Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 09 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC5856.3.5                          9 END     1          50       11                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012106962 Xt7.1-CAAN4091.5 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAN4091.5 TGACTAACTGATTCTGATTGCCATTGGTGCAGCACCGGGACTCATCCTTGTTGTGTGCAAATAGCTGCTGGGATCCATCATGTCTGTGTGTGCTCTGACCCTGCTCTTGGGCTGCCTCCTGCTCTTCCTGGGGGACATCTCCAAACCAGTAGAGGGGTGCACATGTGCCCCCAGCCACCCACAGGACGCCTTCTGCAACTCTGATATAGTCATTCGGGCTAAGGTGGTGGGCAAGAAACTGATGAAGGACGGGCCCTTCGGAACCATGCGCTACACGGTCAAGCAGATGAAGATGTACCGTGGCTTTAATAAGATGCCCCAAGTCCAGTACATCTACACCGAGGCCTCGGAGAGCCTGTGCGGCGTGAAGCTGGAGGTCAACAAATATCAGTATCTGATAACAGGTCGTGTATATGAAGGGAAGGTGTACACCGGGCTGTGTAATTTAATAGAGAGGTGGGAGAAGCTGACCTTCGCCCAACGGAAAGGACTGAATCACCGATACCCTCTTGGTTGCACCTGTAAGATCAAACCTTGCTACTACCTTCCCTGTTTCATCACCTCCAAGAACGAGTGCCTCTGGACAGACATGCTCTCCAACTTCGGCTACCCTGGCTACCAGTCCAAGAACTATGCCTGCATCAAGCAGAAGGAAGGCTACTGCAGCTGGTACAGAGGATGGGCGCCCCCAGACAAAACCACAATAAACACCACAGACCCCTGAGCCTGACCTCTGCCTGGGCCCAGAAGCTGCAATGGACAGTAATTCCCTGATCCGATAATAAAGGCAAAGAAATTACGGCTAATTTCTTGCAAAAAAAACCTAGCACTTGGAACACTTATCGTTTGCCATCGTATTGAAAAGCATATTTTGTAATCACTTTTTTTTTTTGTTTAAAATCACCCATTTCAGCCAGATGTGAGCAGAATGTTCTTTGTAGGGTCTGGTTCAGTTTTTTGCATTTTTTTCTTTCTCTTTATATATTGAAGAGCGCTCAGATATTGGGCCGTATCAAACTCTTTATCAGCAGCCTTTTCTACTTG
                                                  Xt7.1-CHK-1008261406       ACTGATTCTGATTGCCATTGGTGCAGCACCGGGACTCATCCTTGTTGTGTGCAAATAGCTGCTGGGATCCATCATGTCTGTGTGTGCTCTGACCCTGCTCTTGGGCTGCCTCCTGCTCTTCCTGGGGGACATCTCCAAACCAGTAGAGGGGTGCACATGTGCCCCCAGCCACCCACAGGACGCCTTCTGCAACTCTGATATAGTCATTCGGGCTAAGGTGGTGGGCAAGAAACTGATGAAGGACGGGCCCTTCGGAACCATGCGCTACACGGTCAAGCAGATGAAGATGTACCGTGGCTTTAATAAGATGCCCCAAGTCCAGTACATCTACACCGAGGCCTCGGAGAGCCTGTGCGGCGTGAAGCTGGAGGTCAACAAATATCAGTATCTGATAACAGGTCGTGTATATGAAGGGAAGGTGTACACCGGGCTGTGTAATTTAATAGAGAGGTGGGAGAAGCTGACCTTCGCCCAACGGAAAGGACTGAATCACCGATACCCTCTTGGTTGCACCTGTAAGATCAAACCTTGCTACTACCTTCCCTGTTTCATCACCTCCAAGAACGAGTGCCTCTGGACAGACATGCTCTCCAACTTCGGCTACCCTGGCTACCAGTCCAAGAACTATGCCTGCATCAAGCAGAAGGAAGGCTACTGCAGCTGGTACAGAGGATGGGCGCCCCCAGACAAAACCACAATAAACACCACAGACCCCTGAGCCTGACCTCTGCCTGGGCCCAGAAGCTGCAATGGACAGTAATTCCCTGATCCGATAATAAAGGCAAAGAAATTACGGCTAATTTCTTGCAAAAAAAACCTAGCACTTGGAACACTTATCGTTTGCCATCGTATTGAAAAGCATATTTTGTAATCACTTTTTTTTTTTGTTTAAAATCACCCATTTCAGCCAGATGTGAGCAGAATGTTCTTTGTAGGGTCTGGTTCAGTTTTTTGCATTTTTTTCTTTCTCTTTATATATTGAAGAGCGCTCAGATATTGGGCCGTATCAAACTCTTTATCAGCAGCCTTTTCTACTTGTTGTTG
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      79     123 
                                               BLH MIN      76      73 
                                               BLH MPR      40      73 
                                               BLH OVR      79     188 
                                               CDS MIN      79      73 
                                               ORF LNG      79       7 
                                                                                                                                          PROTEIN --- Dm ---- 2e-013     NP_524301.2 CG6281-PA, isoform A [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                               PREDICTED - Sp ---- 6e-018     XP_781027.1 PREDICTED: similar to Metalloproteinase inhibitor 4 precursor (TIMP-4) (Tissue inhibitor of metalloproteinases-4) [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                         PROTEIN --- Dr ---- 4e-047     NP_878294.1 tissue inhibitor of metalloproteinase 2 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                PROTEIN --- Xt ---- 1e-049     AAH89696.1 Unknown (protein for MGC:108274) [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PROTEIN --- Mm ---- 1e-100     NP_035725.1 tissue inhibitor of metalloproteinase 3 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                     PROTEIN === Gg ==== 2e-101     NP_990818.1 metalloproteinase inhibitor [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                     PROTEIN === Hs ==== 1e-101     NP_000353.1 tissue inhibitor of metalloproteinase 3 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === Xl ==== 1e-129     AAC41286.1 tissue inhibitor of metalloproteinases-3 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN === ?? ==== 1e-129     NP_001079064.1 tissue inhibitor of metalloproteinases-3 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAN4091.5     TAA------------------------------------------------------TAG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------ATG---ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------TGA---TGA---------------------------------TAA------------------------------------------------------------------------------------------------------------TAA------------------TAA------------------------------ATG------------------------------------------------------TGA
                                                                   ORF                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2   34  bld Te4  5x3  out                        CAAN4091.5p TGACTAACTGATTCTGATTGCCATTGGTGCAGCACCGGGACTCATCCTTGTTGTGTGCAAATAGCTGCTGGGATCCATCATGTCTGTGTGTGCTCTGACCCTGCTCTTGGGCTGCCTCCTGCTCTTCCTGGGGGACATCTCCAAACCAGTAGAGGGGTGCACATGTGCCCCCAGCCACCCACAGGACGCCTTCTGCAACTCTGATATAGTCATTCGGGCTAAGGTGGTGGGCAAGAAACTGATGAAGGACGGGCCCTTCGGAACCATGCGCTACACGGTCAAGCAGATGAAGATGTACCGTGGCTTTAATAAGATGCCCCAAGTCCAGTACATCTACACCGAGGCCTCGGAGAGCCTGTGCGGCGTGAAGCTGGAGGTCAACAAATATCAGTATCTGATAACAGGTCGTGTATATGAAGGGAAGGTGTACACCGGGCTGTGTAATTTAATAGAGAGGTGGGAGAAGCTGACCTTCGCCCAACGGAAAGGACTGAATCACCGATACCCTCTTGGTTGCACCTGTAAGATCAAACCTTGCTACTACCTTCCCTGTTTCATCACCTCCAAGAACGAGTGCCTCTGGACAGACATGCTCTCCAACTTCGGCTACCCTGGCTACCAGTCCAAGAACTATGCCTGCATCAAGCAGAAGGAAGGCTACTGCAGCTGGTACAGAGGATGGGCGCCCCCAGACAAAACCACAATAAACACCACAGACCCCTGAGCCTGACCTCTGCCTGGGCCCAGAAGCTGCAATGGACAGTAATTCCCTGATCCGATAATAAAGGCAAAGAAATTACGGCTAATTTCTTG
  5   1   2      seed Gas                            TGas030c10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAGGTGTACACCGGGCTGTGTAATTTAATAGAGAGGTGGGAGAAGCTGACCTTCGCCCAACGGAAAGGACTGAATCACCGATACCCTCTTGGTTGCACCTGTAAGATCAAACCTTGCTACTACCTTCCCTGTTTCATCACCTCCAAGAACGAGTGCCTCTGGACAGACATGCTCTCCAACTTCGGCTACCCTGGCTACCAGTCCAAGAACTATGCCTGCATCAAGCAGAAGGAAGGCTACTGCAGCTGGTACAGAGGATGGGCGCCCCCAGACAAAACCACAATAAACACCACAGACCCCTGAGCCTGACCTCTGCCTGGGCCCAGAAGCTGCAATGGACAGTAATTCCCTGATCCGATAATAAAGGCAAAGAAATTACGGCTAATTTCTTGCAAAAAAAACCTAGCACTTGGAACACTTATCGTTTGCCATCGTATTGAAAAGCATATTTTGTAATCACTTTTTTTTTTTGTTTAAAATCACCCATTTCAGCCAGATGTGAGCAGAATGTTCTTTGTAGGGTCTGGTTCAGTTTTTTGCATTTTTTTCTTTCTCTTTATATATTGAAGAGCGCTCAGATATTGGGCCGTATCAAACTCTTTATCAGCAGCCTTTTCTACTTGTTGTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)