Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012109068 Xt7.1-CABG11964.5 - 2 ESTs
                                                                       ...-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABG11964.5                                  ATCATTGATGTCTTTGATAGATATGCTGGTACAGAGGGCAACAAACTGACACTCACCAAGGGGGAAATGAAGACACTTTTAGAGAAAGAGCTTCCTGGGATCCTTGGGAGTGCAAAGGAGAAGGACGCTTGCGAGCAACTCATGAAAGATCTAGATGAAAACGGAGACTCCGAAGTGGACTTCAATGAATTCATTATCTTCGTGGCTGCAATCACCTGCCTTGGACACAAGAAATTTGCAGAACCCAAGGAATAAACCCAAACAGAATATTTGCATTGTTTCAGAAATAAAGCTTTATATAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008253122                                        GATGTCTTTGATAGATATGCTGGTACAGAGGGCAACAAACTGACACTCACCAAGGGGGAAATGAAGACACTTTTAGAGAAAGAGCTTCCTGGGATCCTTGGGAGTGCAAAGGAGAAGGACGCTTGCGAGCAACTCATGAAAGATCTAGATGAAAACGGAGACTCCGAAGTGGACTTCAATGAATTCATTATCTTCGTGGCTGCAATCACCTGCCTTGGACACAAGAAATTTGCAGAACCCAAGGAATAAACCCAAACAGAATATTTGCATTGTTTCAGAAATAAAGCTTTATATAAAAAA
                                                      consensus depths                                       2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1
                                                                          PREDICTED - Gg ---- 6e-015     XP_421894.1 PREDICTED: similar to S-100 protein, beta chain [Gallus gallus] ================================================================================================================================================================
                                                                       PROTEIN --- Xl ---- 6e-015     AAI28942.1 Unknown (protein for MGC:160330) [Xenopus laevis] ========================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 6e-015     NP_001091287.1 hypothetical protein LOC100037101 [Xenopus laevis] ===================================================================================================================================================================================
                                                                       PROTEIN --- Mm ---- 2e-016     NP_035439.1 S100 calcium binding protein A1 [Mus musculus] ==========================================================================================================================================================================================
                                                                                               PROTEIN -== Dr ==== 1e-016     NP_001013513.1 zgc:110771 [Danio rerio] ==============================================================================================================================================================================================
                                                                          PROTEIN --- Hs ---- 8e-026     NP_005971.1 S100 calcium binding protein P [Homo sapiens] ==================================================================================================================================================================================
                                                     Xt7.1-CABG11964.5                                                                                                    ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                    ... open reading frame                                                                                                                                                                   ]
  3   1   2      seed Sto1 PIPE in                        CABG11964.3p                                  ATCATTGATGTCTTTGATAGATATGCTGGTACAGAGGGCAACAAACTGACACTCACCAAGGGGGAAATGAAGACACTTTTAGAGAAAGAGCTTCCTGGGATCCTTGGGAGTGCAAAGGAGAAGGACGCTTGCGAGCAACTCATGAAAGATCTAGATGAAAACGGAGACTCCGAAGTGGACTTCAATGAATTCATTATCTTCGTGGCTGCAATCACCTGCCTTGGACACAAGAAATTTGCAGAACCCAAGGAATAAACCCAAACAGAATATTTGCATTGTTTCAGAAATAAAGCTTTATAT
  5   1   2       bld Sto1 PIPE in                        CABG11964.5p                                  ATCATTGATGTCTTTGATAGATATGCTGGTACAGAGGGCAACAAACTGACACTCACCAAGGGGGAAATGAAGACACTTTTAGAGAAAGAGCTTCCTGGGATCCTTGGGAGTGCAAAGGAGAAGGACGCTTGCGAGCAACTCATGAAAGATCTAGATGAAAACGGAGACTCCGAAGTGGACTTCAATGAATTCATTATCTTCGTGGCTGCAATCACCTGCCTTGGACACAAGAAATTTGCAGAACCCAAGGAATAAACCCAAACAGAATATTTGCATTGTTTCAGAAATAAAGCTTTATATAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)