Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 28 Feb 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA032a03.5                          4 END     1          33       25                dicer1 [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012104155 Xt7.1-CAAN4042.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAN4042.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTACTAGATTCTATCAGACTGTCAAACTGTTCTTTTGGTCTTGGGACCATGGTGTGCTGATAAAGTTGCGGGGATGATGGTGAGAGAGCTGCAGAAGTATATCAAACATGAGCAGGAGGAACTGCACAGAAAATTCCTTTTGTTTACAGACACTATCTTAAGGAAGATCCATGCTCTTTGTGAGGAACACTTCTCGCCAGCCTCTCTTGATATGAAGTTTGTCACACCTAAAGTTATAAAACTGCTGGAAATTTTACGCAAATACAAACCCTACGAACGCCAGCAATTTGAAAGTGTTGAATGGTATAACAATAGAAACCAGGATAATTATGTGTCTTGGAGTGATTCAGAGGATGATGACGATGAAGATGAAGAAATTGAGGAGAAAGAGAAAACTGAAACAAGCTTTCCATCCCCATTCACAAACATCCTGTGTGGCATCATCTTCGTGGAACGAAGATACACAGCAGTAGTATTAAACAGGTTGATTAAAGAAGCCGGGAAGCAAGATCCAGAGCTGGCCTATATCAGTAGTAACTTTATTACTGGGCACGGCATAGGAAAGAACCAGCCACGCAATAAGCAGATGGAAGTTGAGTTTAGAAAGCAAGAAGAGGTGCTTCGTAAATTTCGTGCACACGAAACCAACTTATTGATAGCTACTAGCATTGTTGAGGAAGGAGTGGACATACCAAAATGCAACTTGGTAGTTCGATTTGATTTACCTTCAGAGTACAGATCCTATGTACAGTCCAAAGGCAGAGCAAGAGCACCAATCTCAAATTACATCATGCTAGCCGATAGTGATAAAATTAAGGCATTTGAAGAGGACCTTAAAACATACAAAGCAATTGAAAAGATTCTGCGGAACAAATGCTCAAAGTCCATTGATTGTGGAAATACAGAATCTGAGCCCATTGTGGACGATGATGAAATATTTCCACCATATGTGTTGAGACAGGATGATGGCAGCCCACGAGTTACTATCAACACCGCTATTGGACACATTAACAGGTACTGTGCTAGGCTACCTAGTGACCCATTTACTCATCTTGCTCCTAAGTGCAAAACACGAGAGTTCCCTGATGGACTTTATCGCTCAACACTCTACCTGCCAATTAATTCTCCACTTAGAGCCCCCATTGTTGGCCCTCCGATGAATTGTGGAAGGCTAGCTGATAGAGCTGTAGCTCTTATATGCTGTAAAAAACTACATGAAATTGGTGAACTGGATGATCATTTAATGCCAGTTGGCAAGGAAACTGTAAAATATGAGGAGGAGCTTGATTTGCATGATGAGGAAGAAACCAGTGTTCCAGGCAGACCAGGATCCACAAAAAGAAGGCAGTGTTATCCAAAAGCTATTCCTGAATGTTTACGGAACAGCTACCCCAAGCCTGGTCAGCCTTGTTACTTATATGTAATAGGAATGGTATTAACCACTCCTCTACCAGATGAACTTAATTTTAGGCGACGGAAGCTGTATCCCCCTGAAGACACAACAAGATGCTTTGGAATACTAACTGCCAAACCCATACCTCAGGTATTGCAATGTACAATCAAGTTTTGATGCCAAGCCTCTC
                                                  Xt7.1-CHK-1008250203                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGATTCTATCAGACTGTCAAACTGTTCTTTTGGTCTTGGGACCATGGTGTGCTGATAAAGTTGCGGGGATGATGGTGAGAGAGCTGCAGAAGTATATCAAACATGAGCAGGAGGAACTGCACAGAAAATTCCTTTTGTTTACAGACACTATCTTAAGGAAGATCCATGCTCTTTGTGAGGAACACTTCTCGCCAGCCTCTCTTGATATGAAGTTTGTCACACCTAAAGTTATAAAACTGCTGGAAATTTTACGCAAATACAAACCCTACGAACGCCAGCAATTTGAAAGTGTTGAATGGTATAACAATAGAAACCAGGATAATTATGTGTCTTGGAGTGATTCAGAGGATGATGACGATGAAGATGAAGAAATTGAGGAGAAAGAGAAAACTGAAACAAGCTTTCCATCCCCATTCACAAACATCCTGTGTGGCATCATCTTCGTGGAACGAAGATACACAGCAGTAGTATTAAACAGGTTGATTAAAGAAGCCGGGAAGCAAGATCCAGAGCTGGCCTATATCAGTAGTAACTTTATTACTGGGCACGGCATAGGAAAGAACCAGCCACGCAATAAGCAGATGGAAGTTGAGTTTAGAAAGCAAGAAGAGGTGCTTCGTAAATTTCGTGCACACGAAACCAACTTATTGATAGCTACTAGCATTGTTGAGGAAGGAGTGGACATACCAAAATGCAACTTGGTAGTTCGATTTGATTTACCTTCAGAGTACAGATCCTATGTACAGTCCAAAGGCAGAGCAAGAGCACCAATCTCAAATTACATCATGCTAGCCGATAGTGATAAAATTAAGGCATTTGAAGAGGACCTTAAAACATACAAAGCAATTGAAAAGATTCTGCGGAACAAATGCTCAAAGTCCATTGATTGTGGAAATACAGAATCTGAGCCCATTGTGGACGATGATGAAATATTTCCACCATATGTGTTGAGACAGGATGATGGCAGCCCACGAGTTACTATCAACACCGCTATTGGACACATTAACAGGTACTGTGCTAGGCTACCTAGTGACCCATTTACTCATCTTGCTCCTAAGTGCAAAACACGAGAGTTCCCTGATGGACTTTATCGCTCAACACTCTACCTGCCAATTAATTCTCCACTTAGAGCCCCCATTGTTGGCCCTCCGATGAATTGTGGAAGGCTAGCTGATAGAGCTGTAGCTCTTATATGCTGTAAAAAACTACATGAAATTGGTGAACTGGATGATCATTTAATGCCAGTTGGCAAGGAAACTGTAAAATATGAGGAGGAGCTTGATTTGCATGATGAGGAAGAAACCAGTGTTCCAGGCAGACCAGGATCCACAAAAAGAAGGCAGTGTTATCCAAAAGCTATTCCTGAATGTTTACGGAACAGCTACCCCAAGCCTGGTCAGCCTTGTTACTTATATGTAATAGGAATGGTATTAACCACTCCTCTACCAGATGAACTTAATTTTAGGCGACGGAAGCTGTATCCCCCTGAAGACACAACAAGATGCTTTGGAATACTAACTGCCAAACCCATACCTCAGGTATTGCAATGTACAATCAAGTTTTGATGCCAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                              PROTEIN --- Cs ---- 8e-007     BAB12216.1 vasa homolog [Ciona savignyi] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================
                                                                       ...PREDICTED - Sc ---- 3e-008     NP_012267.1 Mutator PHenotype; Similar to ATP-dependent RNA helicases; Mph1p [Saccharomycescerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Xl ---- 1e-012     AAH73528.1 MGC82787 protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - ?? ---- 5e-016     XP_693126.1 PREDICTED: similar to melanoma differentiation associated protein-5 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 4e-041     NP_524453.1 Dicer-1 CG4792-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 3e-048     NP_498761.1 DiCer Related, LEThal LET-740 (dcr-1) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PREDICTED - Sp ---- 5e-102     XP_790894.1 PREDICTED: similar to dicer1 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PREDICTED - Dr ---- 0          XP_683015.1 PREDICTED: similar to Endoribonuclease Dicer (Double-strand-specific ribonuclease mDCR-1) [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PROTEIN --- Mm ---- 0          NP_683750.2 dicer1 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN --- Hs ---- 0          NP_085124.2 dicer1 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN --- Gg ---- 0          NP_001035555.1 dicer1 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAN4042.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAG------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   2      skin Neu                            TNeu082l19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTACTAGATTCTATCAGACTGTCAAACTGTTCTTTTGGTCTTGGGACCATGGTGTGCTGATAAAGTTGCGGGGATGATGGTGAGAGAGCTGCAGAAGTATATCAAACATGAGCAGGAGGAACTGCACAGAAAATTCCTTTTGTTTACAGACACTATCTTAAGGAAGATCCATGCTCTTTGTGAGGAACACTTCTCGCCAGCCTCTCTTGATATGAAGTTTGTCACACCTAAAGTTATAAAACTGCTGGAAATTTTACGCAAATACAAACCCTACGAACGCCAGCAATTTGAAAGTGTTGAATGGTATAACAATAGAAACCAGGATAATTATGTGTCTTGGAGTGATTCAGAGGATGATGACGATGAAGATGAAGAAATTGAGGAGAAAGAGAAAACTGAAACAAGCTTTCCATCCCCATTCACAAACATCCTGTGTGGCATCATCTTCGTGGAACGAAGATACACAGCAGTAGTATTAAACAGGTTGATTAAAGAAGCCGGGAAGCAAGATCCAGAGCTGGCCTATATCAGTAGTAACTTTATTACTGGGCACGGCATAGAAAGAACCAGCCACGCAATAAGCAGATGGAAGTTGAGT
  5   1   2      seed Te4       out                        CAAN4042.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGAAAGTGTTGAATGGTATAACAATAGAAACCAGGATAATTATGTGTCTTGGAGTGATTCAGAGGATGATGACGATGAAGATGAAGAAATTGAGGAGAAAGAGAAAACTGAAACAAGCTTTCCATCCCCATTCACAAACATCCTGTGTGGCATCATCTTCGTGGAACGAAGATACACAGCAGTAGTATTAAACAGGTTGATTAAAGAAGCCGGGAAGCAAGATCCAGAGCTGGCCTATATCAGTAGTAACTTTATTACTGGGCACGGCATAGGAAAGAACCAGCCACGCAATAAGCAGATGGAAGTTGAGTTTAGAAAGCAAGAAGAGGTGCTTCGTAAATTTCGTGCACACGAAACCAACTTATTGATAGCTACTAGCATTGTTGAGGAAGGAGTGGACATACCAAAATGCAACTTGGTAGTTCGATTTGATTTACCTTCAGAGTACAGATCCTATGTACAGTCCAAAGGCAGAGCAAGAGCACCAATCTCAAATTACATCATGCTAGCCGATAGTGATAAAATTAAGGCATTTGAAGAGGACCTTAAAACATACAAAGCAATTGAAAAGATTCTGCGGAACAAATGCTCAAAGTCCATTGATTGTGGAAATACAGAATCTGAGCCCATTGTGGACGATGATGAAATATTTCCACCATATGTGTTGAGACAGGATGATGGCAGCCCACGAGTTACTATCAACACCGCTATTGGACACATTAACAGGTACTGTGCTAGGCTACCTAGTGACCCATTTACTCATCTTGCTCCTAAGTGCAAAACACGAGAGTTCCCTGATGGACTTTATCGCTCAACACTCTACCTGCCAATTAATTCTCCACTTAGA
  3   1   2       bld Int1 PIPE out                       CAAP10767.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTAAAACATACAAAGCAATTGAAAAGATTCTGCGGAACAAATGCTCAAAGTCCATTGATTGTGGAAATACAGAATCTGAGCCCATTGTGGACGATGATGAAATATTTCCACCATATGTGTTGAGACAGGATGATGGCAGCCCACGAGTTACTATCAACACCGCTATTGGACACATTAACAGGTACTGTGCTAGGCTACCTAGTGACCCATTTACTCATCTTGCTCCTAAGTGCAAAACACGAGAGTTCCCTGATGGACTTTATCGCTCAACACTCTACCTGCCAATTAATTCTCCACTTAGAGCCCCCATTGTTGGCCCTCCGATGAATTGTGGAAGGCTAGCTGATAGAGCTGTAGCTCTTATATGCTGTAAAAAACTACATGAAATTGGTGAACTGGATGATCATTTAATGCCAGTTGGCAAGGAAACTGTAAAATATGAGGAGGAGCTTGATTTGCATGATGAGGAAGAAACCAGTGTTCCAGGCAGACCAGGATCCACAAAAAGAAGGCAGTGTTATCCAAAAGCTATTCCTGAATGTTTACGGAACAGCTACCCCAAGCCTGGTCAGCCTTGTTACTTATATGTAATAGGAATGGTATTAACCACTCCTCTACCAGATGAACTTAATTTTAGGCGACGGAAGCTGTATCCCCCTGAAGACACAACAAGATGCTTTGGAATACTAACTGCCAAACCCATACCTCAGGTATTGCAATGTACAATCAAGTTTTGATGCCAAGCCTCTCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)