Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012109588 Xt7.1-CBTA2992.5 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBTA2992.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTGTGAGCAGCCCAGACCCAATCAGAGGAGAGGTAGTAAAAGCCTTTGTTGTCCTTGCTCCTGCTTATAACGGGCATGACCCTGAAAAACTGGCCCTGGAGCTACAGGAACATGTGAGAAACATAACAGCTCCATATAAATATCCAAGAAAGATAGAATTTGTTCAGCAATTACCCAAGACAGTCAGTGGCAAGATTCGAAGAAACGAGCTGAGAAACAGAGAGTGGGGAAATGTGTAGAATAATCGACAC
                                                  Xt7.1-CHK-1008255205                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAGCCCAGACCCAATCAGAGGAGAGGTAGTAAAAGCCTTTGTTGTCCTTGCTCCTGCTTATAACGGGCATGACCCTGAAAAACTGGCCCTGGAGCTACAGGAACATGTGAGAAACATAACAGCTCCATATAAATATCCAAGAAAGATAGAATTTGTTCAGCAATTACCCAAGACAGTCAGTGGCAAGATTCGAAGAAACGAGCTGAGAAACAGAGAGTGGGGAAATGTGTAGAATAATCGACACAAAAGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 3e-025     XP_001183409.1 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ===============================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 2e-029     NP_997606.2 SA hypertension-associated homolog [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Hs ---- 7e-031     NP_060358.2 hypothetical protein LOC54988 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 3e-031     XP_424596.2 PREDICTED: hypothetical protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-040     AAH75176.1 MGC82117 protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 1e-040     NP_001086370.1 MGC82117 protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================
                                                      Xt7.1-CBTA2992.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                       ]
  5   1   2      seed Panc      in                         CBTA2992.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTGTGAGCAGCCCAGACCCAATCAGAGGAGAGGTAGTAAAAGCCTTTGTTGTCCTTGCTCCTGCTTATAACGGGCATGACCCTGAAAAACTGGCCCTGGAGCTACAGGAACATGTGAGAAACATAACAGCTCCATATAAATATCCAAGAAAGATAGAATTTGTTCAGCAATTACCCAAGACAGTCAGTGGCAAGATTCGAAGAAACGAGCTGAGAAACAGAGAGTGGGGAAATGTGTAGAATAATCGACACAAAAGGGAAAAAAAAAAAAAAA
  3   1   2       bld Panc      in                         CBTA2992.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTGTGAGCAGCCCAGACCCAATCAGAGGAGAGGTAGTAAAAGCCTTTGTTGTCCTTGCTCCTGCTTATAACGGGCATGACCCTGAAAAACTGGCCCTGGAGCTACAGGAACATGTGAGAAACATAACAGCTCCATATAAATATCCAAGAAAGATAGAATTTGTTCAGCAATTACCCAAGACAGTCAGTGGCAAGATTCGAAGAAACGAGCTGAGAAACAGAGAGTGGGGAAATGTGTAGAATAATCGACACAAAAGGGAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)