Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012101767 Xt7.1-CABA3364.5 - 2 ESTs
                                                                       -650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABA3364.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAAGCTGACCTAAACTGCATGGAAGATTTACTGCAGAGCAAAGTACTGTGGAAGTACCTTCTAAATACTTGTGGCACAGACTTCCCATTAAAGACTAATGCTGAAATTGTGAGAACCCTCAAATCATTAAATGGAAAAAATAGTATGGAGTCTGAGAAACCATCATCATCAAAAAAGACACGCTGGGAATTTCATTTTGAAGTGGGAGATTCTATATCAAAGACAGCTATTGAGAAATCCCCACCGCCGATTGACAGTCCAATGTTTACAGGCAACGCGTATATTGTGGTTTGCCGAAATTTCGTTGAACATATTTTTAACAATCCACAAGCTCTGACCTTGATAGAGTGGGTCAAGGATACATATAGCCCAGATGAACATTTATGGGCTACTCTTAATAGAATGCCAGGAGTACCAGGGTCTTCTCCTTACAGCGATAAATATGAAAAATCAGATATGAATGCAGTGGCCAGAATGGTAAAGTGGGGGTACATGGAAGGGGACATTGCAAAGGGAGCACCTTACCCACCATGCACAGGTACACACAGGAGGTCAATTTGTGTGTATGGTACTGGGGATCTATATTGGTTGCTGGAACAGCATCATGTGTTGGCCAACAAGTTTGATCCTAAAGTTGACAACATTGCTCTTGAATGCCTTGAAGAATATTTAAGACACAAAACTGTTTATGGAAAAGGACTTTAATGTAAGGGGAGCATTACAGAGAAAATGTTGCAAATGATCAACCCTTATTGCAGACAAAAACCTAAGAGGAGTTTGTTTACCTTAAGCCCTGACTACAGAGTGGGACTGTCCATCATTTTATAATAAGACGTATATAATGCATATATATCTATATATACACATTCCATGTTTTTAAGTGACTTTTTTTCCCTATTCATTAAATCTAGGTTATGTATTGGTTGTAATAATTTATGTTATATTGATTTCAGGTCATTGAATTTGAGTTTAGGAAATCAGCAGTGGAGCCATAC
                                                  Xt7.1-CHK-1008259350                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGACCTAAACTGCATGGAAGATTTACTGCAGAGCAAAGTACTGTGGAAGTACCTTCTAAATACTTGTGGCACAGACTTCCCATTAAAGACTAATGCTGAAATTGTGAGAACCCTCAAATCATTAAATGGAAAAAATAGTATGGAGTCTGAGAAACCATCATCATCAAAAAAGACACGCTGGGAATTTCATTTTGAAGTGGGAGATTCTATATCAAAGACAGCTATTGAGAAATCCCCACCGCCGATTGACAGTCCAATGTTTACAGGCAACGCGTATATTGTGGTTTGCCGAAATTTCGTTGAACATATTTTTAACAATCCACAAGCTCTGACCTTGATAGAGTGGGTCAAGGATACATATAGCCCAGATGAACATTTATGGGCTACTCTTAATAGAATGCCAGGAGTACCAGGGTCTTCTCCTTACAGCGATAAATATGAAAAATCAGATATGAATGCAGTGGCCAGAATGGTAAAGTGGGGGTACATGGAAGGGGACATTGCAAAGGGAGCACCTTACCCACCATGCACAGGTACACACAGGAGGTCAATTTGTGTGTATGGTACTGGGGATCTATATTGGTTGCTGGAACAGCATCATGTGTTGGCCAACAAGTTTGATCCTAAAGTTGACAACATTGCTCTTGAATGCCTTGAAGAATATTTAAGACACAAAACTGTTTATGGAAAAGGACTTTAATGTAAGGGGAGCATTACAGAGAAAATGTTGCAAATGATCAACCCTTATTGCAGACAAAAACCTAAGAGGAGTTTGTTTACCTTAAGCCCTGACTACAGAGTGGGACTGTCCATCATTTTATAATAAGACGTATATAATGCATATATATCTATATATACACATTCCATGTTTTTAAGTGACTTTTTTTCCCTATTCATTAAATCTAGGTTATGTATTGGTTGTAATAATTTATGTTATATTGATTTCAGGTCATTGAATTTGAGTTTAGGAAATCAGCAGTGGAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                PROTEIN --- Ce ---- 2e-015     NP_496345.1 GLYcosylation related, Serpentine Receptor, class A (alpha) (55.4 kD) (gly-1) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 8e-052     XP_784257.1 PREDICTED: similar to glucosaminyl (N-acetyl) transferase 2 isoform C [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Dr ---- 4e-065     NP_963877.1 core 2 beta-1,6-N-acetylglucosaminyltransferase 3 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                              PROTEIN --- Xl ---- 4e-090     AAH86270.1 LOC495681 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                              PREDICTED - ?? ---- 4e-090     NP_001088629.1 hypothetical protein LOC495681 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN --- Hs ---- 3e-092     NP_004742.1 glucosaminyl (N-acetyl) transferase 3, mucin type [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PREDICTED - Gg ---- 1e-092     XP_425064.2 PREDICTED: similar to core 2 beta-1,6-N-acetylglucosaminyltransferase [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 1e-092     NP_082363.1 glucosaminyl (N-acetyl) transferase 3, mucin type [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABA3364.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------ATG------ATG------------------------------------------------------------------------------------TAATAA---------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2       bld Kid1      in                         CABA3364.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAAGCTGACCTAAACTGCATGGAAGATTTACTGCAGAGCAAAGTACTGTGGAAGTACCTTCTAAATACTTGTGGCACAGACTTCCCATTAAAGACTAATGCTGAAATTGTGAGAACCCTCAAATCATTAAATGGAAAAAATAGTATGGAGTCTGAGAAACCATCATCATCAAAAAAGACACGCTGGGAATTTCATTTTGAAGTGGGAGATTCTATATCAAAGACAGCTATTGAGAAATCCCCACCGCCGATTGACAGTCCAATGTTTACAGGCAACGCGTATATTGTGGTTTGCCGAAATTTCGTTGAACATATTTTTAACAATCCACAAGCTCTGACCTTGATAGAGTGGGTCAAGGATACATATAGCCCAGATGAACATTTATGGGCTACTCTTAATAGAATGCCAGGAGTACCAGGGTCTTCTCCTTACAGCGATAAATATGAAAAATCAGATATGAATGCAGTGGCCAGAATGGTAAAGTGGGGGTACATGGAAGGGGACATTGCAAAGGGAGCACCTTACCCACCATGCACAGGTACACACAGGAGGTCAATTTGTGTGTATGGTACTGGGGATCTATATTGGTTGCTGGAACAGCATCATGTGTTGGCCAACAAGTTTGATCCTAAAGTTGACAACATTGCTCTTGAATGCCTTGAAGAATATTTAAGACACAAAACTGTTTATGGAAAAGGACTTTAATGTAAGGGGAGCATTACAGAGAAAATGTTGCAAATGATCAACCCTTATTGCAGACAAAAACCTAAGAGGAGTTTGTTTACCTTAAGCCCTGACTACAGAGTGGGACTGTCCATCATTTTATAATAAGACGTATATAATGCATATATATCTATATATACACATTCCATGTTTTTAAGTGACTTTTTTTTCCTATTCATAAATCTAGGT
  3   1   2      seed Kid1      in                         CABA3364.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATAGTATGGAGTCTGAGAAACCATCATCATCAAAAAAGACACGCTGGGAATTTCATTTTGAAGTGGGAGATTCTATATCAAAGACAGCTATTGAGAAATCCCCACCGCCGATTGACAGTCCAATGTTTACAGGCAACGCGTATATTGTGGTTTGCCGAAATTTCGTTGAACATATTTTTAACAATCCACAAGCTCTGACCTTGATAGAGTGGGTCAAGGATACATATAGCCCAGATGAACATTTATGGGCTACTCTTAATAGAATGCCAGGAGTACCAGGGTCTTCTCCTTACAGCGATAAATATGAAAAATCAGATATGAATGCAGTGGCCAGAATGGTAAAGTGGGGGTACATGGAAGGGGACATTGCAAAGGGAGCACCTTACCCACCATGCACAGGTACACACAGGAGGTCAATTTGTGTGTATGGTACTGGGGATCTATATTGGTTGCTGGAACAGCATCATGTGTTGGCCAACAAGTTTGATCCTAAAGTTGACAACATTGCTCTTGAATGCCTTGAAGAATATTTAAGACACAAAACTGTTTATGGAAAAGGACTTTAATGTAAGGGGAGCATTACAGAGAAAATGTTGCAAATGATCAACCCTTATTGCAGACAAAAACCTAAGAGGAGTTTGTTTACCTTAAGCCCTGACTACAGAGTGGGACTGTCCATCATTTTATAATAAGACGTATATAATGCATATATATCTATATATACACATTCCATGTTTTTAAGTGACTTTTTTTCCCTATTCATTAAATCTAGGTTATGTATTGGTTGTAATAATTTATGTTATATTGATTTCAGGTCATTGAATTTGAGTTTAGGAAATCAGCAGTGGAGCCATACAATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)