Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI4549.3                            3 END     2          66       66                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 200.0    0Xt7.1-CABI11859.5                          11 PI      76        145      495                paired box gene 2 [Xenopus tropicalis]
     3 248.0    0Xt7.1-TTbA015k14.5                          8 PI      78        159      519                paired box protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 73%

 1012109036 Xt7.1-CABI11353.5 - 3 ESTs
                                                                       .......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI11353.5                                                                                                                                                                                                                                                                                                                                                                                          GTCCTCCAGAGACAAGGTGACATTGGCTGGAAGGAGTCGCACTGTGGATTTACCAGGGACTCGGAGGAAGATGCCCAACAGCAGCATCAGATCAGAGCTCATCACAGAGAGGGGCTGCTCAGGACCTGCCAGCAATCTCAATATAGGTCACGGAGGTTTGAATCAGCTAGGTGGTGCCTTTGTGAATGGGCGACCCCTGCCAGAGGTGGTGAGGCAGCGAATAGTTGACCTGGCACATCAGGGGGTACGTCCCTGTGACATCTCCTCACGACAGCTCCGAGTCAGTCATGGCTGTGTCAGCAAAATTTTGGGCAGGTACTATGAGACAGGCAGTATTCGGCCAGGCGTCATCGGAGGTTCCAAGCCCAAGGTTGCCACCCCCAAAGTGGTGGAGAAAATCGGAGATTACAAACGCCAGAACCCTACAATGTTTGCCTGGGAAATCAGGGACCGGCTGCTGGCAGAGGGGGTGTGCGACAATGACACAGTTCCCAGCGTCAGCTCTATCAACAGAATCATACGCACCAAAGTACAGCAACTTTTTAACCTGCCTATGGAGAGCTGCGTAAAATCACTGAGCCCAGGACAGACTTTAATCCCTAGTTCAGCAGTCACGCCCCCTGAGTCTCCCCATTCAGACTCTCTGGGATCCACGTATTCCATCAGCGGTTTGTTGGGAATCACGCAGCCCGGCGCGGATGGAAAGCGCAAACTTGATGACAGTGACCAGGAGAGCTGCAGGCTCAGCATTGACTCCCAAGGCAGCATGGATCAGTAGGAAACAGCTCCGTACCGAGGCTTATGGGCACCACCCTCTAGACGCCCTGGAGTGTCACTTCCAGAGACAACATTTCCCGGAATCCTACTCTTCTTCCACTCACAGCAAAACAGAACAGGCTCTATATACCCTACCCCTGCTCAACAATTCATTGGATGATGGAAAATCATCACTGACTTCCACAAACACCACAATTGGCAGAAACC
                                                  Xt7.1-CHK-1008248863                                                                                                                                                                                                                                                                                                                                                                                                CAGAGACAAGGTGACATTGGCTGGAAGGAGTCGCACTGTGGATTTACCAGGGACTCGGAGGAAGATGCCCAACAGCAGCATCAGATCAGAGCTCATCACAGAGAGGGGCTGCTCAGGACCTGCCAGCAATCTCAATATAGGTCACGGAGGTTTGAATCAGCTAGGTGGTGCCTTTGTGAATGGGCGACCCCTGCCAGAGGTGGTGAGGCAGCGAATAGTTGACCTGGCACATCAGGGGGTACGTCCCTGTGACATCTCxxxACxACAGCTCCGAGTCAGTCATGGCTGTGTCAGCAAAATTTTGGGCAGGTACTATGAGACAGGCAGTATTCGGCCAGGCGTCATCGGAGGTTCCAAGCCCAAGGTTGCCACCCCCAAAGTGGTGGAGAAAATCGGAGATTACAAACGCCAGAACCCTACAATGTTTGCCTGGGAAATCAGGGACCGGCTGCTGGCAGAGGGGGTGTGCGACAATGACACAGTTCCCAGCGTCAGCTCTATCAACAGAATCATACGCACCAAAGTACAGCAACTTTTTAACCTGCCTATGGAGAGCTGCGTAAAATCACTGAGCCCAGGACAGACTTTAATCCCTAGTTCAGCAGTCACGCCCCCTGAGTCTCCCCATTCAGACTCTCTGGGATCCACGTATTCCATCAGCGGTTTGTTGGGAATCACGCAGCCCGGCGCGGATGGAAAGCGCAAACTTGATGACAGTGACCAGGAGAGCTGCAGGCTxAxxATTGACTCCCAAGGCAGCATGGxxxxGTAGGAAACAGCTCCGTACCGAGGCTTATGGGCACCACCCTCTAGACGCCCTGGAGTGTCACTTCCAGAGACAACATTTCCCGGAATCCTACTCTTCTTCCACTCACAGCAAAACAGAACAGGCTCTATATACCCTACCCCTGCTCAACAATTCATTGGATGATGGAAAATCATCACTGACTTCCACAAACACCACAATTGGCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                               1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      70     167                                                                                                                                                                                                                                                                                                                                                                                          
                                               BLH MIN      34     141                                                                                                                                                                                                                                                                                                                                                                                          
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Br ==== 3e-050     CAB42656.1 amphipax1 protein [Branchiostoma lanceolatum] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 1e-050     NP_500513.1 paired box protein (38.5 kD) (4E962) [Caenorhabditis elegans] ---------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Sp ---- 7e-051     NP_999759.1 paired box protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 2e-057     NP_524633.3 CG11049-PA, isoform A [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 6e-061     BAC41498.1 Pax-2/5/8 [Ciona intestinalis] =====================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Bf ---- 4e-068     AAC12733.1 paired box protein Pax-2 alpha isoform [Branchiostoma floridae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Bb ---- 4e-068     ABK54277.1 Pax-2 [Branchiostoma belcheri] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Gg ---- 9e-089     NP_990124.1 paired-box containing protein Pax-2 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dr ---- 3e-089     NP_571715.1 paired box gene 2b [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 1e-129     NP_039245.1 paired box gene 8 isoform PAX8B [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 3e-131     NP_035170.1 paired box gene 8 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 1e-162     AAD52681.1 Pax-8 DNA-binding transcription factor [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === ?? ==== 1e-162     NP_001081941.1 Pax-8 DNA-binding transcription factor [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 3e-163     A0JMA6 Paired box protein Pax-8 [Xenopus tropicalis]  ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI11353.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                         ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                              ...
  0   1   1           Ovi1 FL                         CABI11353.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAAGAGCTCATCACAGAGAGGGGCTGCTCAGGACCTGCCAGCAATCTCAATATAGGTCACGGAGGTTTGAATCAGCTAGGTGGTGCCTTTGTGAATGGGCGACCCCTGCCAGAGGTGGTGAGGCAGCGAATAGTTGACCTGGCACATCAGGGGGTACGTCCCTGTGACATCTCACGACAGCTCCGAGTCAGTCATGGCTGTGTCAGCAAAATTTTGGGCAGGTACTATGAGACAGGCAGTATTCGGCCAGGCGTCATCGGAGGTTCCAAGCCCAAGGTTGCCACCCCCAAAGTGGTGGAGAAAATCGGAGATTACAAACGCCAGAACCCTACAATGTTTGCCTGGGAAATCAGGGACCGGCTGCTGGCAGAGGGGGTGTGCGACAATGACACAGTTCCCAGCGTCAGCTCTATCAACAGAATCATACGCACCAAAGTACAGCAACTTTTTAACCTGCCTATGGAGAGCTGCGTAAAATCACTGAGCCCAGGACAGACTTTAATCCCTAGTTCAGCAGTCACGCCCCCTGAGTCTCCCCATTCAGACTCTCTGGGATCCACGTATTCCATCAGCGGTTTGTTGGGAATCACGCAGCCCGGCGCGGATGGAAAGCGCAAACTTGATGACAGTGACCAGGAGAGCTGCAGGCTCAGCATTGACTCCCAAGGCAGCATGGGGATCAGTAGGAAACAGCTGCGCACCGAGGCATATGGGCACCACCCTCTGGACGCCCTGGAGTGTCACTTCCAGAGACAACATTTCCCAGAGTCCTACTCCTCTTCCACCCACAGCAAAACAGAACAGGCTCTATATACCCTACCCCTGCTCAACAATGCAATGGATGATGGGAAATCTTCACTGACTTCCACAAACACAACAATTGGTAGAAACCTCTCGACCCACCAGGGATACTCTGCTCTATCTGAACTCTCAGCCTTCACCATTAAACAAGAGGCTTCAGACAGCTCCAGCGCTAGCTCCACCCCTTCATCTTTATGTAGCCCCACCTTCCTGGATCTGCAGCCAATCAGCTCAGGATGCTCAGCGCCATCCTTCAGCGCTTTTTCACACCCCGCATCTGTGTACGGCCAGTTCACAAGCCACATGGCCTCAGGTCGTGATGTGGTTGGATCCACGTTGCCAGGGTACCCACCTCACATACCTAGCGGGCAAGGAAATTACGCCTCTTCTGCGATTGCTGGAATGGTAGCTGCAGGAGGTGATTACTCTGGAAATGCCTATAGCCATGGGGCTTATGCAGCCTACGGAGAGAGTTGGCGTTTCCCCAGCTCAAGCCTTCTAGGCTCTCCCTATTACTACAGCTCTGCCACAAGGACTGCACCTCCTCCCACAACGGCAGGAGCCTATGACCTTCTGTAGTCTTCATGGAGACCGTTGAGTAGCATCATCAACAAAGCAACCCGGCCCTGGGAAAGTGGCTTAATGGTGGACAAAACTAACCATGGCAACACATGGTCACAAGTGTTATGAGACAACAAGTAACAAGAACAACATATCAAACATGGACTAAAGTTACCCTTTTAATCTTGGACTTCCTGGAGCTGTGGATGATATTCGGTAACGCAAGAGATGAAACCTCCGAAGAAGATACAAAGAAAAATCACATTCATTGTTTCTGCAAGCCTAACAAGGAATATTTTTTTGTTCTCTCCACAAATGTAGAAAATGTATAGAGCCATGTACAAGGGTGTTACATACATTTATATATTGGGGTATATAACAAAATATTTGCTAGGCATTTCAGCTGCGATGTGTAGTTAGCCTAACAATGTGTAGTTTCTCCTGTTGATCCTAAGGACAATGGTAAAGACGGCCAGGGTCAGACTGGGCTGCCAGAGTACCACAGGATCTCTAAATGGGCCCAGGATGATTCCCTTCAGTCCTTTCTTATTTTCACCATAGGTTTAGCACAGTCTACATGGAATTGCTGTGCGCCCTCCTTGTCAGGTTCTCCTATGTTCCCTAGGTGACCCAATTTGCAAATTCATTGCAACTCTTGCAGCTCTGCAAATGGAGCTTCTTAATCTGTTCTCAAACTTCCAACAACCTGCAGTGGATGCTGGGCAATTTAGTTTAACAACAGATGGAGCAAGAGAACACTGTAGTACAAGGATTTCCAACTGCACTGTTCTGTACATTCAGAGCTGAGCAAGTGCTGGACCTGGCAGGAAACAAACCAACTGCAGCCCATTCGTCCCCTCTCCGTAACATCCCCAAATTAAAATGGTGAAGTAAAACACCAAAAAGAATGTTGGCAGGAAACACTACACATTGTTTAAAGGTAATCACCCTGAACTGCCCTTGATTTACCTTTCTCTGTAACACAAAAAAAAATGAAGTAAGCATTCAGCTGCTCCTCTCATCTGCCCTCTTTGGTTTAAAAGTTTAATAACTGTCCCTTATTTATATGGAGTTGGCTCTGGGGTCTGACAGCAAAAAACTTCCTCCCTATTGGTGGAAGTGCCTTCTGGATAAACGGAGGCAGAAAAGAGTTGTATGAGGTGGGCCCGCAGGCTGCTGTTCTCATCCCAATGCCGTGTTCCGTGGCATGTTTACAAATGCAGCAATATTTTATCCAGTACGAGGAGGGAACATAGAACATAAACCCCCTTACCCTTTCCTCTCACTTAAGAATAAGCAATGCACATATCCATTAATTTAGTAGAGTAACTATAGGATACCTGGCCCCATATCACAATCTTTTTAGGGCCCCTTAAGCTTTGGGAATAAGATACAATATACCACTTTATCAGTTAGTGGCCCACTGGGCCCCCTAAATAAATTGCCATTCAGCATTTGGATTTTATTACTGTCCACTTTTAAAAGAAATAATTTTTTTGAAAGCAGAATTTTCCCAAGGCTGCCCAATGAACACACTCAAAGCATCCCTGCTGGGAAGGGAGTACAAGTTGGGTTTGTAATGCTGCATTTAAGTAAGTGAGGAGGGGAAATGCTGGAGTTGTTGTACTTCCACTCCCTGCACAGCTGCAGGAGCAAAGACTGCACAAATAGACTCAAAACTGTATATAAATATATGTATGTACAAAATATACATCTATGCAGAGCTCTGTCTCTATATATATATACTGTTTTTATAGCCACAAGGGCTGTACCAGTGACTGGAATGCACTAGTTATTCATACTCTTAGTGCCGGTTCACAATCACTCTAGAAATCTGACTTGGAAGAAGATGCAAATCACACAGCGGGGCTAATTTACTAAGATAGGTGCTAAATTGCCCCTGAGTGTAATCACCCATGGCAACCAGCCAACAATTAACTGTGATCTGCCCACTTATGTTAGAAATGAAAGATCTAATTGGTGGTTACTGGGACACGTTAATACCTATGTCAGTGAGTCAGCCCCATGACTGTGTGTTAACCAGTTGGGCCAAAGGCTATGAATTAACTTCATTTTGATTGGGACATCAACCTGCAAGTGTTTCTAATTACTTGTGCCAAGGCATAGACATAAGTTATATTCTGTTTGCCCTTCCTGTTTTCGACGTGGCGGCTCAGTGCACACAAACGCTGGGGAATATAATGCAAGAGGTTACAATGAAGGAAAGACTTAAGATCAGGCATTATTCCAGGATTGTGTCTGCTCCGCACTAAATGACTTTATCACATGGCCCTGTCTGTGGGAATACAGTAACTGCAGGGCCAGACTGTAAATAAATATTTGTAATATAAAATATTTTAAATAAATAAGCATGAAGGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd0 5g3  out                      IMAGE:6977138                                                                                                                                                                                                                                                                                                                                                                                          GTCCTCCAGAGACAAGGTGACATTGGCTGGAAGGAGTCGCACTGTGGATTTACCAGGGACTCGGAGGAAGATGCCCAACAGCAGCATCAGATCAGAGCTCATCACAGAGAGGGGCTGCTCAGGACCTGCCAGCAATCTCAATATAGGTCACGGAGGTTTGAATCAGCTAGGTGGTGCCTTTGTGAATGGGCGACCCCTGCCAGAGGTGGTGAGGCAGCGAATAGTTGACCTGGCACATCAGGGGGTACGTCCCTGTGACATCTCACGACAGCTCCGAGTCAGTCATGGCTGTGTCAGCAAAATTTTGGGCAGTAGGTACTATGAGACAGGCAGTATTCGGCCAGGCGTCATCGGAGGTTCCAAGCCCAAGGTTGCCACCCCCAAAGTGGTGGAGAAAATCGGAGATTACAAACGCCAGAACCCTACAATGTTTGCCTGGGAAATCAGGGACCGGCTGCTGGCAGAGGGGGTGTGCGACAATGACACAGTTCCCAGCGTCAGCTCTATCAACAGAATCATACGCACCAAAGTACAGCAACTTTTTAACCTGCCTATGGAGAGCTGCGTAAAATCACTGAGCCCAGGACAGACTTTAATCCCTAGTTCAGCAGTCACGCCCCCTGAGTCTCCCCATTCAGACTCTCTGGGATCCACGTATTCCATCAGCGGTTTGTTGGGAATCACGCAGCCCGGCGCGGATGGAAAGCGCAAACTTGATGACAGTGACCAGGAAAGCTGCNAGCTCAGCATTGACTCCCAAGGCAGCATGGGGGATCAGTAAGGAAACAGCTGGCGCACCGAGGCATATGGGGCACCACCCTCTGGACGCCCCTGGAGTGTCACTTCCAGAGAACAACATTTCCC
  5   1   2      seed Ovi1 FL   out                       CABI11353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAAGAGCTCATCACAGAGAGGGGCTGCTCAGGACCTGCCAGCAATCTCAATATAGGTCACGGAGGTTTGAATCAGCTAGGTGGTGCCTTTGTGAATGGGCGACCCCTGCCAGAGGTGGTGAGGCAGCGAATAGTTGACCTGGCACATCAGGGGGTACGTCCCTGTGACATCTCACGACAGCTCCGAGTCAGTCATGGCTGTGTCAGCAAAATTTTGGGCAGGTACTATGAGACAGGCAGTATTCGGCCAGGCGTCATCGGAGGTTCCAAGCCCAAGGTTGCCACCCCCAAAGTGGTGGAGAAAATCGGAGATTACAAACGCCAGAACCCTACAATGTTTGCCTGGGAAATCAGGGACCGGCTGCTGGCAGAGGGGGTGTGCGACAATGACACAGTTCCCAGCGTCAGCTCTATCAACAGAATCATACGCACCAAAGTACAGCAACTTTTTAACCTGCCTATGGAGAGCTGCGTAAAATCACTGAGCCCAGGACAGACTTTAATCCCTAGTTCAGCAGTCACGCCCCCTGAGTCTCCCCATTCAGACTCTCTGGGATCCACGTATTCCATCAGCGGTTTGTTGGGAATCACGCAGCCCGGCGCGGATGGAAAGCGCAAACTTGATGACAGTGACCAGGAGAGCTGCAGGCTCAGCATTGACTCCCAAGGCAGCATGGGGATCAGTAGGAAACAGCTGCGCACCGAGGCATATGGGCACCACCCTCTGGACGCCCTGGAGTGTCACTTCCAGAGACAACATTTCCCAGAGTCCTACTCCTC
  3  -1   1       add Gas7                                 XZG45617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCCCCCCCCCCCGACAGCTCAGAGTCAGTCATGGCTGTGTCAGCAAAATTTTGGGCAGGTACTATGAGACAGGCAGTATCCGGCCAGGTGTCATTGGAGGTTCCAAGCCCAAGGTTGCCACCCCCAAAGTGGTGGAGAAAATCGGAAATTACAAACGCCAGAACCCAACAATGTTTGCCTGGGAAATCAGGGACCGGCTGCTGACAGACGGGGTGTGCGACAATGACACAGTTCCCAGTGTCAGCTCTATCAACAGAATCATACGCACTAAAGTACAGCAACTTTTTAACCTGCCCATGGAGAGCTGTGTAAAATCACTGAGCCCAGGACAAACTCTGATCCCTAGTTCAACAGTGACACCCCCTGAGTCTCCCCATTCAGACTCCCTGGGATCCACGTATTCCATCAGTGGTTTGTTGGGGATCACGCAGCCCAGCGCAAATGGAAAGCGCAAACTTGATGACAGTGACCAGGAGAGCTGCAGGCTGAATATTGACTCTCAAGGATGTGGGGATCAGTAGGAAACAGCTCCGTACCGAGGCTTATGGGCACCACCCTCTAGACGCCCTGGAGTGTCACTTCCAGAGACAACATTTCCCGGAATCCTACTCTTCTTCCACTCACAGCAAAACAGAACAGGCTCTATATACCCTACCCCTGCTCAACAATTCATTGGATGATGGAAAATCATCACTGACTTCCACAAACACCACAATTGGCAGAAACCTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)