Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 85%

 1012105408 Xt7.1-CBXT7921.5 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBXT7921.5 AGAAAATCCAGCTGTGGCACTGGTGATGCTCCGCTGTGCGAACCGTGGTGCCCTGGGCATAAGGGATCCCTGCAGTGAGCGCTGGAGACGGATTTCCCCGGGCACAGAATATAACATCTGTGGGCACAGTGGGCACAGGGGGTCCCTGCTGTAGGGGCAAAGGAGCCGGCTATAGGCTGCTTTCCGTTCCACGCCGAGAGAGCCCAGGGGAAGGCAGGAGTTACACTGCAGATTACATGCTCCTATGAAACTAGCAAGTGACGATCTGTTTCTTCCCTTGAGATGGCTACAAAGAAAAGGGCCCATACTTGTAGCTTGTCAATTTCCCCGTGTGATCACATGACCAGCACCTCCCTGCTAAGGATGGGGATAGATTTCCACGTCAGCTTACGTCTTCCAATTTCTACTTCACGGATCTGCTTCAAAGAGGCAGCTGCATTAGGGAATGATGTTAAGCTCAGCTAATGCGGACAGCCCGAGGTAGCCTAATGATGGATTTTGATGAGCGTGTTCCTTGCTCCTCTAACATGTATTTGCCAAGTTGCACTTACTACGTCTCGGGTCCTGATTTCTCCAGCCTTCCTTCATTCCTGCCCCAAACCCCATCTTCTCGTCCCATGACATATTCCTATTCTTCCAACCTCCCCCAGGTCCAACCAGTGCGAGAAGTTACCTTCAGGGAATATGCCATTGACACGTCCAGTAAGTGGCACCACAGGAACAATCTGCCCCATTGCTACTCAGCAGAGGAGATCATGCACAGGGACTGCCTGCCTGCGTCCAACACTGCTAGCGTGGGGGAAATGTTCGCCAAAAACCCCACTAATGTCTATCACCCCAATGCCAACGTTTCGTCCAATTTCTATAGCACAGTGGGCAGGAATGGGGTGCTGCCACAAGCCTTTGATCAGTTCTTTGAGACAGCCTATGGCACCACGGAAAGCCAGCCCTCGGATTATTCTGTGGATAAGAGCTGCGACAAAG
                                                  Xt7.1-CHK-1008252228       TCCAGCTGTGGCACTGGTGATGCTCCGCTGTGCGAACCGTGGTGCCCTGGGCATAAGGGATCCCTGCAGTGAGCGCTGGAGACGGATTTCCCCGGGCACAGAATATAACATCTGTGGGCACAGTGGGCACAGGGGGTCCCTGCTGTAGGGGCAAAGGAGCCGGCTATAGGCTGCTTTCCGTTCCACGCCGAGAGAGCCCAGGGGAAGGCAGGAGTTACACTGCAGATTACATGCTCCTATGAAACTAGCAAGTGACGATCTGTTTCTTCCCTTGAGATGGCTACAAAGAAAAGGGCCCATACTTGTAGCTTGTCAATTTCCCCGTGTGATCACATGACCAGCACCTCCCTGCTAAGGATGGGGATAGATTTCCACGTCAGCTTACGTCTTCCAATTTCTACTTCACGGATCTGCTTCAAAGAGGCAGCTGCATTAGGGAATGATGTTAAGCTCAGCTAATGCGGACAGCCCGAGGTAGCCTAATGATGGATTTTGATGAGCGTGTTCCTTGCTCCTCTAACATGTATTTGCCAAGTTGCACTTACTACGTCTCGGGTCCTGATTTCTCCAGCCTTCCTTCATTCCTGCCCCAAACCCCATCTTCTCGTCCCATGACATATTCCTATTCTTCCAACCTCCCCCAGGTCCAACCAGTGCGAGAAGTTACCTTCAGGGAATATGCCATTGACACGTCCAGTAAGTGGCACCACAGGAACAATCTGCCCCATTGCTACTCAGCAGAGGAGATCATGCACAGGGACTGCCTGCCTGCGTCCAACACTGCTAGCGTGGGGGAAATGTTCGCCAAAAACCCCACTAATGTCTATCACCCCAATGCCAACGTTTCGTCCAATTTCTATAGCACAGTGGGCAGGAATGGGGTGCTGCCACAAGCCTTTGATCAGTTCTTTGAGACAGCCTATGGCACCACGGAAAGCCAGCCCTCGGATTATTCTGTGGATAAGAGCTGCG
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     488      96 
                                               BLH MIN     488      50 
                                               BLH MPR     488      50 
                                               BLH OVR     464     140 
                                               CDS MIN     464      50 
                                               ORF LNG     464       5 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 3e-035     AAI15002.1 MGC131014 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = ?? ==== 4e-041     XP_682894.1 PREDICTED: homeo box D11a isoform 1 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Dr ==== 7e-065     NP_571222.1 homeo box A11b [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 1e-071     NP_005514.1 homeobox protein A11 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 1e-071     NP_034580.1 homeobox protein A11 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Gg ==== 1e-081     NP_989950.1 homeodomain-containing protein [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 1e-088     AAG39071.1 Hoxa-11 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBXT7921.5                        TGA---------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------TGA---TAG------------------------TGA------------------------------TAG------------------TGA---------------------------------------------------------------------------------------------------------------TGA---TAA---------ATG---------------------ATGATG---------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   2      seed Tbd1      in                         CBXT7921.b1 AGAAAATCCAGCTGTGGCACTGGTGATGCTCCGCTGTGCGAACCGTGGTGCCCTGGGCATAAGGGATCCCTGCAGTGAGCGCTGGAGACGGATTTCCCCGGGCACAGAATATAACATCTGTGGGCACAGTGGGCACAGGGGGTCCCTGCTGTAGGGGCAAAGGAGCCGGCTATAGGCTGCTTTCCGTTCCACGCCGAGAGAGCCCAGGGGAAGGCAGGAGTTACACTGCAGATTACATGCTCCTATGAAACTAGCAAGTGACGATCTGTTTCTTCCCTTGAGATGGCTACAAAGAAAAGGGCCCATACTTGTAGCTTGTCAATTTCCCCGTGTGATCACATGACCAGCACCTCCCTGCTAAGGATGGGGATAGATTTCCACGTCAGCTTACGTCTTCCAATTTCTACTTCACGGATCTGCTTCAAAGAGGCAGCTGCATTAGGGAATGATGTTAAGCTCAGCTAATGCGGACAGCCCGAGGTAGCCTAATGATGGATTTTGATGAGCGTGTTCCTTGCTCCTCTAACATGTATTTGCCAAGTTGCACTTACTACGTCTCGGGTCCTGATTTCTCCAGCCTTCCTTCATTCCTGCCCCAAACCCCATCTTCTCGTCCCATGACATATTCCTATTCTTCCAACCTCCCCCAGGTCCAACCAGTGCGAGAAGTTACCTTCAGGGAATATGCCATTGACACGTCCAGTAAGTGGCACCACAGGAACA
  3   1   2       bld Tbd1      in                         CBXT7921.g1                                                                                                                                                                                                                                                                          CTGTTTCTTCCCTTGAGATGGCTACAAAGAAAAGGGCCCATACTTGTAGCTTGTCAATTTCCCCGTGTGATCACATGACCAGCACCTCCCTGCTAAGGATGGGGATAGATTTCCACGTCAGCTTACGTCTTCCAATTTCTACTTCACGGATCTGCTTCAAAGAGGCAGCTGCATTAGGGAATGATGTTAAGCTCAGCTAATGCGGACAGCCCGAGGTAGCCTAATGATGGATTTTGATGAGCGTGTTCCTTGCTCCTCTAACATGTATTTGCCAAGTTGCACTTACTACGTCTCGGGTCCTGATTTCTCCAGCCTTCCTTCATTCCTGCCCCAAACCCCATCTTCTCGTCCCATGACATATTCCTATTCTTCCAACCTCCCCCAGGTCCAACCAGTGCGAGAAGTTACCTTCAGGGAATATGCCATTGACACGTCCAGTAAGTGGCACCACAGGAACAATCTGCCCCATTGCTACTCAGCAGAGGAGATCATGCACAGGGACTGCCTGCCTGCGTCCAACACTGCTAGCGTGGGGGAAATGTTCGCCAAAAACCCCACTAATGTCTATCACCCCAATGCCAACGTTTCGTCCAATTTCTATAGCACAGTGGGCAGGAATGGGGTGCTGCCACAAGCCTTTGATCAGTTCTTTGAGACAGCCTATGGCACCACGGAAAGCCAGCCCTCGGATTATTCTGTGGATAAGAGCTGCGACAAAGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)