Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBSU5451.5                            2 END     2         100      100                PREDICTED: hypothetical protein [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012102247 Xt7.1-CBSW3509.3 - 2 ESTs
                                                                       .........-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBSW3509.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATGGCAGCTAGTTATTATCATTCTAACAAACATTGGGCAGCAACTCAGTGGAATTAACGCGATTTACTTCTATGCAGCATATGTGTTTACAAAAGCTGGAATCCCTGCTAACAATATTCCTTATGTGACACTGGGAACAGGGCTTTGTGAATGTCTCACTGCTCTGACCTGTGGTCTGCTTATAGACATTGCAGGAAGAAGGATCCTTATTATTGGAGGATACACACTGATGGCATTTTGGTGTACTATACTGACACTGACGCTAACATTTCAGGATGTATATCCTTGGATACCATATCTAAGCATGAGTGCAGTGTTTGCATTTATATTGAGCTTTGGATTAGGGCCAGGGGGTGTTACAAATACCCTTACTGCAGAATTATTCACTCAGTCTTCTCGTTCTGCGGCATTCAGGATATCGGGCTCTGTAGGCTGGATAACGTTCTTTACCATAGGGATGATTTTTCCATTTTTAGTAAATGGACTCAACCAGTATTGTTTCCTGTTTTTCTTTGTGGAGTGCCTTTTAACAGCAAGTTTTATATTTTTTATTGTGCCTGAGACAAAAAACAAATCATTTCTCGAAATCAAAAAGGAATTCCAAAAGCGCAATGTCGGGCAGTCTTACCCGAGTCCAGAAGATGAACCAGATAATCTGGAACTTCATATGTAGCAATCTGTGCTCACAATATATATCTGATATCAAATACAGGAATAATAAACCGAACAGCTCACTATAGGGATTCAAATAAACTAAAGATATGTAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008256006                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCTAGTTATTATCATTCTAACAAACATTGGGCAGCAACTCAGTGGAATTAACGCGATTTACTTCTATGCAGCATATGTGTTTACAAAAGCTGGAATCCCTGCTAACAATATTCCTTATGTGACACTGGGAACAGGGCTTTGTGAATGTCTCACTGCTCTGACCTGTGGTCTGCTTATAGACATTGCAGGAAGAAGGATCCTTATTATTGGAGGATACACACTGATGGCATTTTGGTGTACTATACTGACACTGACGCTAACATTTCAGGATGTATATCCTTGGATACCATATCTAAGCATGAGTGCAGTGTTTGCATTTATATTGAGCTTTGGATTAGGGCCAGGGGGTGTTACAAATACCCTTACTGCAGAATTATTCACTCAGTCTTCTCGTTCTGCGGCATTCAGGATATCGGGCTCTGTAGGCTGGATAACGTTCTTTACCATAGGGATGATTTTTCCATTTTTAGTAAATGGACTCAACCAGTATTGTTTCCTGTTTTTCTTTGTGGAGTGCCTTTTAACAGCAAGTTTTATATTTTTTATTGTGCCTGAGACAAAAAACAAATCATTTCTCGAAATCAAAAAGGAATTCCAAAAGCGCAATGTCGGGCAGTCTTACCCGAGTCCAGAAGATGAACCAGATAATCTGGAACTTCATATGTAGCAATCTGTGCTCACAATATATATCTGATATCAAATACAGGAATAATAAACCGAACAGCTCACTATAGGGATTCAAATAAACTAAAGATATGTAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1
                                                                                                     PREDICTED - Sc ---- 4e-015     NP_009800.1 Hypothetical ORF; Ybr241cp [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ce ---- 9e-029     NP_503413.2 glucose transporter X family member (57.6 kD) (5B919) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PROTEIN --- Dm ---- 6e-031     NP_523878.1 Glucose transporter 1 CG1086-PB [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PREDICTED - Sp ---- 6e-038     XP_001177177.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PREDICTED - ?? ---- 1e-048     NP_001085161.1 hypothetical protein LOC432243 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN --- Xl ---- 2e-052     AAH85081.1 LOC495492 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN --- Xt ---- 5e-053     NP_001008187.1 slc2a5-prov protein [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN --- Mm ---- 3e-056     NP_001012363.1 solute carrier family 2, member 9 isoform a [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                PROTEIN --- Hs ---- 5e-057     NP_001001290.1 solute carrier family 2, member 9 protein isoform 2; human glucosetransporter-like protein-9 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                      PREDICTED - Dr ---- 9e-064     XP_693381.1 PREDICTED: similar to Solute carrier family 2, facilitated glucose transporter, member 11 (Glucose transporter type 11) (Glucose transporter type 10) [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PREDICTED - Gg ---- 4e-087     XP_415207.2 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBSW3509.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAG------------------------TGA---------------TAATAA---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  3   1   2      seed Limb      out                       CBSU5451.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATGGCAGCTAGTTATTATCATTCTAACAAACATTGGGCAGCAACTCAGTGGAATTAACGCGATTTACTTCTATGCAGCATATGTGTTTACAAAAGCTGGAATCCCTGCTAACAATATTCCTTATGTGACACTGGGAACAGGGCTTTGTGAATGTCTCACTGCTCTGACCTGTGGTCTGCTTATAGACATTGCAGGAAGAAGGATCCTTATTATTGGAGGATACACACTGATGGCATTTTGGTGTACTATACTGACACTGACGCTAACATTTCAGGATGTATATCCTTGGATACCATATCTAAGCATGAGTGCAGTGTTTGCATTTATATTGAGCTTTGGATTAGGGCCAGGGGGTGTTACAAATACCCTTACTGCAGAATTATTCACTCAGTCTTCTCGTTCTGCGGCATTCAGGATATCGGGCTCTGTAGGCTGGATAACGTTCTTTACCATAGGGATGATTTTTCCATTTTTAGTAAATGGACTCAACCAGTATTGTTTCCTGTTTTTCTTTGTGGAGTGCCTTTTAACAGCAAGTTTTATATTTTTTATTGTGCCTGAGACAAAAAACAAATCATTTCTCGAAATCAAAAAGGAATTCCAAAAGCGCAATGTCGGGCAGTCTTACCCGAGTCCAGAAGATGAACCAGATAATCTGGAACTTCATATGTAGCAATCTGTGCTCACAATATATATCTGATATCAAATACAGGAATAATAAACCGAACAGCTCACTATAGGGATTCAAATAAACTAAAGATATTGTACATAC
  3   1   2       bld Tail PIPE out                        CBSW3509.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTTATAGACATTGCAGGAAGAAGGATCCTTATTATTGGAGGATACACACTGATGGCATTTTGGTGTACTATACTGACACTGACGCTAACATTTCAGGATGTATATCCTTGGATACCATATCTAAGCATGAGTGCAGTGTTTGCATTTATATTGAGCTTTGGATTAGGGCCAGGGGGTGTTACAAATACCCTTACTGCAGAATTATTCACTCAGTCTTCTCGTTCTGCGGCATTCAGGATATCGGGCTCTGTAGGCTGGATAACGTTCTTTACCATAGGGATGATTTTTCCATTTTTAGTAAATGGACTCAACCAGTATTGTTTCCTGTTTTTCTTTGTGGAGTGCCTTTTAACAGCAAGTTTTATATTTTTTATTGTGCCTGAGACAAAAAACAAATCATTTCTCGAAATCAAAAAGGAATTCCAAAAGCGCAATGTCGGGCAGTCTTACCCGAGTCCAGAAGATGAACCAGATAATCTGGAACTTCATATGTAGCAATCTGTGCTCACAATATATATCTGATATCAAATACAGGAATAATAAACCGAACAGCTCACTATAGGGATTCAAATAAACTAAAGATATGTAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)