTCAGAGAAGCAACAAGCCTAAGTGGCGCATCATACTTGGCGGAACCAAATGCATACCTAAATCAGAACTCCCGGAAGAGTCAGAGGCTATAACGATACCCAGTAATCGCCTATGGACGCACCCCAGTGACCTGACCATAGCACTTTCAGCTAGCACACCCCTTTACCCACCGGGGCGTATCATTCATGTGGTTCACAACCATCCAGTTGAGCAATGCTGTTTCTGGAATCAGGAAGAACCCACCTACTTTGCCATCTGGGGTGATAATAAGGCATTTGAGGAGGTCATAATCTCTCCAGCCATGTTGCATGAACATCTCCCACACGTGGTAATGGAAGGACTGAACAAGGTCCTAGAGAATTACAACAAGGGGAAAACCGCGCTGCTCTCCGCTGCCAAGGTCATGGTGAGTCCAACGGAAGTGGATCTGAACCCAGAGCTGATTTTCCAACAGCAACCTCACCCGCCTCCCCCAATCCTGGAGGTAATTCCTGCCATCATGCCTGGAGCCCACAACAGGAGGAACAGCAGCACCAAGAGTAAGCAGTCAGACATCAGCCTGGAAGGTTTCTATGACTCTCGCCTTCTGTCACCAATTCTAAAAGACCCAGTAGAGCT
  5   1   2      skin Brn3      out                        CAAK1324.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGTCTCCCACACGTGGTAATGGAAGGACTGAACAAGGTCCTAGAGAATTACAACAAGGGGAAAACCGCGCTGCTCTCCGCTGCCAAGGTCATGGTGAGTCCAACGGAAGTGGATCTGAACCCAGAGCTGATTTTCCAACAGCAACCTCACCCGCCTCCCCCAATCCTGGAGGTAATTCCTGCCATCATGCCTGGAGCCCACAACAGGAGGAACAGCAGCACCAAGAGTAAGCAGTCAGACATCAGCCTGGAAGGTTTCTATGACTCTCGCCTTCTGTCACCAATTCTAAAAGACCCAGTAGAGCTCCTTTTGATGAGCACAAAAGATTGCCTGGCTGTATCTCTCCAAGATCGCAGGGCACCTCTCGCCACCATGGAGAGCCTCTCAGATAATGAATCTGTTTACAGCTTTGATTCACGGCGCTCTTCTGGTTTCCGCAGTATACGAGGCTCACCGAGCCTGAGAGCAGTGTTGGAGCGCGATGAGAGTCATTGTTTCTTCATTGACCCCACGATCCCTGAGGAAAACCCCTCTTTGAGCTCACGGACAGAGCTTCTAGGAGCAGATGCGCTCTCAAAGCATTCGCAGGAGAGCCAGCCGACTGAGGTTGCTCACAATAGTGGCAGATCTTCACCAGGTGACCTGCCTCCTTGGGATGAGGAGGCCTTAGCAGGAGTAGAGAGCAGCAGGGCTCTCACACCAGCTAAAGAAGAATTGGCACTGCAGAATGGGCGCTTGAATGAGGTACCTAGTCCCCAGGTGCTGGAGTTTGCAGAATTTATAGACAGCCTTTTTAATCTGGACAACAAAAGTGGTTCTCTGCAGGATCTTTACCATGTGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)