Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     1  36.0    0(repeat)                                    0 REP     79        811     1071                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012102090 Xt7.1-XZT8284.5 - 4 ESTs
                                                                       -920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-XZT8284.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGTGATGAAGACCGACTCAGACATGTTTCGTTAACACCTTCTACCTGGTCCAACTGCTGGCAAAGAAAAACCAGTCTTCTAATTTTTTTACTGGGTTTCTCAAACTGAACGAGTACCCGATAAGGAATATCTTCAGCAAGTGGTACGCCAGTAAAAGGGAATACCCAGGGGCCAAGTACCCTCCATTTTGTTCGGGGACTGGATACGTCTTTTCTGTAGACGTCGCCAAAAAGATCCACAACATCTCCACGACAGTGCCGTTTTTCAAACTGGAGGACGTCTATTTGGGGCTATGTCTTGACATATTGGACATTCACTTGGAGGAACTTCATACAGAGCAGACATTCTTTGCAGAGAGGCAGTCATTCTCCGTTTGCAAATACAGTAAACTTGTCACGTCCCATGGAGTCAAACCATATGAGAACATTGTATACTGGAATCTACTTCAACGGCCAACAAGTGAAAAATGCTAATAACAGGGCTGTGTATTGTGTCCTACGGAGGCTGAGCTCACCATGGCATCATTGTTGATGTCCTTGGAAGGCTCTCCTTGGCTTTGGTTGTCACAATCCAAACTGCAAGACATTGGATTTACCTATAACCCACAGGGGCTTGAAAAGACTTATCAGCCCCATGATGTGGTTCACTTGTAGGGTGTAGAGACAATGTGACCAAAGTTTTTGTTTCGTTTCACACTGACACTAAATTCTTTCTCTCAGTGGGTCTAGTACCTTGATATCAAACTCAGTGACTACACTGTTGAATGCACCTCCATATGAGGAGAAACTGTGTTTGAAGACAGGGGAGGCCTAGACAAGTGTTCCCCAACCAATGGCTCGGGAACAATGTGTTTCTCACCAACCCCTTGGATGTTGTTCCCACTGGCCCCAAAGCAGGGGCTTATTTTTTTTGAAGACAGGTTTTAGTTGCATAAAAAACAGGTGTACTGGCAAACAGAGCCTCCTATAGGCTGTCTGTCCACATAGGGGCTACCAAATAGCCAATCAGAGCTCTTATTTGGTACCTCCAGGTACATTTTTCATGATTGTGTTGCTTTCCAACTCTTTTGGCTGCATAAAAACCAGGTGTACTGGCAAACAGAGCCTCCTATAGGCTGTCAGTCCACATAGGGGCTACCAAATAGCCAATCAGAGCCCTTATTTGGTACCTCCAGATACATTTTTCATGATTGTGTTGCTTCCCAACTCTTTTGGCTGCATAAAAACCAGGTGTACTGGCAAACAGAGCCTCCTATAGGCTGTCCGTCCACATAGGGGCTACCAAATAGCCAATCAGAGCCCTTCTTTGGTACCTCCCGGTACATTTTTCATGATTGTGTTGCTTCCCAACTCTTTTGGCTGCATAAAAACCAGGTGTACTGGCAAACAGAGCCTCCTATAGGCTGTCAGTCCACATATTTGGCTACCAAATAGCCAAT
                                                  Xt7.1-CHK-1008245422                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGAAGACCGACTCAGACATGTTTCGTTAACACCTTCTACCTGGTCCAACTGCTGGCAAAGAAAAACCAGTCTTCTAATTTTTTTACTGGGTTTCTCAAACTGAACGAGTACCCGATAAGGAATATCTTCAGCAAGTGGTACGCCAGTAAAAGGGAATACCCAGGGGCCAAGTACCCTCCATTTTGTTCGGGGACTGGATACGTCTTTTCTGTAGACGTCGCCAAAAAGATCCACAACATCTCCACGACAGTGCCGTTTTTCAAACTGGAGGACGTCTATTTGGGGCTATGTCTTGACATATTGGACATTCACTTGGAGGAACTTCATACAGAGCAGACATTCTTTGCAGAGAGGCAGTCATTCTCCGTTTGCAAATACAGTAAACTTGTCACGTCCCATGGAGTCAAACCATATGAGAACATTGTATACTGGAATCTACTTCAACGGCCAACAAGTGAAAAATGCTAATAACAGGGCTGTGTATTGTGTCCTACGGAGGCTGAGCTCACCATGGCATCATTGTTGATGTCCTTGGAAGGCTCTCCTTGGCTTTGGTTGTCACAATCCAAACTGCAAGACATTGGATTTACCTATAACCCACAGGGGCTTGAAAAGACTTATCAGCCCCATGATGTGGTTCACTTGTAGGGTGTAGAGACAATGTGACCAAAGTTTTTGTTTCGTTTCACACTGACACTAAATTCTTTCTCTCAGTGGGTCTAGTACCTTGATATCAAACTCAGTGACTACACTGTTGAATGCACCTCCATATGAGGAGAAACTGTGTTTGAAGACAGGGGAGGCCTAGACAAGTGTTCCCCAACCAATGGCTCGGGAACAATGTGTTTCTCACCAACCCCTTGGATGTTGTTCCCACTGGCCCCAAAGCAGGGGCTTATTTTTTTTGAAGACAGGTTTTAGTTGCATAAAAAACAGGTGTACTGGCAAACAGAGCCTCCTATAGGCTGTCTGTCCACATAGGGGCTACCAAATAGCCAATCAGAGCTCTTATTTGGTACCTCCAGGTACATTTTTCATGATTGTGTTGCTTTCCAACTCTTTTGGCTGCATAAAAACCAGGTGTACTGGCAAACAGAGCCTCCTATAGGCTGTCAGTCCACATAGGGGCTACCAAATAGCCAATCAGAGCCCTTATTTGGTACCTCCAGATACATTTTTCATGATTGTGTTGCTTCCCAACTCTTTTGGCTGCATAAAAACCAGGTGTACTGGCAAACAGAGCCTCCTATAGGCTGTCCGTCCACATAGGGGCTACCAAATAGCCAATCAGAGCCCTTCTTTGGTACCTCCCGGTACATTTTTCATGATTGTGTTGCTTCCCAACTCTTTTGGCTGCATAAAAACCAGGTGTACTGGCAAACAGAGCCTCCTATAGGCTGTCAGTCCACATATTTGGCTACCAAATAGCCAATCGGAGC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               BLH MIN      28      37                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 8e-009     BAB00622.1 Not3 [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================
                                                                                                           PROTEIN --- Dm ---- 3e-011     NP_788328.1 CG33145-PB [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 9e-023     XP_780484.1 PREDICTED: similar to Beta-1,3-galactosyltransferase 1 (Beta-1,3-GalTase 1) (Beta3GalT1) (UDP-galactose:beta-N-acetyl-glucosamine-beta-1,3-galactosyltransferase 1) (UDP-Gal:betaGlcNAc beta 1,3-galactosyltranferase-I) [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                PREDICTED - Dr ---- 2e-030     NP_996984.1 hypothetical protein zgc:76904 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xt ---- 1e-030     AAH75347.1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PROTEIN --- Xl ---- 7e-031     AAH80111.1 MGC84681 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PROTEIN --- ?? ---- 7e-031     NP_001087567.1 MGC84681 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PREDICTED - Gg ---- 1e-042     XP_425555.2 PREDICTED: similar to UDP-Gal:GlcNAc beta1,3-galactosyltransferase 5 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Mm ---- 2e-045     NP_149161.1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 6e-048     NP_006048.1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase 5 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-XZT8284.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGATGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATAA---------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------TAG------------ATGTGA------------------------------------------------------TAG------------------------------------------------TGA------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------TAG---------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------TAG
  5   1   2      skin HdA                            THdA011n08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGTGATGAAGACCGACTCAGACATGTTTCGTTAACACCTTCTACCTGGTCCAACTGCTGGCAAAGAAAAACCAGTCTTCTAATTTTTTTACTGGGTTTCTCAAACTGAACGAGTACCCGATAAGGAATATCTTCAGCAAGTGGTACGCCAGTAAAAGGGAATACCCAGGGGCCAAGTACCCTCCATTTTGTTCGGGGACTGGATACGTCTTTTCTGTAGACGTCGCCAAAAAGATCCACAACATCTCCACGACAGTGCCGTTTTTCAAACTGGAGGACGTCTATTTGGGGCTATGTCTTGACATATTGGACATTCACTTGGAGGAACTTCATACAGAGCAGACATTCTTTGCAGAGAGGCAGTCATTCTCCGTTTGCAAATACAGTAAACTTGTCACGTCCCATGGAGTCAAACCATATGAGAACATTGTATACTGGAATCTACTTCAACGGCCAACAAGTGAAAAATGCTAATAACAGGGCTGTGTATTGTGTCCTACGGAGGCTGAGCTCACCATGGCATCATTGTTGATGTCCTTGGAAGGCTCTCCTTGGCTTTGGTTGTCACAATCCAAACTGCAAGACATTGGATTTACCTATAACCCACAGGGGCTTGAAAAGACTTATC
  5   1   2      seed Tad5      ?                           XZT8284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAGCAGACATTCTTTGCGGAGAGGCAGTCATTTTCTCCGTTTGCAAATACAGTAAACTTGTCACGTCCCATGGAGTCAAACCATATGAGAACATTGTATACTGGAATCTACTTCAACGGCCAACAAGTGAAAAATGCTAATAACAGGGCTGTGTATTGTGTCCTACGGAGGCTGAGCTCACCATGGCATCATTGTTGATGTCCTTGGAAGGCTCTCCTTGGCTTTGGTTGTCACAATCCAAACTGCAAGACATTGGATTTACCTATAACCCACAGGGGCTTGAAAAGACTTATCAGCCCCATGATGTGGTTCACTTGTAGGGTGTAGAGACAATGTGACCAAAGTTTTTGTTTCGTTTCACACTGACACTAAATTCTTTCTCTCAGTGGGTCTAGTACCTTGATATCAAACTCAGTGACTACACTGTTGAATGCACCTCCATATGAGGAGAAACTGTGTTTGAAGACAGGGGAGGCCTagacaagtgttccccaaccaatggctcgggaacaatgtgtttctcaccaaccccttggatgttgttcccactggccccaaagcaggggcttattttttttgaagacaggttttagttgcataaaaaacaggtgtactggcaaacagagcctcctataggctgtctgtccacataggggctaccaaatagccaatcagagctcttatttggtacctccaggtacatttttcatgattgtgttgctttccaactcttttggctgcataaaaaccangtgtactggcaaacagagcctcctataggctgtcagtccacataggggctaccaaatagccaatcagagcccttatttggtacctccagatacatttttcatgaatgtgttgcttcccaactcttttGGCTGCATAAAAACCAGGTGTACTGGC
  5   1   2       bld HdA                            THdA011n07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACGGCCTGCAAGTGAAAAATGCTAATAGCGGGGCTGTGTATTGTGTCCTACGGAGGCTGAGCTCACCATGGCATCATTGTTGATGTCCTTGGAAGGCTCTCCTTGGCTTTGGTTGTCACAATCCAAACTGCAAGACATTGGATTTACCTATAACCCACAGGGGCTTGAAAAGACTTATCANCCCCATGATGT
  5  -1   2       bld Gas8      out                         st15o21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTAGTACCTTGATATCAAACTCAGTGACTACACTGTTGAATGCACCTCCATATGAGGAGAAACTGTGTTTGAAGACAGGGGAGGCCTAGACAAGTGTTCCCCAACCAATGGCTCGGGAACAATGTGTTTCTCACCAACCCCTTGGATGTTGTTCCCACTGGCCCCAAAGCAGGGGCTTATTTTTTTTGAAGACAGGTTTTAGTTGCATAAAAAACAGGTGTACTGGCAAACAGAGCCTCCTATAGGCTGTCTGTCCACATAGGGGCTACCAAATAGCCAATCAGAGCTCTTATTTGGTACCTCCAGGTACATTTTTCATGATTGTGTTGCTTTCCAACTCTTTTGGCTGCATAAAAACCAGGTGTACTGGCAAACAGAGCCTCCTATAGGCTGTCAGTCCACATAGGGGCTACCAAATAGCCAATCAGAGCCCTTATTTGGTACCTCCAGATACATTTTTCATGATTGTGTTGCTTCCCAACTCTTTTGGCTGCATAAAAACCAGGTGTACTGGCAAACAGAGCCTCCTATAGGCTGTCCGTCCACATAGGGGCTACCAAATAGCCAATCAGAGCCCTTCTTTGGTACCTCCCGGTACATTTTTCATGATTGTGTTGCTTCCCAACTCTTTTGGCTGCATAAAAACCAGGTGTACTGGCAAACAGAGCCTCCTATAGGCTGTCAGTCCACATATTTGGCTACCAAATAGCCAATCGGAGCCCTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)