Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012105656 Xt7.1-TGas064p06.5 - 3 ESTs
                                                                       ...-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas064p06.5                                            CGCCTCTACAGGGGTCTTTTCTGCTCATGTCACCACATAAAACTATCAGTTGGTTTGAGGAAGGACATGGAGACAACTACTTAGCTTATCTCCCACCCTGCAAGAAAGGAAACCTTTCCCCCCAACCCTTGTTAATTCAGCCACTGGCCAGGACAGGAGCTCATTCCCGATGCTGAAGTGAAGATCAGAGTTTCTCCGAAGAGGGACCAGGCTGGCGAAGGGCTGAATTCCCATCTGCTCTGCCAGGGAGGGGGTCCTGCGTTTGGACAAGTCTTTTCCTTCTAAACTGCATTCCGGATGCAGAGTGACAACTTCTAAAAACTCAAGGTTTCCCCAGTTTGCAAGTGAAGATGCCTCGTCCTGGGAGAAACACCTACAGCGACCAGAAGCCTCCCTACTCCTACATTTCCCTGACTGCCATGGCCATCCAGAGCTCCCAAGAGAAGATGCTGCCCCTTAGTGAGATCTACAAGTTCATCATGGACAGGTTCCCCTACTACAGAGAGAACACCCAGAGGTGGCAAAACTCTCTGAGGCACAACTTGTCTTTCAACGACTGTTTCATCAAAATCCCAAGGAGACCCGACCAGCCTGGAAAGGGCAGTTTCTGGGCATTGCATCCCAGCTGTGGGGATATGTTCGAAAATGGCAGTTTCCTGAGACGCAGAAAGAGGTTCAAGGTGATGAAATCGGACCATTTGGCCCCCAGCAAAGCCTCGGATGCCGCCCAATACTTGCAGCAACAAGCCAAGCTGAGACTCAGCGCCCTAGCGGCCTCTGGCACTCACTTGCCTCAGATGTCCACCTATAATCTAGGGGTATCCCAGACTTCTAGCTTTAAACACCCCTTCGCCATTGAGAATATTATCGCCAGAGAGTATAAAATGCCTGGAGGACTTGCCTTTTCCACCATGCAGCCCATGCCAGCCGCCTACCCTCTACATAACCAATTGACTACTGTTGGAAGTTCCATTGGCACAGGCTGGCCCCACATGTACAGCTCCAGCATGCTGGACACAACCACCCCCATATCAATGGGCAACAGCGACTACAGTGTCAGCGCCTATGGAGTACCTATCAAACCTATATGCCATGGGGCACAAACCTTACCGGCCATCCCAGTCCCTA
                                                  Xt7.1-CHK-1008248640                                                  TACAGGGGTCTTTTCTGCTCATGTCACCACATAAAACTATCAGTTGGTTTGAGGAAGGACATGGAGACAACTACTTAGCTTATCTCCCACCCTGCAAGAAAGGAAACCTTTCCCCCCAACCCTTGTTAATTCAGCCACTGGCCAGGACAGGAGCTCATTCCCGATGCTGAAGTGAAGATCAGAGTTTCTCCGAAGAGGGACCAGGCTGGCGAAGGGCTGAATTCCCATCTGCTCTGCCAGGGAGGGGGTCCTGCGTTTGGACAAGTCTTTTCCTTCTAAACTGCATTCCGGATGCAGAGTGACAACTTCTAAAAACTCxAxGxTTCCCCAGTTTGCAAGTGAAGATGCCTCGTCCTGGGAGAAACACCTACAGCGACCAGAAGCCTCCCTACTCCTACATTTCCCTGACTGCCATGGCCATCCAGAGCTCCCAAGAGAAGATGCTGCCCCTTAGTGAGATCTACAAGTTCATCATGGACAGGTTCCCCTACTACAGAGAGAACACCCAGAGGTGGCAAAACTCTCTGAGGCACAACTTGTCTTTCAACGACTGTTTCATCAAAATCCCAAGGAGACCCGACCAGCCTGGAAAGGGCAGTTTCTGGGCATTGCATCCCAGCTGTGGGGATATGTTCGAAAATGGCAGTTTCCTGAGACGCAGAAAGAGGTTCAAGGTGATGAAATCGGACCATTTGGCCCCCAGCAAAGCCTCGGATGCCGCCCAATACTTGCAGCAACAAGCCAAGCTGAGACTCAGCGCCCTAGCGGCCTCTGGCACTCACTTGCCTCAGATGTCCACCTATAATCTAGGGGTATCCCAGACTTCTAGCTTTAAACACCCCTTCGCCATTGAGAATATTATCGCCAGAGAGTATAAAATGCCTGGAGGACTTGCCTTTTCCACCATGCAGCCCATGCCAGCCGCCTACCCTCTACATAACCAATTGACTACTGTTGGAAGTTCCATTGGCACAGGCTGGCCCCACATGTACAGCTCCAGCATGCTGGACACAACCACCCCCATATCAATGGGCAACAGCGACTACAGTGTCAGCGCCTATGGAGTACCTATCAAACCTATATGCCATGGGGCACAAACCTTACCGGCCATCCCAG
                                                      consensus depths                                                 1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     350     165                                            
                                               BLH MIN     350     125                                            
                                               BLH OVR     350     309                                            
                                               ORF LNG     350      10                                            
                                                                                                                                                                             PROTEIN --- Br ---- 1e-017     CAA72307.1 whn transcription factor [Branchiostoma lanceolatum] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN --- Sc ---- 1e-019     NP_009991.2 Dosage-dependent suppressor of cmd1-1 mutation; shows homology to fork headfamily of DNA-binding proteins; Hcm1p [Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Bb ==== 2e-037     BAD97363.1 forkhead protein FoxE4 [Branchiostoma belcheri] =================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN --- Cs ---- 1e-042     BAB16313.1 fork head/HNF-3 homologue [Ciona savignyi] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                            PREDICTED - Gg ---- 1e-043     XP_001236383.1 PREDICTED: forkhead box A2 [Gallus gallus] ----------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Xt ---- 1e-043     AAH88590.1 Unknown (protein for IMAGE:6991484) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Ce ==== 2e-050     NP_494704.1 abnormal cell LINeage LIN-31, forkhead box B1.1 (26.9 kD) (lin-31)[Caenorhabditis elegans] ===========================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Dm ==== 9e-054     NP_524495.1 forkhead domain 96Ca CG11921-PA [Drosophila melanogaster] ====================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Ci ==== 1e-054     CAD58964.1 FoxB protein [Ciona intestinalis] ==============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Sp ==== 2e-061     NP_999797.1 winged helix transcription factor Forkhead-1 [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Bf ==== 2e-068     CAD44627.1 forkhead transcription factor [Branchiostoma floridae] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Dr ==== 9e-123     NP_571360.1 forkhead box B1.2; mariposa; fork head domain protein 3; forkhead-3 [Daniorerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 1e-129     NP_071773.1 forkhead box B1; forkhead box B1a; forkhead box B1b; mesoderm/mesenchymeforkhead 3 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Hs ==== 9e-132     NP_036314.2 forkhead box B1 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 5e-147     AAC62623.1 forkhead-domain-containing protein 5 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === ?? ==== 5e-147     NP_001081836.1 forkhead-domain-containing protein 5 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas064p06.5                                                                      ATG------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------ATG------------------------------------------------------------------ATG------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------ATG------ATG---------------------------------------------------------------------ATG------------ATG------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   1           Gas  FL                     TGas064p06.FL-Sanger                                                                                                                                                                                                                             TGAAGATCAGAGTTTCTCCGAAGAGGGACCAGGCTGGCGAAGGGCTGAATTCCCATCTGCTCTGCCAGGGAGGGGGTCCTGCGTTTGGACAAGTCTTTTCCTTCTAAACTGCATTCCGGATGCAGAGTGACAACTTCTAAAAACTCCAAGGTTTCCCCAGTTTGCAAGTGAAGATGCCTCGTCCTGGGAGAAACACCTACAGCGACCAGAAGCCTCCCTACTCCTACATTTCCCTGACTGCCATGGCCATCCAGAGCTCCCAAGAGAAGATGCTGCCCCTTAGTGAGATCTACAAGTTCATCATGGACAGGTTCCCCTACTACAGAGAGAACACCCAGAGGTGGCAAAACTCTCTGAGGCACAACTTGTCTTTCAACGACTGTTTCATCAAAATCCCAAGGAGACCCGACCAGCCTGGAAAGGGCAGTTTCTGGGCATTGCATCCCAGCTGTGGGGATATGTTCGAAAATGGCAGTTTCCTGAGACGCAGAAAGAGGTTCAAGGTGATGAAATCGGACCATTTGGCCCCCAGCAAAGCCTCGGATGCCGCCCAATACTTGCAGCAACAAGCCAAGCTGAGACTCAGCGCCCTAGCGGCCTCTGGCACTCACTTGCCTCAGATGTCCACCTATAATCTAGGGGTATCCCAGACTTCTAGCTTTAAACACCCCTTCGCCATTGAGAATATTATCGCCAGAGAGTATAAAATGCCTGGAGGACTTGCCTTTTCCACCATGCAGCCCATGCCAGCCGCCTACCCTCTACATAACCAATTGACTACTGTTGGAAGTTCCATTGGCACAGGCTGGCCCCACATGTACAGCTCCAGCATGCTGGACACAACCACCCCCATATCAATGGGCAACAGCGACTACAGTGTCAGCGCCTATGGAGTACCTATCAAACCTATATGCCATGGGGCACAAACCTTACCGGCCATCCCAGTCCCTATAAAACCAACGCTAGCATCTGTGCCAGCGCTTCCAGCCCTCCCAACACATATCCCAGCTATCCTATCGAACTCCTCTCCATCCCTGAGTCCAACCTCTCCACAGACAGCCACAAGCCAAAGCAGCCCTGCTACTCCCAGCGACACCCTCACCAGCCCCCCCACTGCTCTGCTCTCTGTAGCCGTGCACTGACCCACCTGCTGGCACTCTACCCATCCGCACAGTCTGCTGCCCACTTGTTTGTTGGCTCTTAGTGAGAAACTCTTCACTTCTGAATAGAGCTTTGCATCACGTCCCCCTTTCAACATACTTGGGCAAGTCTTGTCTTCTGACAGTAATTCCTAGTATGTGGGCACTAGGGGTGTTCAAAAAGAAACGTGGGAATTCCCATAGAAAATGAAATGTCTTTNCCAAAACTGTGGAAAAATGAAACCTAAATATCAGGATAACCACTGAATTACACAATTAGTGATGGCTGCAATTAACTGTCCCTAATTAATCTAGTTACATAGACTTGTCACAGTAATCAGCACTCACAATGTACTTTTGCAGTTTTGTGCTTTGCCTATTTTACATTTTGGGTTCCCTCTGCAGTTACAGCTATACCTTCCAAGTAGAAGTGATCAGATCCATAGCTACTACAACTTATAATAAAAACAAATACATCATAGTGACAGAAATTTGCTGTCGACCTTGTTTTCACATTACCTGCCCATATGTAAATACTGAACCCACTATTCTGCTCGGTGTAGCAATCTTTGTCAGTGGTTATCATTTCACAGGCCTGAGGGATGATTTATTTAGTCGATACACACCGAGAAAATTATATTTATTATTAAAAAAAGGAGCAGTCAGGCATTTAGCTATATAGCTATTGCTTGTTTTCAGACCTCTGTAATACTGCTCCTGTGAGGCACCTGTAAATGTTTGTGAATAGGAAAGAATATACGTTGTGTATAATGCACTTTGATTTGGACCCCCAGCTGGTTTCTATGCTTTTTTAAAAGCTGAAATTTGCTTCTTTGCTGTATGTGCTGGACTGTCTCATTCCAAGTAAATCGGCTGTCACGGAATTGTAAAGTAAATGACCCTTGCGATTGCTTATTGTACAGGCAGCATGGCATCTCCAGTGTTGTGTTCCCTTCGCAGCATGTGTGTACTGTAACACAGGCCCATGTACAAAGACAACGGCGTTAAATTATGATAATAGTTGTGCAAATAATATTTTCTCATTAAAATGTCTAAAATATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g                        TGas053m03.p1cSP6                                            CGCCTCTACAGGGGTCTTTTCTGCTCATGTCACCACATAAAACTATCAGTTGGTTTGAGGAAGGACATGGAGACAACTACTTAGCTTATCTCCCACCCTGCAAGAAAGGAAACCTTTCCCCCCAACCCTTGTTAATTCAGCCACTGGCCAGGACAGGAGCTCATTCCCGATGCTGAAGTGAAGATCAGAGTTTCTCCGAAGAGGGACCAGGCTGGCGAAGGGCTGAATTCCCATCTGCTCTGCCAGGGAGGGGGTCCTGCGTTTGGACAAGTCTTTTCCTTCTAAACTGCATTCCGGATGCAGAGTGACAACTTCTAAAAACTCCAAGGTTTCCCCAGTTTGCAAGTGAAGATGCCTCGTCCTGGAGAAACACCTACAGCGACCAGAAGCCTCCCTACTCCTACATTTCCCTGACTGCCATGGCCATCCAGAGCTCCCAAGAGAAGATGCTGCCCCTTAGTGAGATCTACAAGTTCATCATGGACAGGTTCCCCTACTACAGAGAGAACACCCAGAGGTGGCAAAACTCTCTGAGGCACAACTTGTCTTTCACGACTGTTTCATCAAAATCC
  5   1   2      seed Gas  FL   out                  TGas064p06.p1cSP6                                                                                                                                                                                                                             TGAAGATCAGAGTTTCTCCGAAGAGGGACCAGGCTGGCGAAGGGCTGAATTCCCATCTGCTCTGCCAGGGAGGGGGTCCTGCGTTTGGACAAGTCTTTTCCTTCTAAACTGCATTCCGGATGCAGAGTGACAACTTCTAAAAACTCCAAGGTTTCCCCAGTTTGCAAGTGAAGATGCCTCGTCCTGGGAGAAACACCTACAGCGACCAGAAGCCTCCCTACTCCTACATTTCCCTGACTGCCATGGCCATCCAGAGCTCCCAAGAGAAGATGCTGCCCCTTAGTGAGATCTACAAGTTCATCATGGACAGGTTCCCCTACTACAGAGAGAACACCCAGAGGTGGCAAAACTCTCTGAGGCACAACTTGTCTTTCAACGACTGTTTCATCAAAATCCCAAGGAGACCCGACCAGCCTGGAAAGGGCAGTTTCTGGGCATTGCATCCCAGCTGTGGGGATATGTTCGAAAATGGCAGTTTCCTGAGACGCAGAAAGAGGTTCAAGGTGATGAAATCGGACCATTTGGCCCCCAGCAAAGCCTCGGATGCCGCCCAATACTTGCAGCAACAAGCCAAGCTGAGACTCAGCGCCCTAGCGGCCTCTGGCACTCACT
  5   1   2   32  bld Gas7 PIPE out                        XZG24714.5p ............................................................................................................................................................................................................................................................................................................................................................................GGACAGGTTTCCCCAGTTTGCACGTGAAGATGCCTCGTCCTGGGAGAAACACCTACAGCGACCAGAAGCCTCCCTACTCCTACATTTCCCTGACTGCCATGGCCATCCAGAGCTCCCAAGAGAAGATGCTGCCCCTTAGCGAGATCTACAAGTTCATCATGGACAGGTTCCCCTACTACAGAGAGAACACCCAGAGGTGGCAAAACTCTCTGAGGCACAACTTGTCTTTCAACGACTGTTTCATCAAAATCCCAAGGAGACCCGACCAGCCTGGAAAGGGCAGTTTCTGGGCATTGCATCCCAGCTGTGGGGATATGTTCGAAAATGGCAGTTTCCTGAGACGCAGAAAGAGGTTCAAGGTGATGAAATCGGACCATTTGGCCCCCAGCAAAGCCTCGGATGCCGCCCAATACTTGCAGCAACAAGCCAAGCTGAGACTCAGCGCCCTAGCGGCCTCTGGCACTCACTTGCCTCAGATGTCCACCTATAATCTAGGGGTATCCCAGACTTCTAGCTTTAAACACCCCTTCGCCATTGAGAATATTATCGCCAGAGAGTATAAAATGCCTGGAGGACTTGCCTTTTCCACCATGCAGCCCATGCCAGCCGCCTACCCTCTACATAACCAATTGACTACTGTTGGAAGTTCCATTGGCACAGGCTGGCCCCACATGTACAGCTCCAGCATGCTGGACACAACCACCCCCATATCAATGGGCAACAGCGACTACAGTGTCAGCGCCTATGGAGTACCTATCAAACCTATATGCCATGGGGCACAAACCTTACCGGCCATCCCAGTCCCTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)