Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 90%

 1012109261 Xt7.1-CAAL22699.5 - 2 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAL22699.5 CCCACTGAGTTACACTAGTATGAAATCTCTCTCTCTCCAACAAGATCAAATGGAGCCATTTAATGAAGAGATGCCATTGTGTCCACCATGCACCTTCCACTATCAATAATTTAAATAGCCCTCGCTGCAAGCCCCGAAGACCAAGCCTGAATATTTTTTTGGGTTTTTTTTCCCCCCCCCGTTGTTTATTGTTTGTAGCCTTTTTAATTTTTTTTTTTCCTGAGGACAGCTGGAAAGAAAACTTCACCCAAACAAACAAAACAAACCACAAAAAACTCCAACAAAATAGAATTTATACAGAGTTTCATCTGAGATCCCCAATACAAGTGTGTTGATGTGTTCTTTGACAAGTACTAACTAAAATAAGTTCCATCAGGTGAGAAGAGTGATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTCAGTTGCATGAAAGCTGCCCCCATGAAAGAAGCCAGTGTCAGAGGACAAAGTGGCCTGGCCTATCCGGGTCTTCGGACCCATGGTACTCTTGAGAGCATAGGTGGTCTCGGTGTCTCAAGAGGAGGAGGACTTCCTTCACTGACAGATACTTTTGAGCATGTCATAGAAGAACTCATGGAAGAGGAACAAAGCATACGACAGAGCGAGGAAAGCAAGGACTCTGACTTGTATTCATCTAGAGTTATGCTAAGCAGTCAAGTACCTTTGGAGCCACCACTGCTTTTCCTACTTGAGGAGTACAAAAACTACTTGGATGCTGCAAACATGTCCATGAGGGTCCGGCGCCACTCGGACCCAGCCAGGCGCGGAGAGCTGAGCGTGTGTGACAGTATTAGCGAATGGGTTACAGCAGCAAACAAGAAAACTGCAGTGGACATGTCGGGGCAAACGGTTACTGTCCTCGAAAAAGTCCCCGTATCCAAAGGCCAACTGAAGCAATATTTCTACGAGACCAAATGTAACCCTATGGGTTACATGAAAGAAGGCTGCAGAGGCATAGACAAAAGGTACTGGAACTCTCAGTGCCGAACTACTCAGTCTTACGTGCGGGCTTTCACCATGGATAGCAAAAAAAAAGTTGGTTGGCGCTTTATAAGAATAGACACTTCTTGTGTATGTACACTGACCATTAAAAGGGGAAGATAGTGAATTTATCTTGTATAGATTATATTGAGAAGAAAATATCTATTTGTATATATACATAACAGGGTAAA
                                                  Xt7.1-CHK-1008254169       GAGTTACACTAGTATGAAATCTCTCTCTCTCCAACAAGATCAAATGGAGCCATTTAATGAAGAGATGCCATTGTGTCCACCATGCACCTTCCACTATCAATAATTTAAATAGCCCTCGCTGCAAGCCCCGAAGACCAAGCCTGAATATTTTTTTGGGTTTTTTTTCCCCCCCCCGTTGTTTATTGTTTGTAGCCTTTTTAATTTTTTTTTTTCCTGAGGACAGCTGGAAAGAAAACTTCACCCAAACAAACAAAACAAACCACAAAAAACTCCAACAAAATAGAATTTATACAGAGTTTCATCTGAGATCCCCAATACAAGTGTGTTGATGTGTTCTTTGACAAGTACTAACTAAAATAAGTTCCATCAGGTGAGAAGAGTGATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTCAGTTGCATGAAAGCTGCCCCCATGAAAGAAGCCAGTGTCAGAGGACAAAGTGGCCTGGCCTATCCGGGTCTTCGGACCCATGGTACTCTTGAGAGCATAGGTGGTCTCGGTGTCTCAAGAGGAGGAGGACTTCCTTCACTGACAGATACTTTTGAGCATGTCATAGAAGAACTCATGGAAGAGGAACAAAGCATACGACAGAGCGAGGAAAGCAAGGACTCTGACTTGTATTCATCTAGAGTTATGCTAAGCAGTCAAGTACCTTTGGAGCCACCACTGCTTTTCCTACTTGAGGAGTACAAAAACTACTTGGATGCTGCAAACATGTCCATGAGGGTCCGGCGCCACTCGGACCCAGCCAGGCGCGGAGAGCTGAGCGTGTGTGACAGTATTAGCGAATGGGTTACAGCAGCAAACAAGAAAACTGCAGTGGACATGTCGGGGCAAACGGTTACTGTCCTCGAAAAAGTCCCCGTATCCAAAGGCCAACTGAAGCAATATTTCTACGAGACCAAATGTAACCCTATGGGTTACATGAAAGAAGGCTGCAGAGGCATAGACAAAAGGTACTGGAACTCTCAGTGCCGAACTACTCAGTCTTACGTGCGGGCTTTCACCATGGATAGCAAAAAAAAAGTTGGTTGGCGCTTTATAAGAATAGACACTTCTTGTGTATGTACACTGACCATTAAAAGGGGAAGATAGTGAATTTATCTTGTATAGATTATATTGAGAAGAAAATATCTATTTGTATATATACATAACAGGGTAAATTATTC
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     388     137 
                                               BLH MIN     367      98 
                                               BLH MPR      19      98 
                                               BLH OVR     388     194 
                                               ORF LNG     388       9 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Bf ---- 4e-012     ABB51092.1 neurotrophin [Branchiostoma floridae] -------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                          PROTEIN --- Sp ---- 5e-014     NP_001073024.1 neurotrophin 5 [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Dr ==== 2e-103     NP_571670.2 brain-derived neurotrophic factor [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Gg ==== 2e-121     NP_001026787.1 brain-derived neurotrophic factor [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 1e-124     NP_031566.4 brain derived neurotrophic factor isoform 1 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 3e-126     NP_733927.1 brain-derived neurotrophic factor isoform b preproprotein [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 3e-137     ABK41483.1 brain derived neurotrophic factor [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 3e-141     ABN58533.1 brain-derived neurotrophic factor [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 3e-141     NP_001090767.1 brain-derived neurotrophic factor [Xenopus (Silurana) tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAL22699.5                    ATG---------------------------ATG------------------ATG---------------------------------TAA------TAG------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------TAG---------------------------------------------ATG---------------------TAA---------------------------ATG------------------ATG---------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------TAGTGA------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2       bld Brn4 PIPE in                        CAAL22699.5p CCCACTGAGTTACACTAGTATGAAATCTCTCTCTCTCCAACAAGATCAAATGGAGCCATTTAATGAAGAGATGCCATTGTGTCCACCATGCACCTTCCACTATCAATAATTTAAATAGCCCTCGCTGCAAGCCCCGAAGACCAAGCCTGAATATTTTTTTGGGTTTTTTTTCCCCCCCCCGTTGTTTATTGTTTGTAGCCTTTTTAATTTTTTTTTTTCCTGAGGACAGCTGGAAAGAAAACTTCACCCAAACAAACAAAACAAACCACAAAAAACTCCAACAAAATAGAATTTATACAGAGTTTCATCTGAGATCCCCAATACAAGTGTGTTGATGTGTTCTTTGACAAGTACTAACTAAAATAAGTTCCATCAGGTGAGAAGAGTGATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTCAGTTGCATGAAAGCTGCCCCCATGAAAGAAGCCAGTGTCAGAGGACAAAGTGGCCTGGCCTATCCGGGTCTTCGGACCCATGGTACTCTTGAGAGCATAGGTGGTCTCGGTGTCTCAAGAGGAGGAGGACTTCCTTCACTGACAGATACTTTTGAGCATGTCATAGAAGAACTCATGGAAGAGGAACAAAGCATACGACAGAGCGAGGAAAGCAAGGACTCTGACTTGTATTCATCTAGAGTTATGCTAAGCAGTCAAGTACCTTTGGAGCCACCACTGCTTTTCCTACTTGAGGAGTACAAAAACTACTTGGATGCTGCAAACATGTCCATGAGGGTCCGGCGCCACTCGGACCCAGCCAGGCGCGGAGAGCTGACCGTGTGTGACAGTATTAGCGAATGGGGTACAGCAG
  3   1   2      seed Brn4 PIPE in                        CAAL22699.3p                                                                                                                                                                                                                                                                                                                                                                        AAATAAGTTCCCATCAGGTGAGAAGAGTGATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTCAGTTGCATGAAAGCTGCCCCCATGAAAGAAGCCAGTGTCAGAGGACAAAGTGGCCTGGCCTATCCGGGTCTTCGGACCCATGGTACTCTTGAGAGCATAGGTGGTCTCGGTGTCTCAAGAGGAGGAGGACTTCCTTCACTGACAGATACTTTTGAGCATGTCATAGAAGAACTCATGGAAGAGGAACAAAGCATACGACAGAGCGAGGAAAGCAAGGACTCTGACTTGTATTCATCTAGAGTTATGCTAAGCAGTCAAGTACCTTTGGAGCCACCACTGCTTTTCCTACTTGAGGAGTACAAAAACTACTTGGATGCTGCAAACATGTCCATGAGGGTCCGGCGCCACTCGGACCCAGCCAGGCGCGGAGAGCTGAGCGTGTGTGACAGTATTAGCGAATGGGTTACAGCAGCAAACAAGAAAACTGCAGTGGACATGTCGGGGCAAACGGTTACTGTCCTCGAAAAAGTCCCCGTATCCAAAGGCCAACTGAAGCAATATTTCTACGAGACCAAATGTAACCCTATGGGTTACATGAAAGAAGGCTGCAGAGGCATAGACAAAAGGTACTGGAACTCTCAGTGCCGAACTACTCAGTCTTACGTGCGGGCTTTCACCATGGATAGCAAAAAAAAAGTTGGTTGGCGCTTTATAAGAATAGACACTTCTTGTGTATGTACACTGACCATTAAAAGGGGAAGATAGTGAATTTATCTTGTATAGATTATATTGAGAAGAAAATATCTATTTGTATATATACATAACAGGGTAAATTATTCCGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)