Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 79%

 1012104559 Xt7.1-CAAJ13227.5 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ13227.5 AGCAGATCGGGGGAGTGGACATTTCAGCATCTCCGCAGCAACTTTTCTTTCTGTGGATTTCATTGTGTGCTGCTTTTGTCGTCTGACACCACTGCTTTTGTCGTCTGACACCACTACTGTCTCAGGAAGAAAACAGCTTGTCCTCTCACATCCCCCTAAGAAGAGAGACAGGCAAGGGACACGCAGCAGGATGCCTGGCAGTGCACGCTGTATGGTGCAGGCTCAGCTAGTGAGCAGGCTGGGCTGAGACAAGCACATTCTAAATCTGAGTTGTGGTGTGGCCAGGTCCAGTCCCATAGCATCGGAGATCCTCTCCCACACTCGGGGAAAGGTCTGCAGGCACTAGGACAGCATGGGTCAATCTGGCTAAAGGATTACAGGAAAACACAGGAGACCGTTCATTCTGTTCCAGACACGCCCTGGAGACACCAGAAGTGGATTATTGCAGAGGGGCAACTTTCTACCTCTGGCACTAAACCCACTCCTAGGTCAGGATGGCACCTGCAGGGTGGGCACTCTGTTTACTCTCCCTCTTGCAAGTGGCCTCTGGACTTTATTTTCTAACAAAGGACTATGACGAGAATTTATATGTGGATCAACCGGCTGGCACACTACTCCTACACATCCATGTGATGAAGGACTCACCACATGAGACACCTCACTTCAGACTCTGTCCAAATAGTTATTTAAGTAGAATCTCTTTCTACCATTGGTTCTGGATAGATGAGCATACAGGGATCCTCTACCTCAACCGGAGTCTTGACAGGAGCGACTATGAAGTCTTCGCCCAAGGAAGTTCATTAGCCGTTCAGAAGATAATTCTAAAGGTGTCAACAAAGCCACAACCATTTTTAGATAATAACTGTGACAATGCACCCTTCACTAGGGTTCATCTTACCTTTAGAAACATTACATCCTCCATCTGTTCCTCGCTTAAACCAAAGGACTTGTGCTTCAATGACAAAGATCTCT
                                                  Xt7.1-CHK-1008255799       TCGGGGGAGTGGACATTTCAGCATCTCCGCAGCAACTTTTCTTTCTGTGGATTTCATTGTGTGCTGCTTTTGTCGTCTGACACCACTGCTTTTGTCGTCTGACACCACTACTGTCTCAGGAAGAAAACAGCTTGTCCTCTCACATCCCCCTAAGAAGAGAGACAGGCAAGGGACACGCAGCAGGATGCCTGGCAGTGCACGCTGTATGGTGCAGGCTCAGCTAGTGAGCAGGCTGGGCTGAGACAAGCACATTCTAAATCTGAGTTGTGGTGTGGCCAGGTCCAGTCCCATAGCATCGGAGATCCTCTCCCACACTCGGGGAAAGGTCTGCAGGCACTAGGACAGCATGGGTCAATCTGGCTAAAGGATTACAGGAAAACACAGGAGACCGTTCATTCTGTTCCAGACACGCCCTGGAGACACCAGAAGTGGATTATTGCAGAGGGGCAACTTTCTACCTCTGGCACTAAACCCACTCCTAGGTCAGGATGGCACCTGCAGGGTGGGCACTCTGTTTACTCTCCCTCTTGCAAGTGGCCTCTGGACTTTATTTTCTAACAAAGGACTATGACGAGAATTTATATGTGGATCAACCGGCTGGCACACTACTCCTACACATCCATGTGATGAAGGACTCACCACATGAGACACCTCACTTCAGACTCTGTCCAAATAGTTATTTAAGTAGAATCTCTTTCTACCATTGGTTCTGGATAGATGAGCATACAGGGATCCTCTACCTCAACCGGAGTCTTGACAGGAGCGACTATGAAGTCTTCGCCCAAGGAAGTTCATTAGCCGTTCAGAAGATAATTCTAAAGGTGTCAACAAAGCCACAACCATTTTTAGATAATAACTGTGACAATGCACCCTTCACTAGGGTTCATCTTACCTTTAGAAACATTACATCCTCCATCTGTTCCTCGCTTAAACCAAAGGACTTGTGCTTCAATGACAAAG
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     494      33 
                                               BLH MIN     494      26 
                                               BLH MPR     479      26 
                                               BLH OVR     494     120 
                                               CDS MIN     494      26 
                                               ORF LNG     494       4 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 2e-021     NP_033076.1 ret proto-oncogene [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ---- 2e-022     NP_858048.1 receptor tyrosine kinase; receptor tyrosine kinase c-ret [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Hs ---- 3e-026     NP_065681.1 ret proto-oncogene isoform c [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Gg ---- 6e-029     NP_990521.1 ret proto-oncogene [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 1e-069     AAG00544.1 c-ret [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 1e-069     NP_001079092.1 ret proto-oncogene [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ13227.5                                                                                    TGA---------------------------------------------------------------------------------------------------------------------------------------------TAGTGA---------------------------TAA---TGA---------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TAG------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2   22  bld Tad5 5g                              XZT29386.5p AGCAGATCGGGGGAGTGGACATTTCAGCATCTCCGCAGCAACTTTTCTTTCTGTGGATTTCATTGTGTGCTGCTTTTGTCGTCTGACACCACTGCTTTTGTCGTCTGACACCACTACTGTCTCAGGAAGAAAACAGCTTGTCCTCTCACATCCCCCTAAGAAGAGAGACAGGCAAGGGACACGCAGCAGGATGCCTGGCAGTGCACGCTGTATGGTGCAGGCTCAGCTAGTGAGCAGGCTGGGCTGAGACAAGCACATTCTAAATCTGAGTTGTGGTGTGGCCAGGTCCAGTCCCATAGCATCGGAGATCCTCTCCCACACTCGGGGAAAGGTCTGCAGGCACTAGGACAGCATGGGTCAATCTGGCTAAAGGATTACAGGAAAACACAGGAGACCGTTCATTCTGTTCCAGACACGCCCTGGAGACACCAGAAGTGGATTATTGCAGAGGGGCAACTTTCTACCTCTGGCACTAAACCCACTCCTAGGTCAGGATGGCACCTGCAGGGTGGGCACTCTGTTTACTCTCCCTCTTGCAAGTGGCCTCTGGACTTTATTTTCTAACAAAGGACTATGACGAGAATTTATATGTGGATCAACCGGCTGGCACACTACTCCTACACATCCATGTGATGAAGGACTCACCACATGAGACACCTCACTTCAGACTCTGTCCAAATAGTTATTTAAGTAGAATCTCTTTCTACCATTGGTTCTGGATAGATGAGCATACAGGGATCCTCTACCCTCACCGGAGTCTTGACA
  5   1   2   24 seed Brn2 5g                             CAAJ13227.5p ............................................................................................................CACCACTACTGTCTCAGGAAGAAAACAGCTTGTCCTCTCACATCCCCCTAAGAAGAGAGACAGGCAAGGGACACGCAGCAGGATGCCTGGCAGTGCACGCTGTATGGTGCAGGCTCAGCTAGTGAGCAGGCTGGGCTGAGACAAGCACATTCTAAATCTGAGTTGTGGTGTGGCCAGGTCCAGTCCCATAGCATCGGAGATCCTCTCCCACACTCGGGGAAAGGTCTGCAGGCACTAGGACAGCATGGGTCAATCTGGCTAAAGGATTACAGGAAAACACAGGAGACCGTTCATTCTGTTCCAGACACGCCCTGGAGACACCAGAAGTGGATTATTGCAGAGGGGCAACTTTCTACCTCTGGCACTAAACCCACTCCTAGGTCAGGATGGCACCTGCAGGGTGGGCACTCTGTTTACTCTCCCTCTTGCAAGTGGCCTCTGGACTTTATTTTCTAACAAAGGACTATGACGAGAATTTATATGTGGATCAACCGGCTGGCACACTACTCCTACACATCCATGTGATGAAGGACTCACCACATGAGACACCTCACTTCAGACTCTGTCCAAATAGTTATTTAAGTAGAATCTCTTTCTACCATTGGTTCTGGATAGATGAGCATACAGGGATCCTCTACCTCAACCGGAGTCTTGACAGGAGCGACTATGAAGTCTTCGCCCAAGGAAGTTCATTAGCCGTTCAGAAGATAATTCTAAAGGTGTCAACAAAGCCACAACCATTTTTAGATAATAACTGTGACAATGCACCCTTCACTAGGGTTCATCTTACCTTTAGAAACATTACATCCTCCATCTGTTCCTCGCTTAAACCAAAGGACTTGTGCTTCAATGACAAAGATCTCTTCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)