Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN2727.3                            9 END     2         100       22                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012101749 Xt7.1-CAAN2727.5 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAN2727.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGACCCAACCCGTACAGTTTGTGAGGCATGCAACATCCGTTTTAGCCGTCATGACACATATGTAGTGCACAAACGTTACTACTGTGCATCACGACATGACCCGCCATTGCGTCGTAGTGGAGTAAACAAGACTGGGCCTCCATATGCCACTCAGCCAACTCCTCGCACAAGGAAACGGCGTAAGTTATATGAAATCCATGGTGTTGTTCCATCAGAATCCACTCCTCCCCAACCACATCCTCTTGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTAATACCTGCACCTGCTGTGCCTTCCCCGAGTTCTAGCCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGATTGGTGACAGAAGCACCAGTTCCATCTCCAGTAGCCACTGTAGCACCACTTGCTGACTACCATGAATGCACTGCATGTCGCATTAGTTTTAACAGCTTAGAAAGTTACTTAGCCCATAAAAAGTTTTCTTGCCCTACGGCACCTCTACAGCAAAAGGCCCTTCATCAGCTTCAGAAAGTTAAATCTCCTTCATCTGCCACAGGAAAGCTTGTAGATGATACTGTTAAAGTTAAAGTAAAAGTGGAAAGTAGGGCATCTATGAGCCCAGGATCTGTCAGTGAGACCACCCAACCTCTTGCTTTGCAACTCTCTGCTATCTCAGACCCCAAACAACTTAAGCATATTTCATCTGTCACAGAAACATCCCCACCTGCAACAACCACTTGTCCCTATTGTCCTCATAATGTGATAATAAGAGGAGACCTGCTTGAGCATTTTAGAAGTGTCCATGGTCTTTTGCTGGCAAAGCCAACTGCAGGGCATAGATTACAAACTACTTTTATGGAGGTGTTGGTGCCTGCTCGTGGGCAAACAAGCAGTGCATCAGAAAACAGTCTGCCAAGTCCACCAGTACCATCTGCTTCACCCCTTCAGCTGCCGGGTCTAAGGAGGGAGAATTCTAAACTACAAGATA
                                                  Xt7.1-CHK-1008259062                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAACCCGTACAGTTTGTGAGGCATGCAACATCCGTTTTAGCCGTCATGACACATATGTAGTGCACAAACGTTACTACTGTGCATCACGACATGACCCGCCATTGCGTCGTAGTGGAGTAAACAAGACTGGGCCTCCATATGCCACTCAGCCAACTCCTCGCACAAGGAAACGGCGTAAGTTATATGAAATCCATGGTGTTGTTCCATCAGAATCCACTCCTCCCCAACCACATCCTCTTGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTAATACCTGCACCTGCTGTGCCTTCCCCGAGTTCTAGCCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGATTGGTGACAGAAGCACCAGTTCCATCTCCAGTAGCCACTGTAGCACCACTTGCTGACTACCATGAATGCACTGCATGTCGCATTAGTTTTAACAGCTTAGAAAGTTACTTAGCCCATAAAAAGTTTTCTTGCCCTACGGCACCTCTACAGCAAAAGGCCCTTCATCAGCTTCAGAAAGTTAAATCTCCTTCATCTGCCACAGGAAAGCTTGTAGATGATACTGTTAAAGTTAAAGTAAAAGTGGAAAGTAGGGCATCTATGAGCCCAGGATCTGTCAGTGAGACCACCCAACCTCTTGCTTTGCAACTCTCTGCTATCTCAGACCCCAAACAACTTAAGCATATTTCATCTGTCACAGAAACATCCCCACCTGCAACAACCACTTGTCCCTATTGTCCTCATAATGTGATAATAAGAGGAGACCTGCTTGAGCATTTTAGAAGTGTCCATGGTCTTTTGCTGGCAAAGCCAACTGCAGGGCATAGATTACAAACTACTTTTATGGAGGTGTTGGTGCCTGCTCGTGGGCAAACAAGCAGTGCATCAGAAAACAGTCTGCCAAGTCCACCAGTACCATCTGCTTCACCCCTTCAGCTGCCGGGTCTAAGGAGGGAGAATTCTAAACTACAAGATACCACCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                       ...PREDICTED - ?? ---- 4e-039     XP_688986.1 PREDICTED: similar to FOG [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-046     NP_033595.1 zinc finger protein, multitype 1; Friend of GATA-1 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-046     NP_722520.2 zinc finger protein, multitype 1 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 3e-053     NP_001034549.1 zinc finger protein, multitype 1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 1e-055     XP_414197.2 PREDICTED: similar to FOG [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-167     AAF64473.1 Friend of GATA [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAN2727.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2       bld Tbd1      out                       CBXT22815.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGACCCAACCCGTACAGTTTGTGAGGCATGCAACATCCGTTTTAGCCGTCATGACACATATGTAGTGCACAAACGTTACTACTGTGCATCACGACATGACCCGCCATTGCGTCGTAGTGGAGTAAACAAGACTGGGCCTCCATATGCCACTCAGCCAACTCCTCGCACAAGGAAACGGCGTAAGTTATATGAAATCCATGGTGTTGTTCCATCAGAATCCACTCCTCCCCAACCACATCCTCTTGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTAATACCTGCACCTGCTGTGCCTTCCCCGAGTTCTAGCCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGATTGGTGACAGAAGCACCAGTTCCATCTCCAGTAGCCACTGTAGCACCACTTGCTGACTACCATGAATGCACTGCATGTCGCATTAGTTTTAACAGCTTAGAAAGTTACTTAGCCCATAAAAAGTTTTCTTGCCCTACGGCACCTCTACAGCAAAAGGCCCTTCATCAGCTTCAGAAAGTTAAATCTCCTTCATCTGCCACAGGAAAGCTTGTAGATGATACTGTTAAAGTTAAAGTAAAAGTGGAAAGTAGGGCATCTATGAGCCCAGGATCTGTCAGTGAGACCACCCAACCTCTTGCTTTGCAACTCTCTGCTATCTCAGACCCCAAACAACTTAAGCATATTTCATCTGTCACAGAAACATCCCCACCTGCAACAACCACTT
  5   1   2      seed Te4       out                        CAAN2727.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCATATGCCACTCAGCCAACTCCTCGCACAAGGAAACGGCGTAAGTTATATGAAATCCATGGTGTTGTTCCATCAGAATCCACTCCTCCCCAACCACATCCTCTTGGAAGGGTAGAAGCTATGGCACTGATGCCAGGTCTAATACCTGCACCTGCTGTGCCTTCCCCGAGTTCTAGCCCAGATGCTGCTGATGGGCCAATAGATCTAAGCAAGAAACCCCGATTGGTGACAGAAGCACCAGTTCCATCTCCAGTAGCCACTGTAGCACCACTTGCTGACTACCATGAATGCACTGCATGTCGCATTAGTTTTAACAGCTTAGAAAGTTACTTAGCCCATAAAAAGTTTTCTTGCCCTACGGCACCTCTACAGCAAAAGGCCCTTCATCAGCTTCAGAAAGTTAAATCTCCTTCATCTGCCACAGGAAAGCTTGTAGATGATACTGTTAAAGTTAAAGTAAAAGTGGAAAGTAGGGCATCTATGAGCCCAGGATCTGTCAGTGAGACCACCCAACCTCTTGCTTTGCAACTCTCTGCTATCTCAGACCCCAAACAACTTAAGCATATTTCATCTGTCACAGAAACATCCCCACCTGCAACAACCACTTGTCCCTATTGTCCTCATAATGTGATAATAAGAGGAGACCTGCTTGAGCATTTTAGAAGTGTCCATGGTCTTTTGCTGGCAAAGCCAACTGCAGGGCATAGATTACAAACTACTTTTATGGAGGTGTTGGTGCCTGCTCGTGGGCAAACAAGCAGTGCATCAGAAAACAGTCTGCCAAGTCCACCAGTACCATCTGCTTCACCCCTTCAGCTGCCGGGTCTAAGGAGGGAGAATTCTAAACTACAAGATACCACCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)