Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012102108 Xt7.1-CAAR7006.5 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAR7006.5 CTGGATTAGACTTCATCTTTAATTGTAATTCTAATTTTGGATAGCGGCATTGTCTTTGTTTTTGAATTAGCTTGTAATAACCCAGAAATAAATGCAAAATGTGTGATCCAGTCATGGAGTTGTTACACGTGTCAGTGTCTGGCAGAACTGTTTGCACTCCCTGACTAGAACGTAATGGGTTGTACCTATACTTTTATGCATAATGAAGAGCTGGCACATGAAAAGTATATGAGTGTACAATGCACACAAGCAGCTTCAGAAACGGTGTACATTAGGCTTTCTGCTTATTGTATTAGCCCAGCAATACAACATTCCATCTTTCCATGTATGGTCTAAGGAGCAGCCCATCTTTATTCTCAGCATGGATCAACTCACAATATATTGAGAAGAAATTAAGTTTATATTTGTCAAATGTAAGGACAAGCAACAGGTTTGTGCAAAGATAGCAAGTAATTCCCTTCACTGCTAGTAGAGGTGCCAACTTTTCTTGTAAAAATTACAATATTAGTACTATTGATATAAGTATTGTATATAATTAAACTGCAAGCTTTTGTGAACCTAATTGTGCCTGATAAACTTTACGATGAA
                                                  Xt7.1-CHK-1008256187       TAGACTTCATCTTTAATTGTAATTCTAATTTTGGATAGCGGCATTGTCTTTGTTTTTGAATTAGCTTGTAATAACCCAGAAATAAATGCAAAATGTGTGATCCAGTCATGGAGTTGTTACACGTGTCAGTGTCTGGCAGAACTGTTTGCACTCCCTGACTAGAACGTAATGGGTTGTACCTATACTTTTATGCATAATGAAGAGCTGGCACATGAAAAGTATATGAGTGTACAATGCACACAAGCAGCTTCAGAAACGGTGTACATTAGGCTTTCTGCTTATTGTATTAGCCCAGCAATACAACATTCCATCTTTCCATGTATGGTCTAAGGAGCAGCCCATCTTTATTCTCAGCATGGATCAACTCACAATATATTGAGAAGAAATTAAGTTTATATTTGTCAAATGTAAGGACAAGCAACAGGTTTGTGCAAAGATAGCAAGTAATTCCCTTCACTGCTAGTAGAGGTGCCAACTTTTCTTGTAAAAATTACAATATTAGTACTATTGATATAAGTATTGTATATAATTAAACTGCAAGCTTTTGTGAACCTAATTGTGCCTGATAAACTTTAC
                                                      consensus depths      2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                      Xt7.1-CAAR7006.5       TAG------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------ATG------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------ATG---TAA---------------------------------------------------------TAA---------------ATGTAA---------------------------------TAA------------------------------------------------------------------TAA
  3   1   2      seed Liv1      in                         CAAR7006.3p CTGGATTAGACTTCATCTTTAATTGTAATTCTAATTTTGGATAGCGGCATTGTCTTTGTTTTTGAATTAGCTTGTAATAACCCAGAAATAAATGCAAAATGTGTGATCCAGTCATGGAGTTGTTACACGTGTCAGTGTCTGGCAGAACTGTTTGCACTCCCTGACTAGAACGTAATGGGTTGTACCTATACTTTTATGCATAATGAAGAGCTGGCACATGAAAAGTATATGAGTGTACAATGCACACAAGCAGCTTCAGAAACGGTGTACATTAGGCTTTCTGCTTATTGTATTAGCCCAGCAATACAACATTCCATCTTTCCATGTATGGTCTAAGGAGCAGCCCATCTTTATTCTCAGCATGGATCAACTCACAATATATTGAGAAGAAATTAAGTTTATATTTGTCAAATGTAAGGACAAGCAACAGGTTTGTGCAAAGATAGCAAGTAATTCCCTTCACTGCTAGTAGAGGTGCCAACTTTTCTTGTAAAAATTACAATATTAGTACTATTGATATAAGTATTGTATATAATTAAACTGCAAGCTTTTGTGAACCTAATTGTGCCTGATAAACTTTACGATGAACGAC
  5   1   2       bld Liv1      in                         CAAR7006.5p CTGGATTAGACTTCATCTTTAATTGTAATTCTAATTTTGGATAGCGGCATTGTCTTTGTTTTTGAATTAGCTTGTAATAACCCAGAAATAAATGCAAAATGTGTGATCCAGTCATGGAGTTGTTACACGTGTCAGTGTCTGGCAGAACTGTTTGCACTCCCTGACTAGAACGTAATGGGTTGTACCTATACTTTTATGCATAATGAAGAGCTGGCACATGAAAAGTATATGAGTGTACAATGCACACAAGCAGCTTCAGAAACGGTGTACATTAGGCTTTCTGCTTATTGTATTAGCCCAGCAATACAACATTCCATCTTTCCATGTATGGTCTAAGGAGCAGCCCATCTTTATTCTCAGCATGGATCAACTCACAATATATTGAGAAGAAATTAAGTTTATATTTGTCAAATGTAAGGACAAGCAACAGGTTTGTGCAAAGATAGCAAGTAATTCCCTTCACTGCTAGTAGAGGTGCCAACTTTTCTTGTAAAAATTACAATATTAGTACTATTGATATAAGTATTGTATATAATTAAACTGCAAGCTTTTGTGAACCTAATTGTGCCTGATAAACTTTACGATGAACGACAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)