Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 27%

 1012101434 Xt7.1-CAAK10256.5 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAK10256.5 AAGAAGAAGAAGGAGCATGACAGGCAGGGCGCAGGGAGTGCGATCTTCTTGATCTCAGCTTTCAGCGATTTTATCGGACCTGTTGCCTGGTGCTTCTTAGTTGCCCATTGTTTCTATTATCCTTGGCTGCCCTGTTCGTACACAGGGATATCACCGGGAGGAATTTTTTTCCGCTTCCAATGAAAGAGGAGGAAGGAGGGAAAGAACTTTGATCGCAGGATAAAGGGAGACGCGCCGGAGCGCTGGATTGCGTCTGGATTTTTCGACCTGAGGGAAGTTGTCGCAAAACTCCGCTCCAGTGAAACTTTTCTCTGTATTTATTGTAAATGGTAGCGATCGGGGGCTCTGCGCGTATAATAACCATAATCATGCTGCTCCTGGGGTATTTCCCAGTCTAGTCCGACTGTCGCATCCCCTCTGGATGCCCGCTTGGATTTGGGATGGACATCTGATTTCAGGAAACTTTGGCTCTAGGTCAATTTTCTCGGCTCCAGGTATTTCTGCATTGGGACACCCCACTCAGTTGGAATATAAACAGGGAAGGCTGTTGATACCTTCTGTTTCTGGTTAATCTGCCCATCGGGGCTGCTAATCGCGGAGGAAGGATGTACCTGCCGGGGAAGTTGCTGCGTCTGTGGCTCCTGCTTCTTGTGGTTTTGACGCTGCTGCCAGCGTCCGGCTGGGCTTTGGTCTGCTTGCCCTGCGACGAATCCAAATGCGAGGAACCCAAGAATTGCCCGGGGAGTATAGTGCAGGGCATCTGCGGCTGCTGCTTCATGT
                                                  Xt7.1-CHK-1008256338       AAGAAGGAGCATGACAGGCAGGGCGCAGGGAGTGCGATCTTCTTGATCTCAGCTTTCAGCGATTTTATCGGACCTGTTGCCTGGTGCTTCTTAGTTGCCCATTGTTTCTATTATCCTTGGCTGCCCTGTTCGTACACAGGGATATCACCGGGAGGAATTTTTTTCCGCTTCCAATGAAAGAGGAGGAAGGAGGGAAAGAACTTTGATCGCAGGATAAAGGGAGACGCGCCGGAGCGCTGGATTGCGTCTGGATTTTTCGACCTGAGGGAAGTTGTCGCAAAACTCCGCTCCAGTGAAACTTTTCTCTGTATTTATTGTAAATGGTAGCGATCGGGGGCTCTGCGCGTATAATAACCATAATCATGCTGCTCCTGGGGTATTTCCCAGTCTAGTCCGACTGTCGCATCCCCTCTGGATGCCCGCTTGGATTTGGGATGGACATCTGATTTCAGGAAACTTTGGCTCTAGGTCAATTTTCTCGGCTCCAGGTATTTCTGCATTGGGACACCCCACTCAGTTGGAATATAAACAGGGAAGGCTGTTGATACCTTCTGTTTCTGGTTAATCTGCCCATCGGGGCTGCTAATCGCGGAGGAAGGATGTACCTGCCGGGGAAGTTGCTGCGTCTGTGGCTCCTGCTTCTTGTGGTTTTGACGCTGCTGCCAGCGTCCGGCTGGGCTTTGGTCTGCTTGCCCTGCGACGAATCCAAATGCGAGGAACCCAAGAATTGCCCGGGGAGTATAGTGCAGGGCATCTGCGGCTGCTGCTTCATGTGCGCCA
                                                      consensus depths      1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH MIN     602       8 
                                               BLH MPR     545       8 
                                               BLH OVR     605      80 
                                               CDS MIN     605       8 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dr ==== 2e-012     NP_997986.1 cysteine-rich motor neuron 1 [Danio rerio] =================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 1e-014     NP_056615.1 cysteine rich transmembrane BMP regulator 1 (chordin like) [Mus musculus] ===========================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ---- 7e-015     NP_057525.1 cysteine-rich motor neuron 1; cysteine-rich repeat-containing protein S52precursor [Homo sapiens] ================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Gg ---- 3e-015     NP_989756.1 cysteine-rich motorneuron 1 [Gallus gallus] ---================================================================================================================================================
                                                     Xt7.1-CAAK10256.5                  TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------TGA---------------------------------------------------------------------------------------TGA---------------------TAAATG---------------------------------------ATG------------------------TAG------------------------------------------ATG------TGA------------------------------------------------------------------------------------------------TGA------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                         ...
  5   1   2       bld Brn3 5x   out                        CAAK3434.5p AAGAAGAAGAAGGAGCATGACAGGCAGGGCGCAGGGAGTGCGATCTTCTTGATCTCAGCTTTCAGCGATTTTATCGGACCTGTTGCCTGGTGCTTCTTAGTTGCCCATTGTTTCTATTATCCTTGGCTGCCCTGTTCGTACACAGGGATATCACCGGGAGGAATTTTTTTCCGCTTCCAATGAAAGAGGAGGAAGGAGGGAAAGAACTTTGATCGCAGGATAAAGGGAGACGCGCCGGAGCGCTGGATTGCGTCTGGATTTTTCGACCTGAGGGAAGTTGTCGCAAAACTCCGCTCCAGTGAAACTTTTCTCTGTATTTATTGTAAATGGTAGCGATCGGGGGCTCTGCGCGTATAATAACCATAATCATGCTGCTCCTGGGGTATTTCCCAGTCTAGTCCGACTGTCGCATCCCCTCTGGATGCCCGCTTGGATTTGGGATGGACATCTGATTTCAGGAAACTTTGGCTCTAGGTCAATTTTCTCGGCTCCAGGTATTTCTGCATTGGGACACCCCACTCAGTTGGAATATAAACAGGGAAGGCTGTTGATACCTTCTGTTTCTGGTTAATCTGCCCATCGGGGCTGCTAATCGCGGAGGAAGGATGTACCTGCCGGGGAAGTTGCTGCGTCTGTGGCTCCTGCTTCTTGTGGTTTTGACGCTGCTGCCAGCGTCCGGCTGGGCTTTGGTCTGCTTGCCCTGCGACGAATCCAAATGCGAGGAACCCAAGAATTGCCCGGGGAGTATAGTGCAGGGCATCTGCGGCTGCTGCTTCATGTGCGCCAGGC
  5   1   2      seed Brn3 5x   out                       CAAK10256.5p        AGAAGGAGCATGACAGGCAGGGCGCAGGGAGTGCGATCTTCTTGATCTCAGCTTTCAGCGATTTTATCGGACCTGTTGCCTGGTGCCTCTTAGTTGCCCATTGTTTCTATTATCCTTGGCTGCCCTGTTCGTACACAGGGATATCACCGGGAGGAATTTTTTTCCGCTTCCAATGAAAGAGGAGGAAGGAGGGAAAGAACTTTGATCGCAGGATAAAGGGAGACGCGCCGGAGCGCTGGATTGCGTCTGGATTTTTCGACCTGAGGGAAGTTGTCGCAAAACTCCGCTCCAGTGAAACTTTTCTCTGTATTTATTGTAAATGGTAGCGATCGGGGGCTCTGCGCGTATAATAACCATAATCATGCTACTCCTGGGGTATTTCCCAGTCTAGTCCGACTGTCGCATCCCCTCTGGATGCCCGCTTGGATTTGGGATGGACATCTGATTTCAGGAAACTTTGGCTCTAGGTCAATTTTCTCGGCTCCAGGTATTTCTGCATTGGGACACCCCACTCAGTTGGAATATAAACAGGGAAGGCTGTTGATACCTTCTGTTTCTGGTTAATCTGCCCATCGGGGCTGCTAATCGCGGAGGAAGGATGTACCTGCCGGGGAAGTTGCTGCGTCTGTGGCTCCTGCTTCTTGTGGTTTTGACGCTGCTGCCAGCGTCCGGCTGGGCTTTGGTCTGCTTGCCCTGCGACGAATCCAAATGCGAGGAACCCAAGAATTGCCCGGGGAGTATAGTGCAGGGCATCTGCGGCTGCTGCTTCATGTGCGCCAGGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)