Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-XZG16831.5                           12 END     1          33        8                Xrcc5-A-prov protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 59%
Application error: Error while executing statement.
22001 [Microsoft][ODBC SQL Server Driver][SQL Server]String or binary data would be truncated.

Use your browser's 'Back <==' button to return to the previous page, where you may be able to correct the problem.
There may be more error messages further down this page - print, save, or cut&paste these messages if you want to pass them on.
1012105559 Xt7.1-CAAK10799.5 - 3 ESTs ..-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880... ? ? ? ? ? ? ? ? Xt7.1-CAAK10799.5 CCCGGAAGCAGCAAGATGGCCCGGGCAGCCAAAAGTGCCGTGGTGCTGTGCATGGACGTAGGACTCGCAATGAGCCATTCCAACCAAGGAGAGGAGTCTCCGTTTGAACAGGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAGAGCAAGGATGAGATTGCAGTGGTTCTGTTTGGCACGGACACCACGGATAATGCCTTGGCTCGTGGGGACCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTCCTAGAACAGATACAGAATGTGGTTGAGCCAGGCTCCACGCAAGCCGACTTCCTCGATGCTCTGATCGTGTCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACGAGCGGCTGCACATCGCAGTATTCTCCGACCTCAGCAGCCCCTTTAGTGTCGACCAACTTGAGGTTATTATCGCAAACCTGAAAAAAGCCGGGATCAGCCTTCAGTTCTTTCTGCCTTTCCCTGTTGAGGAAGAGGAGGCTGGAGATTCCAGTAATAACAGAGGGGATTCGGGCAGCTCGGACAGAGGGCGGGGGCCTGGGAAAGGCCTGTCTGACCAGCAGAAGGAAGGCATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGGGAAGACGGACTGAGTGAAGTTTTTACGTTCAGGGAAAGTCTGGAGAGGCTGAGCATCTTTAAGAAGATTGAGAGGAGACCGATGGCGTGGCCGTGCCAGCTGACCATAGGGTCGGGCCTTTCCATACGCATCGTGGGCTATAAATCCGTCACCGAGGAGAAAGTGAAAAGACCTGGGCTCACGTTGATGGCCAAATCGAAC Xt7.1-CHK-1008250965 AGCAGCAAGATGGCCCGGGCAGCCAAAAGTGCCGTGGTGCTGTGCATGGACGTAGGACTCGCAATGAGCCATTCCAACCAAGGAGAGGAGTCTCCGTTTGAACAGGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAGAGCAAGGATGAGATTGCAGTGGTTCTGTTTGGCACGGACACCACGGATAATGCCTTGGCTCGTGGGGACCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTCCTAGAACAGATACAGAATGTGGTTGAGCCAGGCTCCACGCAAGCCGACTTCCTCGATGCTCTGATCGTGTCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACGAGCGGCTGCACATCGCAGTATTCTCCGACCTCAGCAGCCCCTTTAGTGTCGACCAACTTGAGGTTATTATCGCAAACCTGAAAAAAGCCGGGATCAGCCTTCAGTTCTTTCTGCCTTTCCCTGTTGAGGAAGAGGAGGCTGGAGATTCCAGTAATAACAGAGGGGATTCGGGCAGCTCGGACAGAGGGCGGGGGCCTGGGAAAGGCCTGTCTGACCAGCAGAAGGAAGGCATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGGGAAGACGGACTGAGTGAAGTTTTTACGTTCAGGGAAAGTCTGGAGAGGCTGAGCATCTTTAAGAAGATTGAGAGGAGACCGATGGCGTGGCCGTGCCAGCTGACCATAGGGTCGGGCCTTTCCATACGCATCGTGGGCTATAAATCCGTCACCGAGGAGAAAGTGAAAAGACCTGGGCTCACGTTGATGxCxAAx consensus depths 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 2 3 3 3 3 3 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 2 1 2 1 2 BLH ATG 15 102 PROTEIN === Ci ==== 1e-038 FAA00135.1 TPA: zinc finger protein [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================= PREDICTED = Sp ==== 6e-039 XP_788472.2 PREDICTED: similar to ATP-dependent DNA helicase 2 subunit 2 (ATP-dependent DNA helicase II 80 kDa subunit) (Lupus Ku autoantigen protein p86) (Ku86) (Ku80) (86 kDa subunit of Ku antigen) (Thyroid-lupus autoantigen) (TLAA) (CTC box-binding factor 85 kDa su ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Dr ==== 5e-087 NP_001017360.1 X-ray repair complementing defective repair in Chinese hamster cells 5 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN --- Mm ---= 1e-094 NP_033559.1 X-ray repair complementing defective repair in Chinese hamster cells 5 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================ PROTEIN --- Hs ---= 3e-096 NP_066964.1 ATP-dependent DNA helicase II [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================= PREDICTED - Gg ---- 2e-102 XP_422072.2 PREDICTED: similar to Ku (p70/p80) protein [Gallus gallus] ---========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Xl ==== 5e-140 AAH77439.1 Xrcc5-A-prov protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================= PROTEIN === ?? ==== 5e-140 NP_001081127.1 X-ray repair complementing defective repair in Chinese hamster cells 5 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== Xt7.1-CAAK10799.5 ATG---------------------------------ATG---------------ATG---------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG ORF ... open reading frame ... 5 1 2 24 seed Brn3 5g ? CAAK10799.5p ......................................................................................................CCCGGAAGCAGCAAGATGGCCCGGGCAGCCAAAAGTGCCGTGGTGCTGTGCATGGACGTAGGACTCGCAATGAGCCATTCCAACCAAGGAGAGGAGTCTCCGTTTGAACAGGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCAGAGAGCAAGGATGAGATTGCAGTGGTTCTGTTTGGCACGGACACCACGGATAATGCCTTGGCTCGTGGGGACCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTCCTAGAACAGATACAGAATGTGGTTGAGCCAGGCTCCACGCAAGCCGACTTCCTCGATGCTCTGATCGTGTCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACGAGCGGCTGCACATCGCAGTATTCTCCGACCTCAGCAGCCCCTTTAGTGTCGACCAACTTGAGGTTATTATCGCAAACCTGAAAAAAGCCGGGATCAGCCTTCAGTTCTTTCTGCCTTTCCCTGTTGAGGAAGAGGAGGCTGGAGATTCCAGTAATAACAGAGGGGATTCGGGCAGCTCGGACAGAGGGCGGGGGCCTGGGAAAGGCCTGTCTGACCAGCAGAAGGAAGGCATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGGGAAGACGGACTGAGTGAAGTTTTTACGTTCAGGGAAAGTCTGGAGAGGCTGAGCATCTTTAAGAAGATTGAGAGGAGACCGATGGCGTGGCCGTGCCAGCTGACCATAGGGTCGGGCCTTTCCATACGCATCGTGGGCTATAAATCCGTCACCGAGGAGAAAGTGAAAAGACCTGGGCTCACGTTGATGCCAAATCNGACAAA 5 1 1 10 add Te1 5g3 out CBWN10660.b1 ................................................................................................................GCAAGATGGCCCGGGCAGCCAAAAGTGCCGTGGTGCTGTGCATGGACGTAGGACTCGCAATGAGCCATTCCAACCAAGGAGAGGAGTCTCCGTTTGAACAGGCCAAGAAGGTTATGATGCTCTTCCTGCAGAGACAGGTGTTTGCGGAGAGCAAGGATGAGATTGCAGTGGTTCTGTTTGGCACGGACACTACGGATAATGCCTTGGCTCGCGGGGACCAGTATGAGAACATCTCTGTCCATCGCCACCTGATGCTTCCAGACTTTGACCTCCTAGAACAGATACAGAATGTGGTTGAGCCAGGCTCCACGCAAGCCGACTTCCTCGATGCTCTGATCGTGTCAATGGATCTTCTGCAGAAGGAGACGCTGGGAAAGAAGTACGAGCGGCTGCACATTGCAGTATTCTCCGACCTCAGCAGCCCCTTTAGCGTCGACCAACTTGAGGTTATTATCGCAAACCTGAAAAAAGCCGGGATCAGCCTTCAGTTCTTCCTGCCTTTCCCTGTTGATGAAGAGGAGGCTGGAGATTCCAGTAATAACAGAGGGGATTCGGGCAGCTCGGACAGAGGGCGGGGGCCTGGGAAAGGCCTGTCTGACCAGCAGAAGGAAGGCATTGAGATGGTGAGGAAGATCATGTTCTCTCTGGACGGNG 5 -1 2 bld TpA TTpA069m22.p1kSP6 ATATCTGAGGTGGTAGGCCTGATAGAGAGGAAGATCATGTTCTCTCTGGACGGGGAAGACGGACTGAGTGAAGTTTTTACGTTCAGGGAAAGTCTGGAGAGGCTGAGCATCTTTAAGAAGATTGAGAGGAGACCGATGGCGTGGCCGTGCCAGCTGACCATAGGGTCGGGCCTTTCCATACGCATCGTGGGCTATAAATCCGTCACCGAGGAGAAAGTGAAAAAGACCTGGGCTCACGTTGATGCCAAATCGAACAAAAAAAAAAAAAAAAAAGCGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)