Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK6650.3                            4 END     4         100      100                (no blast hit)

 This cluster: approximate FL confidence score = 76%

 1012103536 Xt7.1-CAAK6650.5 - 4 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                         1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     163     195                                                                                                                                                                                                                                                                                                                                    
                                               BLH MIN     130     220                                                                                                                                                                                                                                                                                                                                    
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 9e-045     NP_498088.1 T BoX family member (47.0 kD) (tbx-2) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 3e-049     AAD21079.1 brachyury protein [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Cs ---- 2e-050     BAA92187.1 brachyury [Ciona savignyi] ---==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 9e-052     NP_525070.2 CG3578-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 1e-072     XP_791266.1 PREDICTED: similar to T-brain-1 protein (T-box brain protein 1) (TBR-1) (TES-56) [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bb ---= 2e-086     BAB63370.1 T-brain [Branchiostoma belcheri] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bf ---- 6e-087     AAG34893.2 T-box protein AmphiEomes/Tbr1/Tbx21 [Branchiostoma floridae] --=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Gg ==== 9e-131     XP_426003.2 PREDICTED: similar to eomesodermin [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xl ---- 6e-161     AAC60061.1 eomesodermin [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- ?? ---- 6e-161     NP_001081810.1 eomesodermin [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Dr ==== 0          XP_683465.1 PREDICTED: similar to T-box brain gene 1 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Mm ==== 0          NP_033348.2 T-box brain gene 1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Hs ==== 0          NP_006584.1 T-box, brain, 1 [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          AAI22953.1 T-box, brain, 1 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK6650.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGA------------------------------------ATG---------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2       bld Brn3      out                        CAAK2048.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGACTGGTCCCTGGCAAAGCCCAAGTCTATCTGTGTAACAGGCCACTCTGGCTCAAGTTCCACAGGCACCAAACCGAAATGATCATCACCAAGCAGGGCAGGCGTATGTTCCCTTTCCTGAGTTTTAACATTTCGGGGCTGGATCCCACGGCGCATTACAATATTTTTGTTGATGTGATTCTGGCTGATCCCAATCACTGGAGATTCCAAGGGGGCAAGTGGGTACCTTGTGGCAAAGCGGACACCAACGTTCAAGGCAATAGGGTGTATATGCACCCCGACTCGCCCAACACCGGGGCCCACTGGATGCGCCAGGAAATCTCTTTTGGCAAAATGAAACTTACCAACAACAAAGGGGCGTCCAATAACAACGGGCAGATGGTTGTGTTGCAGTCTTTACACAAGTACCAACCTAGGCTACATGTGGTGGAGGTGAATGAAGATGGCACAGAAGATACCAGCCAACCTGGCAGGGTCCAGACCTTTACCTTCCCGGAGACCCAGTTCATTGCGGTGACAGCCTACCAGAATACCGATATCACGCAATTGAAAATTGACCACAACCCATTTGCCAAAGGATTTCGGGACAACTATGACACGATCTACACCGGCTGTGACCTGGACCGGCTCACCCCCTCCCCCAATGACTCCCCCCGCTCCCAGATTGTGCCGGGGGCCCGCTACTCCATGGCCAGCACCTTCCTGCAGGACCAGTTCGTTAGTAACTACGCCAAGTCCCGTTTCCACCCCCCGGGAGCGGTGCCAGGGCCGGGGACTGACCGCAGCGTCCCCCATACA
  5   1   2      skin Brn4      out                       CAAL21198.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCGCTCCCAGATTGTGCCGGGGGCCCGCTACTCCATGGCCAGCACCTTCCTGCAGGACCAGTTCGTTAGTAACTACGCCAAGTCCCGTTTCCACCCCCCGGGAGCGGTGCCAGGGCCGGGAACTGACCGCAGCGTCCCCCATACAAACGGGCTGCTGTCGCCTCAACAAGGGGAGGACCCCGGGGCCCCGTCCCCGCAACGTTGGTTTGTAACCCCAGCCAACAACAGGCTGGACTTCACCTCCGCTTCTGCCTACGATGCGGCCACAGACTTTGCCGGCAACGCTGCCACCTTGTTGTCCTACGCTGCGGCCGGAGTCAAGGCGCTTCCTCTGCCTGGAGGTGGCTGCACAGCCCGCCCTCTTGGTTACTATAGTGATCCCACTGGCTGGGGGGCACGGAGCCCCCCTCAGTACTGCACTAAGTCCGGCTCTGTGCTGCCGTGTTGGGCTACAGGGGGCAGGATGGCGGCCACTAACCCTTACCTAACAGGCAGTGAGGAGGTAGAAAGTCTGGCAGCTACAGACAGGTCTCCTTTGGGTGAGGACACAAAACCCAAAGACCTGTCCGACTCCAGCTGGATCGAAACCCCTCCTTCCATCAAGTCTATGGACTCCTCCGACTCCGGGATATATGAACAGGCCAAGAGAAGGAGGCTCTCACCCTCCGACCCTGCGGTGTCGGGCAGCTCCTCGCCATTAAAGAGTGAAGTGGTGCCCCCTAGGGACTGTGAGAAAAACTGCACCAAGGACCTGAGTTTATATGGTTTCTACACTCACACTTAGGGCCACCACACAACTCCTTCATGTCCTTCATACAAGGTCAGGCATCCTGAGGACAATCACT

In case of problems mail me! (