Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN9028.5                           10 END     1          50       11                Unknown (protein for MGC:122132) [Xenopus tropicalis]
     2   2.0    0Xt7.1-CAAK7725.3                            7 END     1          50       14                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012102943 Xt7.1-CAAM13885.3 - 2 ESTs
                                                                       .....-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAM13885.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACAGACCAGAGAGTTGCAAAGCTCCTAGTAAATTGGTGGAACCAGAAGTTCAAGCTATGACAGCCATAGGCAACATCCCAGGCAGGATTCCCCAGCACCAGCCACATCCTGTCATGACTTTGTCATTACAATCCATTCCCTTGCACCATCAGATCCAGACCCAGGCCAGGATAGCATCAGGTTCTCCAGCCCCAGCACAGAGCCCTCCTGTTCACTCTGTTCCAGACATGACCCACAGTCCCCTTCAACAGCACATCATGAGCAGGGCTGCTTCTGACTTTCTTAGCCTCACCTCAGACATGAACACAGAGGTTGATGCCCTTGATCCTAGCATCATGGACTTTGCGCTACAAGGAAACATATGGGAGGACATGAAGGATGAGAGCTTCAGTCTGGACACATTAGGAGCCTTCAGCAATTCCCCTCTCCAACTTTCAGACTGTGATTTGGGAACCATTGGCCTAACCCCTGTGTCTAGCAGTGGGGATCATTCTTTCTCAGACTTTCAGGTTACCAGCCTGTACACTACATATCCAGCTATGGAAAATGTGGCACCTTCCCAGTGTGTGACTGGATCAGGAACCAAGCCTATAGCTTTGCTTTAATAGTTGGACATCATGCATTTAAAGCCACTGTGATGACTTCTGGGTGCAGTGCCAGGGGTGAAGATGAGCAACTGATGGTGTTTAGGGTGCTTTATGAATACTGGGAAACGAAACACTTGCACAATCCACCCTGCCGCCAGCAATCTGCAAAACAAGAAGCCTCCTGAACAACACAAAGCATCATTTTTTCATTTTTACTGTACGGTTATTATTGCCATTGCTGCCTCTAGATCTAGTTTTTCAGTTGGACATAAAATTAAAATATTGCA
                                                  Xt7.1-CHK-1008258313                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCAGAGAGTTGCAAAGCTCCTAGTAAATTGGTGGAACCAGAAGTTCAAGCTATGACAGCCATAGGCAACATCCCAGGCAGGATTCCCCAGCACCAGCCACATCCTGTCATGACTTTGTCATTACAATCCATTCCCTTGCACCATCAGATCCAGACCCAGGCCAGGATAGCATCAGGTTCTCCAGCCCCAGCACAGAGCCCTCCTGTTCACTCTGTTCCAGACATGACCCACAGTCCCCTTCAACAGCACATCATGAGCAGGGCTGCTTCTGACTTTCTTAGCCTCACCTCAGACATGAACACAGAGGTTGATGCCCTTGATCCTAGCATCATGGACTTTGCGCTACAAGGAAACATATGGGAGGACATGAAGGATGAGAGCTTCAGTCTGGACACATTAGGAGCCTTCAGCAATTCCCCTCTCCAACTTTCAGACTGTGATTTGGGAACCATTGGCCTAACCCCTGTGTCTAGCAGTGGGGATCATTCTTTCTCAGACTTTCAGGTTACCAGCCTGTACACTACATATCCAGCTATGGAAAATGTGGCACCTTCCCAGTGTGTGACTGGATCAGGAACCAAGCCTATAGCTTTGCTTTAATAGTTGGACATCATGCATTTAAAGCCACTGTGATGACTTCTGGGTGCAGTGCCAGGGGTGAAGATGAGCAACTGATGGTGTTTAGGGTGCTTTATGAATACTGGGAAACGAAACACTTGCACAATCCACCCTGCCGCCAGCAATCTGCAAAACAAGAAGCCTCCTGAACAACACAAAGCATCATTTTTTCATTTTTACTGTACGGTTATTATTGCCATTGCTGCCTCTAGATCTAGTTTTTCAGTTGGACATAAAATTAAAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1
                                                                                                                                                                                                           PREDICTED - Dr ---- 4e-054     XP_684178.1 PREDICTED: similar to transcription factor Foxn4 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Mm ---- 4e-058     NP_683737.2 forkhead box N4 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 1e-061     NP_998761.1 forkhead box N4 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                             PROTEIN --- Gg ---- 2e-078     NP_001076828.1 forkhead box N4 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                            PROTEIN --- Xl ---- 1e-107     CAJ38821.1 forkhead box protein FoxN4 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                            
                                                                                            PROTEIN --- Xt ---- 8e-114     AAI35762.1 Unknown (protein for MGC:122132) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAM13885.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------ATG---------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------TAATAG---------ATG---------------TGATGA---------------------------ATG------TGA------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       bld Gas7      out                        XZG44111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACAGACCAGAGAGTTGCAAAGCTCCTAGTAAATTGGTGGAACCAGAAGTTCAAGCTATGACAGCCATAGGCAACATCCCAGGCAGGATTCCCCAGCACCAGCCACATCCTGTCATGACTTTGTCATTACAATCCATTCCCTTGCACCATCAGATCCAGACCCAGGCCAGGATAGCATCAGGTTCTCCAGCCCCAGCACAGAGCCCTCCTGTTCACTCTGTTCCAGACATGACCCACAGTCCCCTTCAACAGCACATCATGAGCAGGGCTGCTTCTGACTTTCTTAGCCTCACCTCAGACATGAACACAGAGGTTGATGCCCTTGATCCTAGCATCATGGACTTTGCGCTACAAGGAAACATATGGGAGGACATGAAGGATGAGAGCTTCAGTCTGGACACATTAGGAGCCTTCAGCAATTCCCCTCTCCAACTTTCAGACTGTGATTTGGGAACCATTGGCCTAACCCCTGTGTCTAGCAGTGGGGATCATTCTTTCTCAGACTTTCAGGTTACCAGCCTGTACACTACATATCCAGCTATGGAAAATGTGGCACCTTCCCAGTGTGTGACTGGATCAGGAACCAAGCCTATAGCTTTGCTTTAATAGTTGGACATCATGCATTTAAAGCCACTGTGATGACTTCTGGGTGCAGTGCCAGGNGTGAAGATGAGCAACTGATGGTGTTTAGGGTGCTTTATGAATACTGGGAAACGAAACACTTGCACAATCCACCCTGCCGCCAGCAATCTGCAAAACAAGAAGCCTCCTGAACGACACANAGCATCATTTTTTCATTTTTACTGTACGGTTATTATTGCCATTGCTGCCTCTAGATCTAGTTTTTCAGTTGGACATAAAAATT
  3   1   2      seed Te3  5g3  out                       CAAM13885.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTCCCCAGCACCAGCCACATCCTGTCATGACTTTGTCATTACAATCCATTCCCTTGCACCATCAGATCCAGACCCAGGCCAGGATAGCATCAGGTTCTCCAGCCCCAGCACAGAGCCCTCCTGTTCACTCTGTTCCAGACATGACCCACAGTCCCCTTCAACAGCACATCATGAGCAGGGCTGCTTCTGACTTTCTTAGCCTCACCTCAGACATGAACACAGAGGTTGATGCCCTTGATCCTAGCATCATGGACTTTGCGCTACAAGGAAACATATGGGAGGACATGAAGGATGAGAGCTTCAGTCTGGACACATTAGGAGCCTTCAGCAATTCCCCTCTCCAACTTTCAGACTGTGATTTGGGAACCATTGGCCTAACCCCTGTGTCTAGCAGTGGGGATCATTCTTTCTCAGACTTTCAGGTTACCAGCCTGTACACTACATATCCAGCTATGGAAAATGTGGCACCTTCCCAGTGTGTGACTGGATCAGGAACCAAGCCTATAGCTTTGCTTTAATAGTTGGACATCATGCATTTAAAGCCACTGTGATGACTTCTGGGTGCAGTGCCAGGGGTGAAGATGAGCAACTGATGGTGTTTAGGGTGCTTTATGAATACTGGGAAACGAAACACTTGCACAATCCACCCTGCCGCCAGCAATCTGCAAAACAAGAAGCCTCCTGAACAACACAAAGCATCATTTTTTCATTTTTACTGTACGGTTATTATTGCCATTGCTGCCTCTAGATCTAGTTTTTCAGTTGGACATAAAATTAAAATATTGCAGAAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)