Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012106578 Xt7.1-CBWN7415.3 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBWN7415.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGATGTAACTGAAGATTTGGATGGAGAAGATACATCCGATCACGATGGAAAACAGACAACTGATGGAAATGAATCCACAGAATCCGACAGCGATGACTGCATCATACCTGTCAGAAAAGATTTAAAACCGCAATTTGAAAAAATCCGTATAGAGATCATCTCTCTTAGCCTCAACTCAACATCAGATGTTGCACAGAATGATACAATCCAGAAACTGTTTGTCGAATACAGATTCTGCAACATTGTCACCGAGGAAACACCAGTGTCTCTTCAAAAACCTGCCAGTGGGCTGCAGATATACTACAATTACAGCAATGTAATTCATGTGGATAAAGAAAATAACCAGGCAAACAGAGACCTTCTACGATCTTTGCTTAATGATCCAGGTGTTTGATTTCATGTAGCTCAATTTACAGTAGTAAGTGACCCACCTGAAGATGAACAAGATCTGGATTGTGACGACATTGGGTTTGCCAGCATCAACCTCAGTGAGATCTTGCAAAGTGGCAAAGATGTTATTAACAGGAGTATTGAGAGTATGTTTCACAAGTCTAAATAATTAATGTAATATCTTGGCCAGCCTTTATTTAGTCACACATAGTAAATAGCACATGGTTAAAATGTAATGTAATGAGGCATGTGCAACCGTGTGGACGCTCTTCCACTCGTCCCTTGGGATTATCCTTGCATTAGTTGTTTCTAAGGTTTTTTTTTCTATAAAAATGTAGGTTCCTTGTAACCTGAACTGTATAAAT
                                                  Xt7.1-CHK-1008245057                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAACTGAAGATTTGGATGGAGAAGATACATCCGATCACGATGGAAAACAGACAACTGATGGAAATGAATCCACAGAATCCGACAGCGATGACTGCATCATACCTGTCAGAAAAGATTTAAAACCGCAATTTGAAAAAATCCGTATAGAGATCATCTCTCTTAGCCTCAACTCAACATCAGATGTTGCACAGAATGATACAATCCAGAAACTGTTTGTCGAATACAGATTCTGCAACATTGTCACCGAGGAAACACCAGTGTCTCTTCAAAAACCTGCCAGTGGGCTGCAGATATACTACAATTACAGCAATGTAATTCATGTGGATAAAGAAAATAACCAGGCAAACAGAGACCTTCTACGATCTTTGCTTAATGATCCxxxTxTTTGATTTCATGxxGxxxAATTTACAGTAGTAAGTGACCCACCTGAAGATGAACAAGATCTGGATTGTGACGACATTGGGTTTGCCAGCATCAACCTCAGTGAGATCTTGCAAAGTGGCAAAGATGTTATTAACAGGAGTATTGAGAGTATGTTTCACAAGTCTAAATAATTAATGTAATATCTTGGCCAGCCTTTATTTAGTCACACATAGTAAATAGCACATGGTTAAAATGTAATGTAATGAGGCATGTGCAACCGTGTGGACGCTCTTCCACTxxxCxCTTGGGATTATCCTTGCATTAGTTGTTTCTAAGGTTTTTTTTTCTATAAAAATGTAGGTTCCTTGTAACCTGAACTGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     3     1     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     1     3     1     2     1     2     1     2     1     2     1     1     1     1
                                                                       ...PREDICTED - Sp ---- 6e-019     XP_790646.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - ?? ---- 5e-022     XP_690460.1 PREDICTED: similar to Receptor tyrosine-protein kinase erbB-4 precursor (p180erbB4) (Tyrosine kinase-type cell surface receptor HER4) [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 6e-025     XP_685888.1 PREDICTED: similar to proteasome (prosome, macropain) activator subunit 4 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Hs ---- 1e-039     NP_056087.2 hypothetical protein LOC23322 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 5e-043     NP_775607.1 hypothetical protein LOC244585 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 8e-044     XP_001234248.1 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBWN7415.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGA------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------TAA---ATGTAA------------------------------TAGTAA------------TAA------ATGTAATGA---ATG------------------------------------------------------------TAA---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                         ...
  3   1   1       add Te1       out                        CBWN7415.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGATGTAACTGAAGATTTGGATGGAGAAGATACATCCGATCACGATGGAAAACAGACAACTGATGGAAATGAATCCACAGAATCCGACAGCGATGACTGCATCATACCTGTCAGAAAAGATTTAAAACCGCAATTTGAAAAAATCCGTATAGAGATCATCTCTCTTAGCCTCAACTCAACATCAGATGTTGCACAGAATGATACAATCCAGAAACTGTTTGTCGAATACAGATTCTGCAACATTGTCACCGAGGAAACACCAGTGTCTCTTCAAAAACCTGCCAGTGGGCTGCAGATATACTACAATTACAGCAATGTAATTCATGTGGATAAAGAAAATAACCAGGCAAACAGAGACCTTCTACGATCTTTGCTTAATGATCCTAATACCAGCAATGGAAGTGTGAAATTTACAGTAGTAAGTGACCCACCTGAAGATGAACAAGATCTGGATTGTGACGACATTGGGTTTGCCAGCATCAACCTCAGTGAGATCTTGCAAAGTGGCAAAGATGTTATTAACAGGAGTATTGAGATTTATAGCTCACCCTCTGGCGGGGAAGCAATTGGTATGCTAACTGTGACAGTGGAAGCCCTGGAAGCTCTACAATCAGTACTGCGGGATTGAGATGCTGTATAGAACAGGATTTCTCTTTGAAAATTCATGATTTTGTTATCAAGGGCTGTTACTAATTTTTTTTTAATAAAGGTACAAACCTAAAAACAAAAAAAAAAAAAAA
  3   1   1       add BrSp      out                     EC2BBA6BH11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAAGTATGTAAGTTAGAATGTGTTTTAGCTCTGCCTTGTTCCAATGAAATCAATCAGCAAAACTATGTTTATATAACATTCTTTTTCTTGTCCCCATTTAGCAATTTGAAAAAATCCGTATAGAGATCATCTCTCTTAGCCTCAACTCAACATCAGATGTTGCACAGAATGATACAATCCAGAAACTGTTTGTCGAATACAGATTCTGCAACATTGTCACCGAGGAAACACCAGTGTCTCTTCAAAAACCTGCCAGTGGGCTGCAGATATACTACAATTACAGCAATGGTACAACTTGCAGAAGATGAATGTGGGGCGGAAAACTAAATATGAGAAATATACATATGTTGCATTCAGGTGTTTGATTTCATGTAGCTCTGCATTTAGGTGTGAAATATCTATGTTTCTCTATGTTTCTAGGTTTGCATAAAGTCAGTACTATTCCAGTTGCTTGATCTGTATGACAGCAAAATAGTTAATAGTAATTTTGACCAGCCTTTTGTGACTTTTGTGAGAAATTAGTGTTTTAGTGTTGATGATTTCAACTGGAAGTAGTAGTTTGTTGAAATATTGCCCCATTAAGGCATGGAGGAGTTCAGCCCCAGTCTAGAAAAAAGCCATGGACACAATAATCCATTCACTCTTGGGATTATCCTTGCATTAGTTGTTTCTAAGGTTTTTTTTTCTATAAAAATGTAGGTTCCTTGTAACCTGAACTGTATAAATTAGAA
  5  -1   2       bld Tad5      in                         XZT70175.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTTTTTTTTTTTTTTTCTTAGTGTGAAATTTACAGTAGTAAGTGACCCACCTGAAGATGAACAAGATCTGGATTGTGACGACATTGGGTTTGCCAGCATCAACCTCAGTGAGATCTTGCAAAGTGGCAAAGATGTTATTAACAGGAGTATTGAGAGTATGTTTCACAAGTCTAAATAATTAATGTAATATCTTGGCCAGCCTTTATTTAGTCACACATAGTAAATAGCACATGGTTAAAATGTAATGTAATGAGGCATGTGCAACCGTGTGGACGCTCTTCCACTCGTCCAATG
  3  -1   2      seed Tad5      in                         XZT70175.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTGTGAAATTTACAGTAGTAAGTGACCCACCTGAAGATGAACAAGATCTGGATTGTGACGACATTGGGTTTGCCAGCATCAACCTCAGTGAGATCTTGCAAAGTGGCAAAGATGTTATTAACAGGAGTATTGAGAGTATGTTTCACAAGTCTAAATAATTAATGTAATATCTTGGCCAGCCTTTATTTAGTCACACATAGTAAATAGCACATGGTTAAAATGTAATGTAATGAGGCATGTGCAACCGTGTGGACGCTCTTCCACTCGTCCAATGCGGACGCGTGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)