Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TNeu073b24.3                          5 END     3         100       60                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012104505 Xt7.1-CABC1089.5 - 3 ESTs
                                                                       ..-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABC1089.5                                                                                                                 CAACAATCATCCAGGCTCTTCCAGTGTACCTCAGTCGGCAGACATGAGATTCATCTAGTAGCTGTCTGGATGATGAGGATACCTTTAAGATCCTGGTTGCTACTGACATTCACCTGGGCTTTATGGAGAAAGATGCTGTGAGGGGAAATGACAGTTTTTCGACTTTTGATGAAATCCTCCGGCTCGCTCAAGACAATGAAGTTGACTTCTTACTTTTAGGTGGAGATCTCTTTCATGACAACAAACCCTCCAGAAGGACCCTCCACATATGCCTAGAGCAACTGAGGAAGTACTGCATGGGCGATCGACCCATAGAGTTTGAGGTTCTTAGTGACCAGTCTGTTAATTTTGGATACAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAACATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCATGATGACCCAACAGGGGCTGATGCTCTTTGTGCTTTGGATATTTTAAGCTGTGCCGGGCTGGTGAATCACTTTGGCCGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGTGTTATTGCAGAAGGGCCGCTCAAAGATTGCCCTGTACGGACTCGGGTCCATACCTGATGAGCGCCTCTATCGAATGTTCGTTAATAAACAAGTCATGATGCTGCGCCCTCGAGAGGATGAGTCCAGCTGGTTTAACTTGTTTGTTATCCATCAGAACAGGAGCAAGCACGGGCCAACAAATTACATCCCGGAACAGTTTTTGGATGATTTCTTGGACCTGATTATTTGGGGTCACGAGCATGAGTGCAAAATCAATCCAACAAGGAACGAACAGCAACTCTTCTACGTGTCTCAGCCAGGAAGTTCGGTGGCGACGTCTCTCTCTCCAGGGGAAGCAGAAAAAAAAGCATGTGGGTTTATTGCGAATTAAAGGCAAAAAAATGAACATGCAGAAGATTCCCCTGCAGACTGTCCGCCAGTTCTTCATTGAAGACCTTGTCTTAAGCGACTACCCTGATATATTCAACCCAGACAATCCTAAAGTAACGCAAGAGATCGAGTCCTTTTGCATCGAGAAGGTAGAAGCGATGCTCGATACTGCTGAGAGGGAACGTCTGGGAAATGCGCGGCAGCCGGATAAACCTTTGATACGACTCCGGGTAGATTACACGGGTGGTTTTGAGCCTTTCAACACTCTAAGGTTCAGTCAGAAGTTTGTTGATCGGACTGCCAACCCCAAGGACATTATCCACTTCTTCAGACATAAAGAGCAAAAGGATAAGAAAGACAATATCACAATTAATTTTGGGAAACTTGACAGCAAGCCTTTGTTTGAGGGCTCTACGCTAAGAGTGGAAGACCTGGTGAAAGAGTACTTCAAAACTGCAGAGAAGAATGTTCAGCTGTCTCTTTTAACAGAGAGAGGGATGGGAGAAGCAGTTCAGGAATTTGTGGATAAGGAGGAAAAGGATGCCCTTGAGGAACTGGTGAAATTCCAGTTAGAGAAGACGCAG
                                                  Xt7.1-CHK-1008249042                                                                                                                       TCATCCAGGCTCTTCCAGTGTACCTCAGTCGGCAGACATGAGATTCATCTAGTAGCTGTCTGGATGATGAGGATACCTTTAAGATCCTGGTTGCTACTGACATTCACCTGGGCTTTATGGAGAAAGATGCTGTGAGGGGAAATGACAGTTTTTCGACTTTTGATGAAATCCTCCGGCTCGCTCAAGACAATGAAGTTGACTTCTTACTTTTAGGTGGAGATCTCTTTCATGACAACAAACCCTCCAGAAGGACCCTCCACATATGCCTAGAGCAACTGAGGAAGTACTGCATGGGCGATCGACCCATAGAGTTTGAGGTTCTTAGTGACCAGTCTGTTAATTTTGGATACAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAACATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCATGATGACCCAACAGGGGCTGATGCTCTTTGTGCTTTGGATATTTTAAGCTGTGCCGGGCTGGTGAATCACTTTGGCCGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGTGTTATTGCAGAAGGGCCGCTCAAAGATTGCCCTGTACGGACTCGGGTCCATACCTGATGAGCGCCTCTATCGAATGTTCGTTAATAAACAAGTCATGATGCTGCGCCCTCGAGAGGATGAGTCCAGCTGGTTTAACTTGTTTGTTATCCATCAGAACAGGAGCAAGCACGGGCCAACAAATTACATCCCGGAACAGTTTTTGGATGATTTCTTGGACCTGATTATTTGGGGTCACGAGCATGAGTGCAAAATCAATCCAACAAGGAACGAACAGCAACTCTTCTACGTGTCTCAGCCAGGAAGTTCGGTGGCGACGTCTCTCTCTCCAGGGGAAGCAGAAAAAAAAGCATGTGGGTTTATTGCGAATTAAAGGCAAAAAAATGAACATGCAGAAGATTCCCCTGCAGACTGTCCGCCAGTTCTTCATTGAAGACCTTGTCTTAAGCGACTACCCTGATATATTCAACCCAGACAATCCTAAAGTAACGCAAGAGATCGAGTCCTTTTGCATCGAGAAGGTAGAAGCGATGCTCGATACTGCTGAGAGGGAACGTCTGGGAAATGCGCGGCAGCCGGATAAACCTTTGATACGACTCCGGGTAGATTACACGGGTGGTTTTGAGCCTTTCAACACTCTAAGGTTCAGTCAGAAGTTTGTTGATCGGACTGCCAACCCCAAGGACATTATCCACTTCTTCAGACATAAAGAGCAAAAGGATAAGAAAGACAATATCACAATTAATTTTGGGAAACTTGACAGCAAGCCTTTGTTTGAGGGCTCTACGCTAAGAGTGGAAGACCTGGTGAAAGAGTACTTCAAAACTGCAGAGAAGAATGTTCAGCTGTCTCTTTTAACAGAGAGAGGGATGGGAGAAGCAGTTCAGGAATTTGTGGATAAGGAGGAAAAGGATGCCCTTGAGGAACTGGTGAAATTCCAGTTAGAGAAGACGCAGAGATTT
                                                      consensus depths                                                                                                                      1     1     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN      50     136                                                                                                                 
                                                                       PROTEIN --- Ce ---- 3e-094     NP_505736.2 yeast MRE recombination/repair homolog family member (mre-11) [Caenorhabditis elegans] --------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PROTEIN --- Sc ==== 2e-105     NP_013951.1 Mre11p [Saccharomyces cerevisiae] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                REMOVED --- Dm ---- 1e-088     NP_523547.1 PROBABLY REMOVED OR REPLACED [Drosophila melanogaster]  ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PREDICTED - Sp ==== 1e-112     XP_798167.2 PREDICTED: similar to MRE11 meiotic recombination 11 homolog A, partial [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PROTEIN === Dr ==== 2e-140     NP_001001407.1 meiotic recombination 11 homolog A [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN === Gg ==== 1e-140     NP_990109.1 Mre11 [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN === Mm ==== 3e-146     NP_061206.1 meiotic recombination 11 homolog A [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN === Hs ==== 1e-147     NP_005582.1 meiotic recombination 11 homolog A isoform 1 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PREDICTED = Xl ==== 3e-160     AAD31866.1 putative nuclease Mre11 [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PREDICTED = ?? ==== 3e-160     NP_001080975.1 putative nuclease Mre11 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABC1089.5                                                                                                                                                             TGA---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------TGA------------------------TGA---------------------TAA------------------------------------------------------------TGA---------------------------------TAA---------------------------------------TGA------------------------------------TGA------------------------------------------TAA------------TAA------------------TAA------------TGA---------------TGA------------------------------------------------------------------------------------------------------------------------TAA------------------TGA
                                                                   ORF                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  5   1   2       bld Gas8      out                         st25j24.5p                                                                                                                 CAACAATCATCCAGGCTCTTCCAGTGTACCTCAGTCGGCAGACATGAGATTCATCTAGTANCTGTCTGGATGATGAGGATACCTTTAAGATCCTGGTTGCTACTGACATTCACCTGGGCTTTATGGAGAAAGATGCTGTGAGGGGAAATGACAGTTTTTCGACTTTTGATGAAATCCTCCGGCTCGCTCAAGACAATGAAGTTGACTTCTTACTTTTAGGTGGAGATCTCTTTCATGACAACNAACCCTCCNGAAGGACCCTCCACATATGCCTAGAGCAACTGAGGAAGTACTGCATGGGCGATCGACCCATAGAGTTTGAGGTTCTTAGTGACCAGTCTGTTAATTTTGGATACAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAACATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCATGATGACCCAACAGGGGCTGATGCTCTTTGTGCTTTGGATATTTTAAGCTGTGCCGGGCTGGTGAATCACTTTGGCCGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGTGTTATTGCAGAAGGGCCGCTCAAAGATTGCCCTGTACGGACTCGGGTCCATACCTGATGAGCGCCTCTATCGAATGTTCGTTAATAAACAAGTCATGATGCTGCGCCCTCGAGAGGATGAGTCCAGCTGGTTTAACTTGTTTGTTATCCATCAGAACAGGAGCAAGCACGGGCCAACAAATTACATCCC
  5   1   2      seed Fat1 PIPE out                        CABC1089.5p                                                                                                                            CCAGGCTCTTCCAGTGTACCTCAGTCGGCAGACATGAGTTCATCTAGTAGCTGTCTGGATGATGAGGATACCTTTAAGATCCTGGTTGCTACTGACATTCACCTGGGCTTTATGGAGAAAGATGCTGTGAGGGGAAATGACAGTTTTTCGACTTTTGATGAAATCCTCCGGCTCGCTCAAGACAATGAAGTTGACTTCTTACTTTTAGGTGGAGATCTCTTTCATGACAACAAACCCTCCAGAAGGACCCTCCACATATGCCTAGAGCAACTGAGGAAGTACTGCATGGGCGATCGACCCATAGAGTTTGAGGTTCTTAGTGACCAGTCTGTTAATTTTGGATACAGCAAATTTCCTTGGGTGAATTACCAGGATAACAATCTGAACATTTCTCTGCCAGTCTTCAGTGTGCATGGAAACCATGATGACCCAACAGGGGCTGATGCTCTTTGTGCTTTGGATATTTTAAGCTGTGCCGGGCTGGTGAATCACTTTGGCCGTGCTACATCTGTAGAAAAGATAGACATTAGCCCTGTGTTATTGCAGAAGGGCCGCTCAAAGATTGCCCTGTACGGACTCGGGTCCATACCTGATGAGCGCCTCTATCGAATGTTCGTTAATAAACAAGTCATGATGCTGCGCCCTCGAGAGGATGAGTCCAGCTGGTTTAACTTGTTTGTTATCCATCAGAACAGGAGCAAGCACGGGCCAACAAATTACATCCCGGAACAGTTTTTGGATGATTTCTTGGACCCTGATATTTGGGGTCACGAGCATGAGTGCAAAATCAATCCAAC
  3  -1   2       bld Int1      out                        CAAP7457.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGAGTCTAGCTGGTTTAACTTGTTTGTTATCCATCAGAACAGGAGCAAGCACGGGCCAACAAATTACATCCCGGAACAGTTTTTGGATGATTTCTTGGACCTGATTATTTGGGGTCACGAGCATGAGTGCAAAATCAATCCAACAAGGAACGAACAGCAACTCTTCTACGTGTCTCAGCCAGGAAGTTCGGTGGCGACGTCTCTCTCTCCAGGGGAAGCAGAAAAAAAAGCATGTGGGTTTATTGCGAATTAAAGGCAAAAAAATGAACATGCAGAAGATTCCCCTGCAGACTGTCCGCCAGTTCTTCATTGAAGACCTTGTCTTAAGCGACTACCCTGATATATTCAACCCAGACAATCCTAAAGTAACGCAAGAGATCGAGTCCTTTTGCATCGAGAAGGTAGAAGCGATGCTCGATACTGCTGAGAGGGAACGTCTGGGAAATGCGCGGCAGCCGGATAAACCTTTGATACGACTCCGGGTAGATTACACGGGTGGTTTTGAGCCTTTCAACACTCTAAGGTTCAGTCAGAAGTTTGTTGATCGGACTGCCAACCCCAAGGACATTATCCACTTCTTCAGACATAAAGAGCAAAAGGATAAGAAAGACAATATCACAATTAATTTTGGGAAACTTGACAGCAAGCCTTTGTTTGAGGGCTCTACGCTAAGAGTGGAAGACCTGGTGAAAGAGTACTTCAAAACTGCAGAGAAGAATGTTCAGCTGTCTCTTTTAACAGAGAGAGGGATGGGAGAAGCAGTTCAGGAATTTGTGGATAAGGAGGAAAAGGATGCCCTTGAGGAACTGGTGAAATTCCAGTTAGAGAAGACGCAGAGATTTCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)