Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012105203 Xt7.1-CAAK6568.5 - 3 ESTs
                                                                       .....-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK6568.5                                    GCGTCTACACTATTTCCCATGACATTCCCAAGTCAGGAGGGTCGGCGGCTCTTTGACTTGTTTTGATATTAGTATCTATTCATTTTCACCTCCGATTGAGCCTTTCGTTTACTGAAGAAGAAGCAACCCAGGAACCCAACCTGATTGTTGGTCTGGACATTCGGTGCATGGCTTAGGACTCCAGTTTATGGAATTAGGCTACCAAAGCTTCTGTCAGATTTCCCACGCGTGTCATTTCCACGCTGCAGAGATGCTTTTCCACAGTCTATCAGGGGGGGAGATGCATGGGGTCATCGATGAGATGGACAGAAGGAGCAAGAACGAAGTGTCGGCTATCAGCTCTGCAATTGATAGAGGGGAGACTGAGACGACTATGCCATCCATCAGCAGTGACCGGGCCGCACTCTGTGCAGGGTGTGGAGGGAAGATTTCAGACCGGTACTACCTCTTGGCAGTTGACAAACAATGGCATATGCGTTGCCTAAAGTGCTGTGAATGTAAATTAAACCTGGAGTCGGAGCTTACCTGCTTCAGCAAAGATGGAAGCATATACTGCAAAGAGGACTATTACAGGCGATTTTCAGTCCAAAGATGTGCCAGGTGCCACTTGGGAATCTCTGCCTCTGAGATGGTAATGAGAGCCAGGGACTTAGTGTATCACCTCAACTGCTTTACCTGCAACACTTGCAACAAGATGCTCACCACTGGGGACCATTTTGGCATGAAGGACAATTTAGTATACTGCCGGCTCCACTTTGAGACTTTGATACAGGGAGAATACCAAGTTCACTTCAGTCACTCGGATGTAGCATCAGGGAAGGGCTCAGGACTTGGCACAGGGGCTGCCTCTTTGGGGCTGCCTTACTACAATGGCGTGGGAACTGTCCAGAAAGGGAGACCGAGAAAGAGGAAAAGCCCAGGTCCTGGGGCGGACTTGGCTGCCTACAACGCAGCTCTGAGCTGCAATGAAAATGATGGAGACCATATGGATAGAGACCAGCAGTACACGCCGAATCAGAAAACCAAAAGAATGAGGACCTCCTTCAAACACCATCAGCTACGAACAATGAAGTCCTACTTTGCTATCAACCACAACCCAGATGCCAAGGACCTAAA
                                                  Xt7.1-CHK-1008247664                                          ACACTATTTCCCATGACATTCCCAAGTCAGGAGGGTCGGCGGCTCTTTGACTTGTTTTGATATTAGTATCTATTCATTTTCACCTCCGATTGAGCCTTTCGTTTACTGAAGAAGAAGCAACCCAGGAACCCAACCTGATTGTTGGTCTGGACATTCGGTGCATGGCTTAGGACTCCAGTTTATGGAATTAGGCTACCAAAGCTTCTGTCAGATTTCCCACGCGTGTCATTTCCACGCTGCAGAGATGCTTTTCCACAGTCTATCAGGGGGGGAGATGCATGGGGTCATCGATGAGATGGACAGAAGGAGCAAGAACGAAGTGTCGGCTATCAGCTCTGCAATTGATAGAGGGGAGACTGAGACGACTATGCCATCCATCAGCAGTGACCGGGCCGCACTCTGTGCAGGGTGTGGAGGGAAGATTTCAGACCGGTACTACCTCTTGGCAGTTGACAAACAATGGCATATGCGTTGCCTAAAGTGCTGTGAATGTAAATTAAACCTGGAGTCGGAGCTTACCTGCTTCAGCAAAGATGGAAGCATATACTGCAAAGAGGACTATTACAGGCGATTTTCAGTCCAAAGATGTGCCAGGTGCCACTTGGGAATCTCTGCCTCTGAGATGGTAATGAGAGCCAGGGACTTAGTGTATCACCTCAACTGCTTTACCTGCAACACTTGCAACAAGATGCTCACCACTGGGGACCATTTTGGCATGAAGGACAATTTAGTATACTGCCGGCTCCACTTTGAGACTTTGATACAGGGAGAATACCAAGTTCACTTCAGTCACTCGGATGTAGCATCAGGGAAGGGCTCAGGACTTGGCACAGGGGCTGCCTCTTTGGGGCTGCCTTACTACAATGGCGTGGGAACTGTCCAGAAAGGGAGACCGAGAAAGAGGAAAAGCCCAGGTCCTGGGGCGGACTTGGCTGCCTACAACGCAGCTCTGAGCTGCAATGAAAATGATGGAGACCATATGGATAGAGACCAGCAGTACACGCCGAATCAGAAAACCAAAAGAATGAGGACCTCCTTCAAACACCATCAGCTACGAACAATGAAGTCCTACTTTGCTATCAACCACAACCCAGATGCCAAGGACCTAAAGCAGCT
                                                      consensus depths                                         1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     250     110                                    
                                               BLH MIN     187     135                                    
                                               BLH OVR     187     209                                    
                                               ORF LNG     187      13                                    
                                                                                                                                                                                                                                                                                               PROTEIN --- Cs ---- 2e-026     BAB68342.1 Cs-LHX3 [Ciona savignyi] --------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Bb ---- 3e-030     BAB91364.1 LIM homeodomain protein [Branchiostoma belcheri] -----=====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PROTEIN --- Ce ---- 3e-030     NP_509970.1 abnormal ThermoTaXis TTX-3, C.Elegans Homeobox, LIM (45.7 kD) (ttx-3) [Caenorhabditis elegans] ---------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Bf ==== 2e-032     AAF34717.1 LIM-homeodomain transcription factor islet [Branchiostoma floridae] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xt ---- 5e-032     AAT72002.1 isl1 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 2e-035     CAA06919.1 LIM homeodomain protein [Ciona intestinalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 1e-060     NP_724428.1 CG8376-PA, isoform A [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 9e-074     XP_782032.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 5e-145     NP_001032319.1 LIM homeodomain type transcription factor Lhx2 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                    
                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 3e-154     NP_004780.3 LIM homeobox protein 2; LIM HOX gene 2 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 3e-154     NP_034840.1 LIM homeobox protein 2; LIM homeo box protein 2 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Gg ==== 9e-163     NP_990220.1 LIM homeodomain [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 1e-178     AAN41461.1 LIM homeobox protein 2 [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK6568.5                                                       TGA------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------ATG------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  3  -1   2      skin TpA                             TTpA010p08.q1kT7                                    GCGTCTACACTATTTCCCATGACATTCCCAAGTCAGGAGGGTCGGCGGCTCTTTGACTTGTTTTGATATTAGTATCTATTCATTTTCACCTCCGATTGAGCCTTTCGTTTACTGAAGAAGAAGCAACCCAGGAACCCAACCTGATTGTTGGTCTGGACATTCGGTGCATGGCTTAGGACTCCAGTTTATGGAATTAGGCTACCAAAGCTTCTGTCAGATTTCCCACGCGTGTCATTTCCACGCTGCAGAGATGCTTTTCCACAGTCTATCAGGGGGGGAGATGCATGGGGTCATCGATGAGATGGACAGAAGGAGCAAGAACGAAGTGTCGGCTATCAGCTCTGCAATTGATAGAGGGGAGACTGAGACGACTATGCCATCCATCAGCAGTGACCGGGCCGCACTCTGTGCAGGGTGTGGAGGGAAGATTTCAGACCGGTACTACCTCTTGGCAGTTGACAAACAATGGCATATGCGTTGCCTAAAGTGCTGTGAATGTAAATTAAACCTGGAGTCGGAGCTTACCTGCTTCAGCAAAGATGGAAGCATATACTGCAAAGAGGACTATTACAGCTGAAAGCTCACAGGGACTTGCTGACTAACTGTGACCTATCCTGGTTCTGATTGCACAGGCGATTTTCAGTCCAAAGATGTGCCAGGTGCCACTTGGGAATCTCTGCCTCTGAGATGGTAATGAGAGCCAGGGGACTTAGTGTATCACCTCAACTGCTTTACCTG
  5   1   2      seed Brn3      ?                          CAAK6568.5p                                                                                                                                                                                                                                                                  CCAGCACCCAGACACCCTCTCCCCCTGCCTTTTCCTGTACATAGGCATTTAAATGCAAGCACCCCACCCAATAACAGCGCTAGGTCTCCTCTTCATTTAGCGCACCATTTACCAGCTCTCCTATTCCCACACTCTCTGGACCTGCAAGACTATGCCATCCATCAGCAGTGACCGGGCCGCACTCTGTGCAGGGTGTGGAGGGAAGATTTCAGACCGGTACTACCTCTTGGCAGTTGACAAACAATGGCATATGCGTTGCCTAAAGTGCTGTGAATGTAAATTAAACCTGGAGTCGGAGCTTACCTGCTTCAGCAAAGATGGAAGCATATACTGCAAAGAGGACTATTACAGGCGATTTTCAGTCCAAAGATGTGCCAGGTGCCACTTGGGAATCTCTGCCTCTGAGATGGTAATGAGAGCCAGGGACTTAGTGTATCACCTCAACTGCTTTACCTGCAACACTTGCAACAAGATGCTCACCACTGGGGACCATTTTGGCATGAAGGACAATTTAGTATACTGCCGGCTCCACTTTGAGACTTTGATACAGGGAGAATACCAAGTTCACTTCAGTCACTCGGATGTAGCATCAGGGAAAGGCTCAGGACTTGGCACAGGGGCTGCCTCTTTGGGGCTGCCTTACTACAATGGCGTGGGAACTGTCCAGAAAGGGAGACCGAGAAAGA
  5   1   2       bld Gas                            TGas005l22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGGGACTTGCTGACTAACTGTGACCTATCCTGGTTCTGATTGCACAGGCGATTTTCAGTCCAAAGATGTGCCAGGTGCCACTTGGGAATCTCTGCCTCTGAGATGGTAATGAGAGCCAGGGACTTAGTGTATCACCTCAACTGCTTTACCTGCAACACTTGCAACAAGATGCTCACCACTGGGGACCATTTTGGCATGAAGGACAATTTAGTATACTGCCGGCTCCACTTTGAGACTTTGATACAGGGAGAATACCAAGTTCACTTCAGTCACTCGGATGTAGCATCAGGGAAGGGCTCAGGACTTGGCACAGGGGCTGCCTCTTTGGGGCTGCCTTACTACAATGGCGTGGGAACTGTCCAGAAAGGGAGACCGAGAAAGAGGAAAAGCCCAGGTCCTGGGGCGGACTTGGCTGCCTACAACGCAGCTCTGAGCTGCAATGAAAATGATGGAGACCATATGGATAGAGACCAGCAGTACACGCCGAATCAGAAAACCAAAAGAATGAGGACCTCCTTCAAACACCATCAGCTACGAACAATGAAGTCCTACTTTGCTATCAACCACAACCCAGATGCCAAGGACCTAAAGCAGCTAGCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)