Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012106790 Xt7.1-THdA050d20.5 - 3 ESTs
                                                                       ....-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-THdA050d20.5                                                                                                                                                                                                                                                                                                                                                                                       TGTGGAATCACTATGTGGGCAAATCAATCAATAGGAAACTATTGGAGAGCAAGGAAGAGATGCAACAAGCATGGGCCCTGGGACAACAAGGCACAAGATACAGATGGGACCGCGTGGGCCTCAATGCAGGATAACAATGCCCAAAAACCCCAGACTACTGGGGTCCCCTCTTCAGACGACACTCAATACCGACACCGACAAGACCCATTGCAGGAGGAGCTGCATGGCGGGCCCGGGACACAGAGATTCCATGACATTGGCACAGAGATGATCATCACTATAGCTGGGAGGAGAATGTTCGTTCCCTTCTGTGCGGATAAAAGTCAAAGGCCTCGATCCCTCCAAGCAATATTACATCGCCATGGATGTCACCCCAGTGGACTCCAAAAGATACAGGTATGTCTATCACAGCTCACAGTGGATGGTTGCAGGCAACACAGACCATTCCTGTATAACCCCAAGGCTGTACATTCACCCAGATTCACCTTGTTCCGGAGAGACCTGGATGAGGCAAATCATAAGCTTTGACAGGATTAAACTGACCAATAATGAGATGGACGACAAAGGACATATTATTTTGCAGTCGATGCACAAGTACAAGCCCCGTGTACATATTATTGTCCACGACTCCAGATTTGACTTGTCTCAGATACAGTCTTTGCCAGCTGAGGGGGTTAAAACTTTCTCATTCAAAGAAACAGAATTCACAACAGTTACCGCTTACCAAAACCAACAAATAACAAAACTGAAAATCGACAGAAATCCCTTTGCTAAAGGATTCAGAGATCCTGGAAGGAACAGGAGGCAGCTCCGGTTCTTCGCCCATCACTTCCAGCGGGGGAGCTCCATCACCTTTGCTTTCTCCTTCCTGCTCGCCGCCATCATTTCACCTGCCTACTAGTAACCATGGACTCTCCTGTTCAGAGAATTGTCTGCACAATATCAATATGCCGCTGTGCTATAAGATTTGCCCTACAAACATTCTGAGACAGCGGGCTCTAGTATTTGCCAACCAGGATAAACTTGGAAGCCCAAGCTCACATGTTCCCATCCTAATGGTGGATGTTTCGTTTGTTTCATCTTTTGGCATCTCNAAACCCAACA
                                                  Xt7.1-CHK-1008249978                                                                                                                                                                                                                                                                                                                                                                                             ATCACTATGTGGGCAAATCAATCAATAGGAAACTATTGGAGAGCAAGGAAGAGATGCAACAAGCATGGGCCCTGGGACAACAAGGCACAAGATACAGATGGGACCGCGTGGGCCTCAATGCAGGATAACAATGCCCAAAAACCCCAGACTACTGGGGTCCCCTCTTCAGACGACACTCAATACCGACACCGACAAGACCCATTGCAGGAGGAGCTGCATGGCxxGxxxxxxxxxCAGAGATTCCATGACATTGGCACAGAGATGATCATCACTATAGCTGGGAGGAGAxxGxxxGTTCCCTTCTGTGCGGATAAAAGTCAAAGGCCTCGATCCCTCCAAGCAATATTACATCGCCATGGATGTCACCCCAGTGGACTCCAAAAGATACAGGTATGTCTATCACAGCTCACAGTGGATGGTTGCAGGCAACACAGACCATTCCTGTATAACCCCAAGGCTGTACATTCACCCAGATTCACCTTGTTCCGGAGAGACCTGGATGAGGCAAATCATAAGCTTTGACAGGATTAAACTGACCAATAATGAGATGGACGACAAAGGACATATTATTTTGCAGTCGATGCACAAGTACAAGCCCCGTGTACATATTATTGTCCACGACTCCAGATTTGACTTGTCTCAGATACAGTCTTTGCCAGCTGAGGGGGTTAAAACTTTCTCATTCAAAGAAACAGAATTCACAACAGTTACCGCTTACCAAAACCAACAAATAACAAAACTGAAAATCGACAGAAATCCCTTTGCTAAAGGATTCAGAGATCCTGGAAGGAACAGGAGGCAGCTCCGGTTCTTCGCCCATCACTTCCAGCGGGGGAGCTCCATCACCTTTGCTTTCTCCTTCCTGCTCGCCGCCATCATTTCACCTGCCTACTAGTAACCATGGACTCTCCTGTTCAGAGAATTGTCTGCACAATATCAATATGCCGCTGTGCTATAAGATTTGCCCTACAAACATTCTGAGACAGCGGGCTCTAGTATTTGCCAACCAGGATAAACTTGGAAGCCCAAGCTCACATGTTCCCATCCTAATGGTGGATGTTTCGTTTGTTTCATCTTTTGGCATCTCNAAACCCAACAAACTTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                            1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     3     1     3     1     3     1     3     2     3     1     3     1     3     1     3     1     3     1     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     289      92                                                                                                                                                                                                                                                                                                                                                                                       
                                                                                                                                                                                                                                                                                            PROTEIN --- Bb ---- 4e-039     BAB63370.1 T-brain [Branchiostoma belcheri] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 1e-048     NP_493750.1 T BoX family member, T-box transcription factor required for posterior body patterning, Male ABnormal MAB-9 (39.4 kD) (mab-9) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 6e-052     NP_511085.2 CG11202-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                             PREDICTED - Sp ---- 2e-053     XP_790408.2 PREDICTED: similar to T-box protein AmphiTbx1/10 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Xl ---- 8e-056     AAN39113.1 T-box protein TBX20 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Xt ---- 6e-056     AAZ79653.1 T-box transcription factor 20 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Mm ---- 3e-056     NP_919239.1 T-box 20 isoform a [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 2e-062     AAG21402.1 T-box transcription factor CiVEGTR [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bf ---- 5e-067     AAG34891.1 T-box protein AmphiTbx15/18/22 [Branchiostoma floridae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dr ---- 1e-086     NP_705950.1 T-box 15 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 6e-088     NP_689593.2 T-box 15 [Homo sapiens] -----------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - ?? ---- 4e-078     XP_683969.1 PREDICTED: similar to T-box transcription factor TBX22 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Gg ---- 2e-122     NP_989437.1 T-box 22 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-THdA050d20.5                                                                                                                                                                                                                                                                                                                                                                                                                      TAG------------------------------------ATG------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------ATG------------------------ATG---------------TGA---------TAG---------------ATG------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTAA---------------------------------------------------------TAA------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  5   1   1       add HdA       out                 THdA002p22.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                       TGTGGAATCACTATGTGGGCAAATCAATCAATAGGAAACTATTGGAGAGCAAGGAAGAGATGCAACAAGCATGGGCCCTGGGACAACAAGGCACAAGATACAGATGGGACCGCGTGGGCCTCAATGCAGGATAACAATGCCCAAAAACCCCAGACTACTGGGGTCCCCTCTTCAGACGACACTCAATACCGACACCGACAAGACCCATTGCAGGAGGAGCTGCATGGCTCGGAACTATGGCAGAGATTCCATGACATTGGCACAGAGATGATCATCACTATAGCTGGGAGGAGAATGTTCCCGTGTCTGATGCGTGATAAAAGTCAAAGGCCTCGATCCCTCAAAGCAATATTACATCGCCATGGATGTCACCCCAGTGGACTCCAAAAGATACGGGTATGTCTATCACATCTCACAGTGGATGGTTGCAGGCAACACAGACCATTCCTGTATAACCCCAAGGCTGTACATTCACCCAGATTCACCTTGTTCCGGAGAGACCTGGATGAGGCAAATCATAAGCTTTGACAGGATTAAACTGACCAATAATGAGATGGACGACAAAGGACATATTATTTTGCAGTCGATGCACAAGTACAAGCCCCGTGTACATATTATTGTCCACGACTCCAGATTTGACTTGTCTCAGATACAGTCTTTG
  5   1   2       bld TpA       out                  TTpA059l14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCGCATCGATTTGGTGCTCACCCTGGAGGAAAGCGCAGCGATCCTGGAGATTACCAATTTACCCTTATTCGCCCCAGGATGGCTCTGAGCTCCAAAGCTCACGCCTTTTCTGTGGAATCACTAGTGGGCAAATCAATCAAGAGGAAACTATTGGAGAGCAAGGAAGAGATGCAGCAAGCAGGGGCCCGGGACAACAAGGCAGAAGATACAGAGGGGACCGCAGGGGCCTCAATGCAGGAGAAGAATGGAGAATGTTCCCTTCTGTGCGGATAAAAGTCAAAGGCCTCGATCCCTCCAAGCAATATTACATCGCCATGGATGTCACCCCAGTGGACTCCAAAAGATACAGGTATGTCTATCACAGCTCACAGTGGATGGTTGCAGGCAACACAGACCATTCCTGTATAACCCCAAGGCTGTACATTCACCCAGATTCACCTTGTTCCGGAGAGACCTGGATGAGGCAAATCATAAGCTTTGACAGGATTAAACTGACCAATAATGAGATGGACGACAAAGGACATATAACAAAACTGAAAATCGACAGAAATCCCTTTGCTAAAGGATTCAGAGATCCTGGAAGGAACAGGGGTGTACTGGATGGCCTTCTAGAGACCTACCCTTGGAGACCGCCGATTACCTTAGACTTTAAAGCCTTTGGAGCTGAGACACCTGGAGGCAGCTCCGGTTCTTCGCCCATCACTTCCAGCGGGGGAGCTCCATCACCTTTGCTTTCTCCTTCCTGCTCGCCGCCATCATTTCACCTGCCTACTAGTAACCATGGACTCTCCTGTTCAGAGAATTGTCTGCACNAATATCATATGCCGCTGTGCTATAAGATTTGCCCTA
  5   1   2      seed HdA                            THdA050d20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCTTCGGACGACACTCAATACCGACACCGACAGGACCCAGTGCAGGTGGAGCTGCAGGGCTCGGAACTATGGCGGAGATTCCATGACATTGGCACAGAGATGATCATCACTAAAGCTGGGAGGAGAATGTTCCCTTCTGTGCGGATAAAAGTCAAAGGCCTCGATCCCTCCAAGCAATATTACATCGCCATGGATGTCACCCCAGTGGACTCCAAAAGATACAGGTATGTCTATCACAGCTCACAGTGGATGGTTGCAGGCAACACAGACCATTCCTGTATAACCCCAAGGCTGTACATTCACCCAGATTCACCTTGTTCCGGAGAGACCTGGATGAGGCAAATCATAAGCTTTGACAGGATTAAACTGACCAATAATGAGATGGACGACAAAGGACATATTATTTTGCAGTCGATGCACAAGTACAAGCCCCGTGTACATATTATTGTCCACGACTCCAGATTTGACTTGTCTCAGATACAGTCTTTGCCAGCTGAGGGGGTTAAAACTTTCTCATTCAAAGAAACAGAATTCACAACAGTTACCGCTTACCAAAACCAACAAATAACAAAACTGAAAATCGACAGAAATCCCTTTGCTAAAGGATTCAGAGATCCTGGAAGGAACAGGAGGCAGCTCCGGTTCTTCGCCCATCACTTCCAGCGGGGGAGCTCCATCACCTTTGCTTTCTCCTTCCTGCTCGCCGCCATCATTTCACCTGCCTACTAGTAACCATGGACTCTCCTGTTCAGAGAATTGTCTGCACAATATCAATATGCCGCTGTGCTATAAGATTTGCCCTACAAACATTCTGAGACAGCGGGCTCTAGTATTTGCCAACCAGGATAAACTTGGAAGCCCAAGCTCACATGTTCCCATCCTAATGGTGGATGTTTCGTTTGTTTCATCTTTTGGCATCTCNAAACCCAACAAACTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)