Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAO8368.3                            4 END     2         100       50                D site of albumin promoter (albumin D-box) binding protein [Homo sapiens]

 This cluster: approximate FL confidence score = 77%

 1012108473 Xt7.1-CAAO8368.5 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAO8368.5 GGCAACGTTGTTGCAGTGATCGGGAAATGGGAACACTTGGATCATATGCCCCCAGCCAGGAAGCCGAGCTGAGCCCCCACTATTTACAGGGACCCTGAATATATTGCTCGTCATCATTCATTCACTGACTGGGACATTCGGACTTTTTGCGTTTATCCCGGGATACCGTCCTCCCTTGGCTCATTGGTGAACATCGATATCGATCTGATATTGTGCAGGAACGATCGGGCATTGCTGCTGCTTCTGTATTTGCTGTGCATCTGCCAAGTGCTTGTTAAAGGGCTATGGCTCGGCCAACTACCCAGCTGGCTGCCAGCGAGAAGCTACAGGGGCAACAGCTGCATCCTACGCCTCCCCTTGGGGCCCCCGGGCCCGGGATGGTCAGCCTAAAGAGCCTCCTGCAAGGGCCCATAAAGGGTACGGATCGCAGAACTAGAGAGCTTTCTAACTGTATAATGAAAGAAAAGGAGAGGAAACTAGAAGATGACATGACTGGTCCTCGTCCCGCTCACTGTGCGTTCCTGGGGTCCCTACTGTGGGAACGCACATTGCCATATAATGAAATAGAGTATGTGGACCTGGATGAGTTCCTACGAGAGAATGGCCTTCCTCCAAGCCCACCTCACCAGCCCTTCTCACCAGCGAATCTGACGCCACCTCCATCTAACCAATCAGTGGTTGATCTCAGCCGACCGGCCTCCTGCGCCTCTTCTACCTCCGCCTGTTCTTCTCCTGTGCAAAGCATGATTGACAGTGAATATGAACATCCAAGCAGCCAAGCAGGTCAGATGA
                                                  Xt7.1-CHK-1008254224       GTTGTTGCAGTGATCGGGAAATGGGAACACTTGGATCATATGCCCCCAGCCAGGAAGCCGAGCTGAGCCCCCACTATTTACAGGGACCCTGAATATATTGCTCGTCATCATTCATTCACTGACTGGGACATTCGGACTTTTTGCGTTTATCCCGGGATACCGTCCTCCCTTGGCTCATTGGTGAACATCGATATCGATCTGATATTGTGCAGGAACGATCGGGCATTGCTGCTGCTTCTGTATTTGCTGTGCATCTGCCAAGTGCTTGTTAAAGGGCTATGGCTCGGCCAACTACCCAGCTGGCTGCCAGCGAGAAGCTACAGGGGCAACAGCTGCATCCTACGCCTCCCCTTGGGGCCCCCGGGCCCGGGATGGTCAGCCTAAAGAGCCTCCTGCAAGGGCCCATAAAGGGTACGGATCGCAGAACTAGAGAGCTTTCTAACTGTATAATGAAAGAAAAGGAGAGGAAACTAGAAGATGACATGACTGGTCCTCGTCCCGCTCACTGTGCGTTCCTGGGGTCCCTACTGTGGGAACGCACATTGCCATATAATGAAATAGAGTATGTGGACCTGGATGAGTTCCTACGAGAGAATGGCCTTCCTCCAAGCCCACCTCACCAGCCCTTCTCACCAGCGAATCTGACGCCACCTCCATCTAACCAATCAGTGGTTGATCTCAGCCGACCGGCCTCCTGCGCCTCTTCTACCTCCGCCTGTTCTTCTCCTGTGCAAAGCATGATTGACAGTGAATATGAACATCCAAGCAGCCAAGCAGGTC
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     284       6 
                                               BLH MIN     317      11 
                                               BLH MPR     308      11 
                                               BLH OVR     284      60 
                                               CDS MIN     284      11 
                                               ORF LNG     284       5 
                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 7e-007     XP_797650.1 PREDICTED: similar to hepatic leukemia factor [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Xt ---- 3e-007     CAJ83354.1 thyrotrophic embryonic factor [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - ?? ---- 2e-009     XP_693458.1 PREDICTED: similar to Hepatic leukemia factor, partial [Danio rerio] ======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Dr ---- 1e-015     NP_001070802.1 hypothetical protein LOC768192 [Danio rerio] ========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 3e-016     NP_766151.1 hepatic leukemia factor [Mus musculus] =================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 1e-016     NP_002117.1 hepatic leukemia factor [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Gg ---- 1e-017     XP_415649.2 PREDICTED: similar to hepatic leukemia factor [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAO8368.5                           ATG------------------------------------------------------------------TGA---------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------TAA------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2       bld Te5       out                        CAAO8368.5p GGCAACGTTGTTGCAGTGATCGGGAAATGGGAACACTTGGATCATATGCCCCCAGCCAGGAAGCCGAGCTGAGCCCCCACTATTTACAGGGACCCTGAATATATTGCTCGTCATCATTCATTCACTGACTGGGACATTCGGACTTTTTGCGTTTATCCCGGGATACCGTCCTCCCTTGGCTCATTGGTGAACATCGATATCGATCTGATATTGTGCAGGAACGATCGGGCATTGCTGCTGCTTCTGTATTTGCTGTGCATCTGCCAAGTGCTTGTTAAAGGGCTATGGCTCGGCCAACTACCCAGCTGGCTGCCAGCGAGAAGCTACAGGGGCAACAGCTGCATCCTACGCCTCCCCTTGGGGCCCCCGGGCCCGGGATGGTCAGCCTAAAGAGCCTCCTGCAAGGGCCCATAAAGGGTACGGATCGCAGAACTAGAGAGCTTTCTAACTGTATAATGAAAGAAAAGGAGAGGAAACTAGAAGATGACATGACTGGTCCTCGTCCCGCTCACTGTGCGTTCCTGGGGTCCCTACTGTGGGAACGCACATTGCCATATAATGAAATAGAGTATGTGGACCTGGATGAGTTCCTACGAGAGAATGGCCTTCCTCCAAGCCCACCTCACCAGCCCTTCTCACCAGCGAATCTGACGCCACCTCCATCTAACCAATCAGTGGTTGATCTCAGCCGACCGGCCTCCTGCGCCTCTTCTACCTCCGCCTGTTCTTCTCCTGTGCAAAGCATGATTGACAGTGAATATGAACATCCAAGCAGCCAAGCAGGTCAGATGACTC
  5   1   2   14 seed Brn4 5g3  out                       CAAL19566.5p .................................................................................ATTTACAGGGACCCTGAATATATTGCTCGTCATCATTCATTCACTGACTGGGACATGGGGACTTTTTGCGTTTATCCCGGGATACCGTCCTCCCTTGGCTCATTGGTGAACATCGATATCGATCTGATATTGTGCAGGAACGATCGGGCATTGCTGCTGCTTCTGTATTTGCTGTGCATCTGCCAAGTGCTTGTTAAAGGGCTATGGCTCGGCCAACTACCCAGCTGGCTGCCAGCGAGAAGCTACAGGGGCAACAGCTGCATCCTACGCCTCCCCTTGGGGCCCCCGGGCCCGGGATGGTCAGCCTAAAGAGCCTCCTGCAAGGGCCCATAAAGGGTACGGATCGCAGAACTAGAGAGCTTTCTAACTGTATAATGAAAGAAAAGGAGAGGAAACTAGAAGATGACATGACTGGTCCTCGTCCCGCTCACTGTGCGTTCCTGAGGTCCCTACTGTGGGAACGCACATTGCCATATAATGAAATAGAGTATGTGGACCTGGATGAGTTCCTAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)