Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAP1982.3.5                          6 END     2         100       33                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012101388 Xt7.1-CAAP1982.5 - 2 ESTs
                                                                       ...-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAP1982.5                                                                                    CTCCATCTCTATAGTTGAACAGCTTCTGAAGAAGCAGGAAGACTTTGAGAAGATGCTGGCAGCTCAAGAAGAAAAGTTTGCTCTACTCAGAAGGAAAACCAAAACGGAGCAAAACTTGAGGCAAATTGACATAGATGATAAAGATCAAAAGAAACAAGAACCAAATTTTCTAAGGGTGCCTTCACTAAAGAGAAAACCTTCAGACAGAAAACCGTTTGCTCCCAAACTTTCTGATCGGGGGAGCAAAAAGGGTTTGGGACATACCGGTGGCTCAATAAGATCTGCAGTGGACAATACGAATGGCCCTTTCCAGTTATCAAAAGAAAGTCCAGGCACATCTAGTTTGCTGGATAGCTTGAATTTAAAAGCCAAAAACACAGAACTTTTAAAAACAGACATGTCTAATAATCAAGAACAGCAACCTGCCGCTGTAAATCAGGGCAGTTCCCAACTTTCGTCTCTTGAGATAAGTACTCCATCACTACCTGCAAATACAATCTACCAGCAAACTGCCATAACCAAATTAGATCCTTTCTCAATCCATGCCTTACCAGAGAGGAGTCAAAGTGATACCCACTCACTCACCATGCCGGCAATCAAGTCACAGCCTCCAACTGAACCTAATGTGGGCTCATTAAATATATCATCACCTATCATTCCTGTGGCCCATAAACTGTCCACAGAGAACACAGGATACAAGGATCCTGTATTGCAGATTGCCTCATATGACAGAACTATAAATGGATTCATGGAAACAAGATGCAAGATTTTGCCAGGTGGAAAGGAAAACGTGGCCGGTTTCTGGAATTCCTACTATGTCACTCTACGCGGGGAGAGGCTGAGCTTTTATAATGCNAAGAGGGATGAAGCCAAGAATGAAACTGNCATCCCTTCTGTCAATGTGAGAGGCGCTCACTGCGAGAGGGTGGAGGATTCAGCTGACAAGCAAATATCTTCATG
                                                  Xt7.1-CHK-1008252527                                                                                          CTCTATAGTTGAACAGCTTCTGAAGAAGCAGGAAGACTTTGAGAAGATGCTGGCAGCTCAAGAAGAAAAGTTTGCTCTACTCAGAAGGAAAACCAAAACGGAGCAAAACTTGAGGCAAATTGACATAGATGATAAAGATCAAAAGAAACAAGAACCAAATTTTCTAAGGGTGCCTTCACTAAAGAGAAAACCTTCAGACAGAAAACCGTTTGCTCCCAAACTTTCTGATCGGGGGAGCAAAAAGGGTTTGGGACATACCGGTGGCTCAATAAGATCTGCAGTGGACAATACGAATGGCCCTTTCCAGTTATCAAAAGAAAGTCCAGGCACATCTAGTTTGCTGGATAGCTTGAATTTAAAAGCCAAAAACACAGAACTTTTAAAAACAGACATGTCTAATAATCAAGAACAGCAACCTGCCGCTGTAAATCAGGGCAGTTCCCAACTTTCGTCTCTTGAGATAAGTACTCCATCACTACCTGCAAATACAATCTACCAGCAAACTGCCATAACCAAATTAGATCCTTTCTCAATCCATGCCTTACCAGAGAGGAGTCAAAGTGATACCCACTCACTCACCATGCCGGCAATCAAGTCACAGCCTCCAACTGAACCTAATGTGGGCTCATTAAATATATCATCACCTATCATTCCTGTGGCCCATAAACTGTCCACAGAGAACACAGGATACAAGGATCCTGTATTGCAGATTGCCTCATATGACAGAACTATAAATGGATTCATGGAAACAAGATGCAAGATTTTGCCAGGTGGAAAGGAAAACGTGGCCGGTTTCTGGAATTCCTACTATGTCACTCTACGCGGGGAGAGGCTGAGCTTTTATAATGCNAAGAGGGATGAAGCCAAGAATGAAACTGNCATCCCTTCTGTCAATGTGAGAGGCGCTCACTGCGAGAGGGTGGAGGATTCAGCTGACAAGCAAATATCTTCATGTGAGGG
                                                      consensus depths                                                                                         1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                       PREDICTED - ?? ---- 1e-009     XP_698216.1 PREDICTED: similar to Spectrin beta chain, brain 2 (Spectrin, non-erythroid beta chain 2) (Beta-III spectrin) (SPNB-3) (Beta SpIII sigma 1) (Spectrin-like protein GTRAP41) [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PREDICTED = Gg ==== 1e-028     XP_421148.2 PREDICTED: similar to beta chain spectrin [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAP1982.5                                                                                                                                        ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2      seed Int1      out                        CAAP1982.5p                                                                                    CTCCATCTCTATAGTTGAACAGCTTCTGAAGAAGCAGGAAGACTTTGAGAAGATGCTGGCAGCTCAAGAAGAAAAGTTTGCTCTACTCAGAAGGAAAACCAAAACGGAGCAAAACTTGAGGCAAATTGACATAGATGATAAAGATCAAAAGAAACAAGAACCAAATTTTCTAAGGGTGCCTTCACTAAAGAGAAAACCTTCAGACAGAAAACCGTTTGCTCCCAAACTTTCTGATCGGGGGAGCAAAAAGGGTTTGGGACATACCGGTGGCTCAATAAGATCTGCAGTGGACAATACGAATGGCCCTTTCCAGTTATCAAAAGAAAGTCCAGGCACATCTAGTTTGCTGGATAGCTTGAATTTAAAAGCCAAAAACACAGAACTTTTAAAAACAGACATGTCTAATAATCAAGAACAGCAACCTGCCGCTGTAAATCAGGGCAGTTCCCAACTTTCGTCTCTTGAGATAAGTACTCCATCACTACCTGCAAATACAATCTACCAGCAAACTGCCATAACCAAATTAGATCCTTTCTCAATCCATGCCTTACCAGAGAGGAGTCAAAGTGATACCCACTCACTCACCATGCCGGCAATCAAGTCACAGCCTCCAACTGAACCTAATGTGGGCTCATTAAATATATCATCACCTATCATTCCTGTGGCCCATAAACTGTCCACAGAGAACACAGGATACAAGGATCCTGTATTGCAGATTGCCTCATATGACAGAACTATAAATGGATTCATGGAAACAAGATGCAAGATTTTGCCAGGTGGAAAGGAAACGTGGCCGGTTTCTGGAATTCCTACTATGTCACTCTACGCGGGGAGAGGCTG
  5   1   2       bld Int1      out                        CAAP8861.5p                                                                                                                                                                         CTCAGAAGGAAAACCAAAACGGAGCAAAACTTGAGGCAAATTGACATAGATGATAAAGATCAAAAGAAACAAGAACCAAATTTTCTAAGGGTGCCTTCACTAAAGAGAAAACCTTCAGACAGAAAACCGTTTGCTCCCAAACTTTCTGATCGGGGGAGCAAAAAGGGTTTGGGACATACCGGTGGCTCAATAAGATCTGCAGTGGACAATACGAATGGCCCTTTCCAGTTATCAAAAGAAAGTCCAGGCACATCTAGTTTGCTGGATAGCTTGAATTTAAAAGCCAAAAACACAGAACTTTTAAAAACAGACATGTCTAATAATCAAGAACAGCAACCTGCCGCTGTAAATCAGGGCAGTTCCCAACTTTCGTCTCTTGAGATAAGTACTCCATCACTACCTGCAAATACAATCTACCAGCAAACTGCCATAACCAAATTAGATCCTTTCTCAATCCATGCCTTACCAGAGAGGAGTCAAAGTGATACCCACTCACTCACCATGCCGGCAATCAAGTCACAGCCTCCAACTGAACCTAATGTGGGCTCATTAAATATATCATCACCTATCATTCCTGTGGCCCATAAACTGTCCACAGAGAACACAGGATACAAGGATCCTGTATTGCAGATTGCCTCATATGACAGAACTATAAATGGATTCATGGAAACAAGATGCAAGATTTTGCCAGGTGGAAAGGAAAACGTGGCCGGTTTCTGGAATTCCTACTATGTCACTCTACGCGGGGAGAGGCTGAGCTTTTATAATGCNAAGAGGGATGAAGCCAAGAATGAAACTGNCATCCCTTCTGTCAATGTGAGAGGCGCTCACTGCGAGAGGGTGGAGGATTCAGCTGACAAGCAAATATCTTCATGTGAGGGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)