Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-THdA046n17.3                         24 END     1          33        4                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 235.0    0Xt7.1-CABE10208.5                          10 PI      73        710     1372                Galnt13 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 92%

 1012105153 Xt7.1-NISC_mq22h10.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-NISC_mq22h10.5 CTGCTGCTGTGGAACAGAATGAGGTTGTCAGCACTGTATGTGTTTGAGCAGCTGAACAGGCAGCTGAAGCACTGTGGATCCTGCTGAAGAGAATCTAAAGATGCTTTAATGTAATGCCTGCAGTTTAGGAGACGTGTTTCGTGTGAGGAAGATGCTTTCATGAGTGCCGACAAGAACCTCCTATTTAAGTGGAACATTATCATTCATGTTATGGATTAACATATCGATGGTGCTGTAGGCAATATTTGTTTTCAGTTTGCAGCTCCTGCAAAATCAACAGATTTACATCATTTTATGTGAACTAAAGCTACAAAAAACAAAACTCTTTTCTCTGTCACCTTTTTAAAATGGACGTCTCTCCCAATGGTTTCAAAGTCAATTCTGAATACCCTTTGTGTCATATAACTGAAGAAATGTAGAAACTACAAACCAACCAATGTAAAGGACCCCTGTGATTAAGGATTACGTCTACATTTTTTTTTTTTTTTTTGCTGTGGCTTCAGATTTTTTATTACACATTTTTGTCACCTCAGTTTTTTCTTGCTATGAAAAAATTTGCATATTGCAAGGTGGTCTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGTTATACTTCAGCGAATGCAACAAATGTGATGATAAGAAGGAACGGGGCCTTCCTGGAGGGGATGGTCCTGACATTAATCAGAAACCACATGAAGGCCCAGGGGAAATGGGAAAGCCTGTTGTCATTCCGAAAGAAGAGCAGGAAAAGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTTAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACGAAAGTGTACCCTGACAGTCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACTACATTATTAAGGACTGTACATAGTGTAATAAATCGGTCACCACGGCATTTATTACAAGAAATCATTCTTGTAGATGATGCCAGTGAGAGAGAGTTTTTGAAAAGACCATTGGAGACATATGTAAAAAAACTTACAGTACCCGTTCATGTATTACGAATGGAGCAGCGTTCAGGGCTGATCAGGGCTCGTCTAAGGGGTGCTGCTGCATCTAAAGGCCAAGTAATTACTTTTCTAGATGCCCACTGTGAATGTACCGTAGGCTGGTTGGAGCCTTTATTGGCACGCATCAAGCATGACAGGCGGACAGTAGTGTGTCCAATCATTGATGTGATCAGTGATGATACGTTCGAATATATGGCTGGTTCTGACATGACTTATGGTGGATTTAACTGGAAATTAAACTTCCGATGGTATCCTGTTCCCCAACGTGAAATGGATCGAAGACGAGGTGATCGGACACTTCCAGTGAGGACTCCTACTA
                                                  Xt7.1-CHK-1008248489       CTGTGGAACAGAATGAGGTTGTCAGCACTGTATGTGTTTGAGCAGCTGAACAGGCAGCTGAAGCACTGTGGATCCTGCTGAAGAGAATCTAAAGATGCTTTAATGTAATGCCTGCAGTTTAGGAGACGTGTTTCGTGTGAGGAAGATGCTTTCATGAGTGCCGACAAGAACCTCCTATTTAAGTGGAACATTATCATTCATGTTATGGATTAACATATCGATGGTGCTGTAGGCAATATTTGTTTTCAGTTTGCAGCTCCTGCAAAATCAACAGATTTACATCATTTTATGTGAACTAAAGCTACAAAAAACAAAACTCTTTTCTCTGTCACCTTTTTAAAATGGACGTCTCTCCCAATGGTTTCAAAGTCAATTCTGAATACCCTTTGTGTCATATAACTGAAGAAATGTAGAAACTACAAACCAACCAATGTAAAGGACCCCTGTGATTAAGGATTACGTCTACATTTTTTTTTTTTTTTTTGCTGTGGCTTCAGATTTTTTATTACACATTTTTGTCACCTCAGTTTTTTCTTGCTATGAAAAAATTTGCATATTGCAAGGTGGTCTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGTTATACTTCAGCGAATGCAACAAATGTGATGATAAGAAGGAACGGGGCCTTCCTGGAGGGGATGGTCCTGACATTAATCAGAAACCACATGAAGGCCCAGGGGAAATGGGAAAGCCTGTTGTCATTCCGAAAGAAGAGCAGGAAAAGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTTAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACGAAAGTGTACCCTGACAGTCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACTACATTATTAAGGACTGTACATAGTGTAATAAATCGGTCACCACGGCATTTATTACAAGAAATCATTCTTGTAGATGATGCCAGTGAGAGAGAGTTTTTGAAAAGACCATTGGAGACATATGTAAAAAAACTTACAGTACCCGTTCATGTATTACGAATGGAGCAGCGTTCAGGGCTGATCAGGGCTCGTCTAAGGGGTGCTGCTGCATCTAAAGGCCAAGTAATTACTTTTCTAGATGCCCACTGTGAATGTACCGTAGGCTGGTTGGAGCCTTTATTGGCACGCATCAAGCATGACAGGCGGACAGTAGTGTGTCCAATCATTGATGTGATCAGTGATGATACGTTCGAATATATGGCTGGTTCTGACATGACTTATGGTGGATTTAACTGGAAATTAAACTTCCGATGGTATCCTGTTCCCCAACGTGAAATGGATCGAAGACGAGGTGATCGGACACTTCCAGTGAGGACTCCTACTATGGCAG
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     545     208 
                                               BLH MIN     545     136 
                                               BLH MPR     509     136 
                                               BLH OVR     545     187 
                                               CDS MIN     545     136 
                                               ORF LNG     545      12 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Dr ---- 1e-057     NP_001038243.1 hypothetical protein LOC554875 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 4e-084     NP_498722.1 GLYcosylation related (68.9 kD) (gly-3) [Caenorhabditis elegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 7e-097     NP_608906.2 CG31651-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Sp ==== 2e-101     XP_780324.2 PREDICTED: similar to UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 3e-157     NP_038842.2 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 5e-159     NP_065207.2 polypeptide N-acetylgalactosaminyltransferase 1 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Gg ==== 7e-160     NP_001006381.1 similar to polypeptide N-acetylgalactosaminyltransferase 1; GalNAc-T1; GalNAc transferase 1; protein-UDP acetylgalactosaminyltransferase 1; UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 1 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Xl ==== 2e-163     AAH60419.1 Unknown (protein for MGC:68664) [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = ?? ==== 2e-163     NP_001083410.1 hypothetical protein LOC398911 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 8e-171     AAH90583.1 Unknown (protein for MGC:69370) [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-NISC_mq22h10.5                                             TGA------------------------------------------------TAA---------------ATG---------TAG---------------TGA---------------------------------------TAA------------------------------------------------------------------------------------------------------------------TAA------------------------------------------ATG---------------------------------------------------------------ATGTAG---------------------------------TGA------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------ATG------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  5   1   2   34  bld Brn3 5g3  out                       CAAK10485.5p CTGCTGCTGTGGAACAGAATGAGGTTGTCAGCACTGTATGTGTTTGAGCAGCTGAACAGGCAGCTGAAGCACTGTGGATCCTGCTGAAGAGAATCTAAAGATGCTTTAATGTAATGCCTGCAGTTTAGGAGACGTGTTTCGTGTGAGGAAGATGCTTTCATGAGTGCCGACAAGAACCTCCTATTTAAGTGGAACATTATCATTCATGTTATGGATTAACATATCGATGGTGCTGTAGGCAATATTTGTTTTCAGTTTGcagctcctgcaaaatcaacagatttacatcattttatgtgaactaaagctacaaaaaaCAAAACTCTTTTCTCTGTCACCTTTTTAAAATGGACGTCTCTCCCAATGGTTTCAAAGTCAATTCTGAATACCCTTTGTGTCATATAACTGAAGAAATGTAGAAACTACAAACCAACCAATGTAAAGGACCCCTGTGATTAAGGATTACGTCTACATTTTTTTTTTTTTTTTTGCTGTGGCTTCAGATTTTTTATTACACATTTTTGTCACCTCAGTTTTTTCTTGCTATGAAAAAATTTGCATATTGCAAGGTGGTCTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGTTATACTTCAGCGAATGCAACAAATGTGATGATAAGAAGGAACGGGGCCTTCCTGGAGGGGATGGTCCTGACATTAATCAGAAACCACATGAAGGCCCAGGGGAAATGGGAAAGCCTGTTGTCATTCCGAAAGAAGAGCAGGAAAAGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTTAACA
  5   1   2      seed Gas1 5g                          NISC_mq22h10.y2                                                                                                                                                                                                                                                                                                                                                GTTAACGGCGTTGCGGGACGTTTAAGCAGCGATTCGGGATTGAGGGTTTTGTATAGAAAATCGGAACTGCGGGCTGTTTTAAGAAAATCGGAACTGTTGGGCGAATGTAAAGGACCCCTGTGATTAAGGATTACGTCTACATTTTTTTTTTTTTTGCTGTGGCTTCAGATTTTTTATTACACATTTTTGTCACCTCAGTTTTTTCTTGCTATGAAAAAATTTGCATATTGCAAGGTGGTCTTGGCCACCTCCTTGGTTTGGGTTTTCCTGGATATGTTTCTGCTGTTATACTTCAGCGAATGCAACAAATGTGATGATAAGAAGGAACGGGGCCTTCCTGGAGGGGATGGTCCTGACATTAATCAGAAACCACATGAAGGCCCAGGGGAAATGGGAAAGCCTGTTGTCATTCCGAAAGAAGAGCAGGAAAAGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTTAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACGAAAGTGTACCCTGACAGTCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACTACATTATTAAGGACT
  5   1   2       bld Brn2      out                         CAAJ653.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGCTCCTATGGAGTTTTCTCTTTGTCTATTTTATATATAATAATTATATAGAAAAAAACATGGCTTTTATTTGTTTTCCTGCATCTGCATTTTGGTTTTAGGTCCTGACATTAATCAGAAACCACATGAAGGCCCAGGGGAAATGGGAAAGCCTGTTGTCATTCCGAAAGAAGAGCAGGAAAAGATGAAGGAGATGTTCAAAATCAATCAGTTTAATCTAATGGCTAGTGAGATGATTGCACTTAACAGATCCTTACCTGATGTCCGCTTAGAAGGGTGTAAAACGAAAGTGTACCCTGACAGTCTGCCAACAACAAGTGTTGTAATAGTGTTTCACAATGAAGCTTGGACTACATTATTAAGGACTGTACATAGTGTAATAAATCGGTCACCACGGCATTTATTACAAGAAATCATTCTTGTAGATGATGCCAGTGAGAGAGAGTTTTTGAAAAGACCATTGGAGACATATGTAAAAAAACTTACAGTACCCGTTCATGTATTACGAATGGAGCAGCGTTCAGGGCTGATCAGGGCTCGTCTAAGGGGTGCTGCTGCATCTAAAGGCCAAGTAATTACTTTTCTAGATGCCCACTGTGAATGTACCGTAGGCTGGTTGGAGCCTTTATTGGCACGCATCAAGCATGACAGGCGGACAGTAGTGTGTCCAATCATTGATGTGATCAGTGATGATACGTTCGAATATATGGCTGGTTCTGACATGACTTATGGTGGATTTAACTGGAAATTAAACTTCCGATGGTATCCTGTTCCCCAACGTGAAATGGATCGAAGACGAGGTGATCGGACACTTCCAGTGAGGACTCCTACTATGGCAGGAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)