Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTbA027m21.3.5                       46 END     1          50        2                chondroitin sulfate proteoglycan 2 [Xenopus laevis]

 This cluster: approximate FL confidence score = 86%

 1012107742 Xt7.1-CAAK11319.5 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAK11319.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCACAGGACTCAGCACAGACACACGCTGCAGAGACTTCTGGGATCAGGTGCCCTTGTTCTACGGGGACTTTTATAGTGCAAGAGCCTACAAACAGGATCCCCCCAAAAGCATCCCTCCAGCCCTCCAGCCTGGGAATATACTCCATCAGCCACAAGCAAGTCTGAGAGAGATTTCTGTACAAAAGTGGATTGGATGCAGCTGCACTGCTAGGTCACCTTAAAAGGTCAAGATGTTACTAGAAATAAAATATATATTTTGGATATTCTCGGCATTCTCCCTTACTAATGCATTCCGTGCAGTTCAAGTGGAAAAGAGTTCCCCAGTGAAGGGTTCGTTATCTGGAAGAGTGAATCTGCCATGCTTTTTTTCAACCATACCAACATTGCCACCCAGCTACAATATTACAAATGAATTCCTGAGGATCAAATGGACCAAAATTGTTCAGAGCAGAGATGGAAAGGACCCAAAGGAAACTACAGTTTTGGTGGCCCAAAGTGGAAGTATTAAAATTGGACAACAATATAGAGGCAGAGTGTCTGTGCCAAGTCACCCTGAAGACATTGGGGATGCATCTTTAACCATAGTCAAACTACGTGCTAGTGATGCTGGTGTTTACCGATGTGAAGTTCTGTTTGGGATTGAGGATACCCAAGACACAGTTTCCTTGGATGTTTCAGGAGTTGTGTTCCACTACCGAGCCTCTACTGACAAGTACACTTTGGACTTTGAGGCTGCTCAGAAAGCATGCATAGACAATGGTGCCCAAATTGCAACTCCTGGACAACTGAGAGCAGCTTATGAAGATGGTTTTGAGCAATGTGATGCTGGGTGGCTTTCTGACCAGACTGTTAGATATCCAATCCGCTCGCCTAGAGCAGCCTGCTATGGTGATAAAATG
                                                  Xt7.1-CHK-1008253228                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACTCAGCACAGACACACGCTGCAGAGACTTCTGGGATCAGGTGCCCTTGTTCTACGGGGACTTTTATAGTGCAAGAGCCTACAAACAGGATCCCCCCAAAAGCATCCCTCCAGCCCTCCAGCCTGGGAATATACTCCATCAGCCACAAGCAAGTCTGAGAGAGATTTCTGTACAAAAGTGGATTGGATGCAGCTGCACTGCTAGGTCACCTTAAAAGGTCAAGATGTTACTAGAAATAAAATATATATTTTGGATATTCTCGGCATTCTCCCTTACTAATGCATTCCGTGCAGTTCAAGTGGAAAAGAGTTCCCCAGTGAAGGGTTCGTTATCTGGAAGAGTGAATCTGCCATGCTTTTTTTCAACCATACCAACATTGCCACCCAGCTACAATATTACAAATGAATTCCTGAGGATCAAATGGACCAAAATTGTTCAGAGCAGAGATGGAAAGGACCCAAAGGAAACTACAGTTTTGGTGGCCCAAAGTGGAAGTATTAAAATTGGACAACAATATAGAGGCAGAGTGTCTGTGCCAAGTCACCCTGAAGACATTGGGGATGCATCTTTAACCATAGTCAAACTACGTGCTAGTGATGCTGGTGTTTACCGATGTGAAGTTCTGTTTGGGATTGAGGATACCCAAGACACAGTTTCCTTGGATGTTTCAGGAGTTGTGTTCCACTACCGAGCCTCTACTGACAAGTACACTTTGGACTTTGAGGCTGCTCAGAAAGCATGCATAGACAATGGTGCCCAAATTGCAACTCCTGGACAACTGAGAGCAGCTTATGAAGATGGTTTTGAGCAATGTGATGCTGGGTGGCTTTCTGACCAGACTGTTAGATATCCAATCCGCTCGCCTAGAGCAGCCTGCTATGGTGAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     231      28                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     231      52                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     231     142                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     231       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - Sp ---- 3e-007     XP_001201915.1 PREDICTED: similar to HyTSRp1 protein, partial [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Xl ---- 1e-039     AAK40085.1 brevican soluble core protein precursor [Xenopus laevis] ------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - ?? ---- 7e-050     XP_687413.1 PREDICTED: similar to Neurocan core protein precursor (Chondroitin sulfate proteoglycan 3) [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 4e-051     AAI21482.1 Unknown (protein for IMAGE:7663615) [Xenopus tropicalis] ------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 5e-069     NP_999853.1 dermacan [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Gg ==== 3e-082     NP_990118.1 proteoglycan [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Mm ==== 9e-091     XP_488510.2 PREDICTED: chondroitin sulfate proteoglycan 2 isoform 1 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 6e-093     NP_004376.2 chondroitin sulfate proteoglycan 2 (versican) [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAK11319.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAA---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  0   1   1           TpA  FL                     TTpA007c12.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGGTGCACAAGGACTCAGCACAGACACACGCTGCAGAGACTTCTGGGATCAGGTGCCCTTGTTCTACGGGGACTTTTATAGTGCAAGAGCCTACAAACAGGATCCCCCCAAAAGCATCCCTCCAGCCCTCCAGCCTGGGAATATACTCCATCAGCCACAAGCAAGTCTGAGAGAGATTTCTGTACAAAAGTGGATTGGATGCAGCTGCACTGCTAGGTCACCTTAAAAGGTCAAGATGTTACTAGAAATAAAATATATATTTTGGATATTCTCGGCATTCTCCCTTACTAATGCATTCCGTGCAGTTCAAGTGGAAAAGAGTTCCCCAGTGAAGGGTTCGTTATCTGGAAGAGTGAATCTGCCATGCTTTTTTTCAACCATACCAACATTGCCACCCAGCTACAATATTACAAATGAATTCCTGAGGATCAAATGGACCAAAATTGTTCAGAGCAGAGATGGAAAGGACCCAAAGGAAACTACAGTTTTGGTGGCCCAAAGTGGAAGTATTAAAATTGGACAACAATATAGAGGCAGAGTGTCTGTGCCAAGTCACCCTGAAGACATTGGGGATGCATCTTTAACCATAGTCAAACTACGTGCTAGTGATGCTGGTGTTTACCGATGTGAAGTTCTGTTTGGGATTGAGGATACCCAAGACACAGTTTCCTTGGATGTTTCAGGAGTTGTGTTCCACTACCGAGCCTCTACTGACAAGTACACTTTGGACTTTGAGGCTGCTCAGAAAGCATGCATAGACAATGGTGCCCAAATTGCAACTCCTGGACAACTGAGAGCAGCTTATGAAGATGGTTTTGAGCAATGTGATGCTGGGTGGCTTTCTGACCAGACTGTTAGATATCCAATCCGCTCGCCTAGAGCAGCCTGCTATGGTGATAAAATGGGAAAGGAAGGAATCCGTACCTATGGAAAGCGTCCTGTTTCTGAGAAATACGACGTGTACTGTTTTGTGGATGAACTGGAAGGTGACCTGTTTCACACGACTGCTAACAAAAAGTTCACCTTTGAAGAAGCCAAACAGGAGTGCGAGAAGAAGAATGCCGCTCTGGCCACAGTGGGAGATCTGTATGCGGCCTGGAGAAAGGGATTTGACCAGTGTGATTATGGATGGCTTGCTGACGGCAGCGTTCGTTACCCAGTATCTGTGGCCCGACCCCAGTGTGGAAATGGTTTGCTTGGAGTTCGTACCAAATACCGCTTCAGTAACCAGACTAATTTCCCTAATTCACTGGAGAGATTTGATGCATATTGTATCCAAAGCAAAAGGAATATAACGGAATCTGTATCTGTTAGATTGATATTTCCGACTGAAGCAACAACCGCCAGTATTATAAAAACAGTAGAAAAATTACCTGAAAAGGTAACAGCAAAGTCTGTTTATTCTCATGGACGACAACCTGCAACAGAAAGCATTTCACATTTGAAAGCAGAAACAACTGTTACAGCTGATGCCAGACAGAGAGAAACAGTAGGCCCAACAGATCCATCAGCTCTATTATTTCAAGAAGAGGGTACCTCGGCTTCTAAACTGGAAAGTAGCCAAGATGTAATAGAATCTTCCGCTGATCAGACCGAAAAAATAACAGAGTCTCCTGTGAAACAACAATTTTCTGTAACTGATAATTCCATAAAACTGACAAAAGAGGTTTTATATCAAAGTTCACAGCCCCCAAAAGGGTCAATGGAAGCCAAAACTGAAGAAGTTATCCCAACGGTTATAATACATCATAAGATTGTTGGTGATGACATTGTTACCAGCCCACCAGAAATAGAAGCAGGACCTGAAGAACCCGTTGATAGTGTTGTGACAGTAAGTAGTTTAAAACATGATTTTGATTCCTCAAGCACACAGCCTGAGGTGGATGTAATTACAGTGTACAAAACATCCACCTCTGTGCAGCCTGGAGTAACTTCAGGCTTTGATTCCTCTGAGGAAGGTAGCCAGCCAATTGTGGCTACAGACTTGATAATTTCAAAAGACAAACATGTAGTTAGTACAGTTACAGCCCATCAAGATGAGTTCACAGATGAAGGCAGTAGACTTGAACTAGAAAGTACAACATTGCCTGAGAGCACTGTCACTCAGGATGGAATTGTAGAATCTGAGGACAGTTATGCAGTTGCTGTGGAAGAAACAACATCACCACCAGTGCTTCTTGTTCAGTCAAGCCAACCATCACATTTAGACATGCATGTTCCTGAAGCCATCTCTACAATCAAAGAACAACAAACCATTCCACCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Brn3 FL                         CAAK11319.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACTCAGCACAGACACACGCTGCAGAGACTTCTGGGATCAGGTGCCCTTGTTCTACGGGGACTTTTATAGTGCAAGAGCCTACAAACAGGATCCCCCCCAAAAGCATCCCTCCAGCCCTCCAGCCTGGGAATATACTCCATCAGCCACAAGCAAGTCTGAGAGAGATTTCTGTACAAAAGTGGATTGGATGCAGCTGCACTGCTAGGTCACCTTAAAAGGTCAAGATGTTACTAGAAATAAAATATATATTTTGGATATTCTCGGCATTCTCCCTTACTAATGCATTCCGTGCAGTTCAAGTGGAAAAGAGTTCCCCAGTGAAGGGTTCGTTATCTGGAAGAGTGAATCTGCCATGCTTTTTTTTCAACCATACCAACATTGCCACCCAGCTACAATATTACAAATGAATTCCTGAGGATCAAATGGACCAAAATTGTTCAGAGCAGAGATGGAAAGGACCCAAAGGAAACTACAGTTTTGGTGGCCCAAAGTGGAAGTATTAAAATTGGACAACAATATAGAGGCAGAGTGTCTGTGCCAAGTCACCCTGAAGACATTGGGGATGCATCTTTAACCATAGTCAAACTACGTGCTAGTGATGCTGGTGTTTACCGATGTGAAGTTCTGTTTGGGATTGAGGATACCCAAGACACAGTTTCCTTGGATGTTTCAGGAGTTGTGTTCCACTACCGAGCCTCTACTGACAAGTACACTTTGGACTTTGAGGCTGCTCAGAAAGCATGCATAGACAATGGTGCCCAAATTGCAACTCCTGGACAACTGAGAGCAGCTTATGAAGATGGTTTTGAGCAATGTGATGCTGGGTGGCTTTCTGACCAGACTGTTAGATATCCAATCCGCTCGCCTAGAGCAGCCTGCTATGGTGATAAAATGGGAAAGGAAGGAATCCGTACCTATGGAAAGCGTCCTGTTTCTGAGAAATACGACGTGTACTGTTTTGTGGATGAACTGGAAGGTGACCTGTTTCACACGACTGCTAACAAAAAGTTCACCTTTGAAGAAGCCAAACAGGAGTGCGAGAAGAAGAATGCCGCTCTGGCCACAGTGGGAGATCTGTATGCGGCCTGGAGAAAGGGATTTGACCAGTGTGATTATGGATGGCTTGCTGACGGCAGCGTTCGTTACCCAGTATCTGTGGCCCGACCCCAGTGTGGAAATGGTTTGCTTGGAGTTCGTACCAAATACCGCTTCAGTAACCAGACTAATTTCCCTAATTCACTGGAGAGATTTGATGCATATTGTATCCAAAGCAAAAGGAATATAACGGAATCTGTATCTGTTAGATTGATATTTCCGACTGAAGCAACAACCGCCAGTATTATAAAAACAGTAGAAAAATTATCTGAAAAGGTAACAGCAAAGTCTGTTTATTCTCATGGACGACAACCTGCAACAGAAAGCATTTCACATTTGAAAGCAGAAACAACTGTTACAGCTGATGCCAGACAGAGAGAAACAGTAGGCCCAACAGATCCATCAGCTCTATTATTTCAAGAAGAGGGTACCTCGGCTTCTAAACTGGAAAGTAGCCAAGATGTAATAGAATCTTCCGCTGATCAGACCGAAAAAATAACAGAGTCTCCTGTGAAACAACAATTTTCTGTAACTGATAATTCCATAAAACTGACAAAAGAGGTTTTATATCAAAGTTCACAGCCCCCAAAAGGGTCAATGGAAGCCAAAACTGAAGAAGTTATCCCAACGGTTATAATACATCATAAGATTGTTGGTGATGACATTGTTACCAGCCCACCAGAAATAGAAGCAGGACCTGAAGAACCCGTTGATAGTGTTGTGACAGTAAGTAGTTTAAAACATGATTTTGATTCCTCAAGCACACAGCCTGAGGTGGATGTAATTACAGTGTACAAAACATCCACCTCTGTGCAGCCTGGAGTAACTTCAGGCTTTGATTCCTCTGAGGAAGGTAGCCAGCCAATTGTGGCTACAGACTTGATAATTTCAAAAGACAAACATGTAGTTAGTACAGTTACAGCCCATCAAGATGAGTTCACAGATGAAGGCAGTAGACTTGAACTAGAAAGTACAACATTGCCTGAGAGCACTGTCACTCAGGATGGAATTGTAGAATCTGAGGACAGTTATGCAGTTGCTGTGGAAGAAACAACATCACCACCAGTGCTTCTTGTTCAGTCAAGCCAACCATCACATTTAGACATGCATGTTCCTGAAGCCATCTCTACAATCAAAGAACAACAACCAACCGAAACACACACCACTTATAAAGAGACAGTCGAAGAACAGATAACACCAAAACCTGTTCCTATTTCTACCCAGAAGCCACATCTGATAGATGTGGAACCCGATGAGGAAACCAGCAAGGGAACAATAGTGATTGGTGAGTCTATTTCTCATCTAAAAGTTACAACTGAATCTGATATGACAGGCAAACAGAAGCAAGATATTGACTCAGAATACCTGACAAGCGGAACTTCTGCAAAAGAACCCACCCAGGAGCCAGAATGCGAGGACACCTCAGATGAGACTCAAACGAATGTACACAATGAAGATTCGAATCAGATACCAATCAATCTGATCGTTGTAGAAGTTAATGAAAATGTGACAGGTCAAGACCCATGCAAAGTAAATCCATGCCAAGGTGGAGGGACCTGTTACGCTCGTGGAGGTTCATCCTTTGTCTGCACATGTATGCCTGGTTTCAGTGGAGATCAGTGTGAAATTGATATAGATGAATGTCAGTCAAACCCTTGCCGGAATGGAGCAGCGTGTGTTGATGGGATAAACTCCTTTTCATGTATCTGTCTTCCAAGCTACGCTGGATCACTTTGTGAGCAAGACACCGAGGTCTGTGACTATGGCTGGCACAAATTCCAAGGTCACTGCTACAAATATTTTGCCCATCGACGTACCTGGGACGCAGCCGAGAGAGAATGCCGTGTACAAGGTGGCCACCTGACAAGTATTATGTCCAATGACGAACAGACTTTCGTCAACCGTTTAGGGCATGATTACCAGTGGATTGGCCTCAATGATAAGATGTTTGAGAATGACTTCCGTTGGACTGATGGAAGCACAATGCAATATGAAAACTGGCGGCCAAACCAACCAGACAGTTTCTTCTCAGCTGGTGAAGATTGTGTCGTTATTATTTGGCACGAGAATGGCCAGTGGAACGATGTTCCATGCAACTACCATCTTACTTACACCTGCAAAAAGGGAACAGTGGCGTGCGGACAGCCTCCTTTTGTTGAAAATGCCAAGACCTTTGGAAAGGCCAAACCTCGCTATGAGATAAACTCTATGGTCAGATACCACTGCATGGAAGGCTTTGTACAGCGCCATTTGCCAACCATAAGATGCAGAGGTGATGGACGATGGGATTTGCCTAAAGTGTCCTGTCTGAAACCTTCCAATTTCCAAAGGACTTACTCTAAGAAATATTATTACAAGTTTACTCCACCTGAGATGAGGGCTTCCATGAATTCTCCAAAGCACCACCACAGCTGGAGCAGGACTTGGCAAAACTCCCCACGCTGAAGAACCCCGACCAACCATCAGCAGACACCTTGGCTGCCAAAGTCCTCATTTATAGTGCCTTTCACAAGAGTTCCGAGAAGTGATATCTTAGACTTGGACTATGGCGTTGAATAAAAAAATAAGACATTTTGACCTAAAATCTTAGACATTATAGGGACTAAACCTGATGTAAGCAAAAAAAAAAAAAAA
  5   1   2      seed TpA  FL                        TTpA007c12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCACAGGACTCAGCACAGACACACGCTGCAGAGACTTCTGGGATCAGGTGCCCTTGTTCTACGGGGACTTTTATAGTGCAAGAGCCTACAAACAGGATCCCCCCAAAAGCATCCCTCCAGCCCTCCAGCCTGGGAATATACTCCATCAGCCACAAGCAAGTCTGAGAGAGATTTCTGTACAAAAGTGGATTGGATGCAGCTGCACTGCTAGGTCACCTTAAAAGGTCAAGATGTTACTAGAAATAAAATATATATTTTGGATATTCTCGGCATTCTCCCTTACTAATGCATTCCGTGCAGTTCAAGTGGAAAAGAGTTCCCCAGTGAAGGGTTCGTTATCTGGAAGAGTGAATCTGCCATGCTTTTTTTCAACCATACCAACATTGCCACCCAGCTACAATATTACAAATGAATTCCTGAGGATCAAATGGACCAAAATTGTTCAGAGCAGAGATGGAAAGGACCCAAAGGAAACTACAGTTTTGGTGGCCCAAAGTGGAAGTATTAAAATTGGACAACAATATAGAGGCAGAGTGTCTGTGCCAAGTCACCCTGAAGACATTGGGGATGCATCTTTAACCATAGTCAAACTACGTGCTAGTGATGCTGGTGTTTACCGATGTGAAGTTCTGTTTGGGATTGAGGATACCCAAGACACAGTTTCCTTGGATGTTTCAGGAGTTGTGTTCCACTACCGAGCCTCTACTGACAAGTACACTTTGGACTTTGAGGCTGCTCAGAAAGCATGCATAGACAATGGTGCCCAAATTGCAACTCCTGGACAACTGAGAGCAGCTTATGAAGATGGTTTTGAGCAATGTGATGCTGGGTGGCTTTCTGACCAGACTGTTAGATATCCAATCCGCTCGCCTAGAGCAGCCTGCTATGGTGATAAAATG
  5   1   2   15  bld Brn3 FL   out                       CAAK11319.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACTCAGCACAGACACACGCTGCAGAGACTTCTGGGATCAGGTGCCCTTGTTCTACGGGGACTTTTATAGTGCAAGAGCCTACAAACAGGATCCCCCCCAAAAGCATCCCTCCAGCCCTCCAGCCTGGGAATATACTCCATCAGCCACAAGCAAGTCTGAGAGAGATTTCTGTACAAAAGTGGATTGGATGCAGCTGCACTGCTAGGTCACCTTAAAAGGTCAAGATGTTACTAGAAATAAAATATATATTTTGGATATTCTCGGCATTCTCCCTTACTAATGCATTCCGTGCAGTTCAAGTGGAAAAGAGTTCCCCAGTGAAGGGTTCGTTATCTGGAAGAGTGAATCTGCCATGCTTTTTTTTCAACCATACCAACATTGCCACCCAGCTACAATATTACAAATGAATTCCTGAGGATCAAATGGACCAAAATTGTTCAGAGCAGAGATGGAAAGGACCCAAAGGAAACTACAGTTTTGGTGGCCCAAAGTGGAAGTATTAAAATTGGACAACAATATAGAGGCAGAGTGTCTGTGCCAAGTCACCCTGAAGACATTGGGGATGCATCTTTAACCATAGTCAAACTACGTGCTAGTGATGCTGGTGTTTACCGATGTGAAGTTCTGTTTGGGATTGAGGATACCCAAGACACAGTTTCCTTGGATGTTTCAGGAGTTGTGTTCCACTACCGAGCCTCTACTGACAAGTACACTTTGGACTTTGAGGCTGCTCAGAAAGCATGCATAGACAATGGTGCCCCAATTGCAACTCCTGGACAACTGAGAGCAGCTTATGAAGATGGTTTTGAGCAATGTGATGCTGGGTGGCTTTCTGACCAGACTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)