Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT61326.5                            9 END     1          33       11                (no blast hit)
     2   2.0    0Xt7.1-st112c18.3                            2 END     1          33       50                MAP/microtubule affinity-regulating kinase 4; MAP/microtubuleaffinity-regulating kinase 4L; MARK4 serine/threonine protein kinase [Musmusculus]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 179.0    0Xt7.1-CAAR5633.5.5                         84 PI      76         30      348                mark2-prov protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012110336 Xt7.1-st112c18.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-st112c18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCATTGACAGACGCAGCTGAATCCCAGTAGTCTGCAAAAGCTATTTCGTGAGGTCCGAATCATGAAAGGACTTAATCATCCTAATATTGTGAAGCTGTTTGAAGTCATAGAAACTGAGAAAACGCTTTATCTCATCATGGAATACGCCAGTGGAGGTGAGGTATTTGACTATTTAGTGTCTCATGGACGTATGAAAGAGAAAGAGGCCCGTGCCAAATTCCGACAGATTGTCTCTGCAGTCCATTACTGTCATCAGAAGAACATAGTTCATCGGGATCTCAAGGCTGAGAATCTCCTTCTTGATTCAGAGTCTAATATAAAAATTGCAGACTTTGGATTCAGTAAT------------------------------------------------------------------------------------------------------------AGCCTGGGAGTTATCTTATACACATTGGTCAGTGGATCCCTGCCATTTGATGGGCAGAATCTTAAGGAACTGAGAGAGCGAGTTCTGCGTGGGAAATACAGAATTCCATTCTATATGAGCACAGACTGTGAGGGTGTTCTACGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGATGGGTCGCAGAAATACATATGTTTGCACAGATCGGCACAGCTCTGAAAGACATTCACTTCTCCATAATGACAAAGAGAAC
                                                  Xt7.1-CHK-1008247819                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGACAGACGCAGCTGAATCCCAGTAGTCTGCAAAAGCTATTTCGTGAGGTCCGAATCATGAAAGGACTTAATCATCCTAATATTGTGAAGCTGTTTGAAGTCATAGAAACTGAGAAAACGCTTTATCTCATCATGGAATACGCCAGTGGAGGTGAGGTATTTGACTATTTAGTGTCTCATGGACGTATGAAAGAGAAAGAGGCCCGTGCCAAATTCCGACAGATTGTCTCTGCAGTCCATTACTGTCATCAGAAGAACATAGTTCATCGGGATCTCAAGGCTGAGAATCTCCTTCTTGATTCAGAGTCTAATATAAAAATTGCAGACTTTGGATTCAGTAATGAGTTT------------------------------------------------------------------------------------------------------------GGAGTTATCTTATACACATTGGTCAGTGGATCCCTGCCATTTGATGGGCAGAATCTTAAGGAACTGAGAGAGCGAGTTCTGCGTGGGAAATACAGAATTCCATTCTATATGAGCACAGACTGTGAGGGTGTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACCAGGGTGATGGGTCGCAGAAATACATATGTTTGCACAGATCGGCACAGCTCTGAAAGACATTCACTTCTCCATAATGACAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     0     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                       ...PROTEIN --- Cs ---- 1e-010     BAB68344.1 EPH receptor tyrosine kinase [Ciona savignyi] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Bf ---- 1e-011     AAM18889.1 unknown [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                 PROTEIN --- Br ---- 4e-014     AAM92833.1 protein kinase C [Branchiostoma lanceolatum] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bb ---- 7e-017     BAA84741.1 src-like A-1 [Branchiostoma belcheri] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 3e-023     BAC57526.1 calmodulin-dependent protein kinase homologue [Ciona intestinalis] --------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Sc ---- 4e-035     NP_012821.1 Histone Synthetic Lethal Negative regulator of Swe1 kinase; Hsl1p [Saccharomycescerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 7e-073     NP_001041145.1 abnormal embryonic PARtitioning of cytoplasm family member (par-1) [Caenorhabditis elegans] ------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 2e-074     XP_796948.2 PREDICTED: similar to MAP/microtubule affinity-regulating kinase 3 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 1e-074     NP_995899.1 CG8201-PB, isoform B [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 6e-076     XP_690280.1 PREDICTED: similar to Serine/threonine-protein kinase MARK2 (MAP/microtubule affinity-regulating kinase 2) (ELKL motif kinase) (EMK1) (PAR1 homolog), partial [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Xt ---- 2e-076     NP_001025540.1 mark2-prov protein [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xl ---- 5e-077     AAO27567.1 Ser/Thr protein kinase PAR-1A [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- ?? ---- 5e-077     NP_001084256.1 Ser/Thr protein kinase PAR-1A [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Gg ---- 2e-077     XP_421385.2 PREDICTED: similar to MAP/microtubule affinity-regulating kinase 3 long isoform 2 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 6e-080     NP_758483.1 MAP/microtubule affinity-regulating kinase 4; MAP/microtubuleaffinity-regulating kinase 4L; MARK4 serine/threonine protein kinase [Musmusculus] --------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 4e-080     NP_113605.2 MAP/microtubule affinity-regulating kinase 4 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-st112c18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGA------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2       chi Gas8      out                        st112c18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCATTGACAGACGCAGCTGAATCCCAGTAGTCTGCAAAAGCTATTTCGTGAGGTCCGAATCATGAAAGGACTTAATCATCCTAATATTGTGAAGCTGTTTGAAGTCATAGAAACTGAGAAAACGCTTTATCTCATCATGGAATACGCCAGTGGAGGTGAGGTATTTGACTATTTAGTGTCTCATGGACGTATGAAAGAGAAAGAGGCCCGTGCCAAATTCCGACAGATTGTCTCTGCAGTCCATTACTGTCATCAGAAGAACATAGTTCATCGGGATCTCAAGGCTGAGAATCTCCTTCTTGATTCAGAGTCTAATATAAAAATTGCAGACTTTGGATTCAGTAATGAGTTTACTCCAGGTGGGAAATTGGACACTTTCTGCGGTAGCCCCCCTTACGCTGCCCCTGAACTCTTTCAGGGAAAAAGGTACAATGGACCTGAGGTGGATGTCTGGAGCCTGGGAGTTATCTTATACACATTGGTCAGTGGATCCCTGCCATTTGATGGGCAGAATCTTAAGGAACTGAGAGAGCGAGTTCTGCGTGGGAAATACAGAATTCCATTCTATATGAGCACAGACTGTGAGGGTGTTCTACGA
  5   1   2       bld Ski1      out                       CABJ10331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCCTGGGAGTTATCTTATACACATTGGTCAGTGGATCCCTGCCATTTGATGGGCAGAATCTTAAGGAACTGAGAGAGCGAGTTCTGCGTGGGAAATACAGAATTCCATTCTATATGAGCACAGACTGTGAGGGTGTTCTACGAAGATTCCTAGTGTTAAATCCAAGCAAGAGGTGCACTTTGGACCAAATAATGAATGACAAGTGGATGAATATTGGATTTGATAGTGATGATCTAAAGCCATATAAAGAACCAGAGGAGGACAATGCAGATCCCAAACGCATTGAGATTATGTTGGAAATGGGTTACTCACGTGAGGAGATTAAAGATGCTCTGAGCTCAAACAAGTACAATGAAGTGATGGCAACATACCTGCTGCTTGGAAGAAAGCCTGAGAGTGAAGGAGGAGAGTCTCGTTCAGACAGCACTCTTTCACTTTCTAGGTCCCGTGTTGCCTCAGATGTTACCAACGGTGCCACCAAGTCATCATCAGTACACAGCAAAAACCAGAGAGGCTATCAAAGGCAGAGAAGACACAGTGACTTCTGTGGTCCTGCCCCAGCTCCTTCACAGGCCAAGCGCAGCCCTCCTGGTGTAGGCGATGATGGTGCTGTTGGAGAACGTCTTGCCCCCCGGAGGGGCAGTGGATCAGTGGGTGGGGGCAGCCGGCCTCCCCCTCCCTCAAGTCCCATGGTCAGCCATGCCCACAACCCTAACAAGGCAGAGATTCCTGAGCCAAGAAAGGAGGCCCCACCAACAACTATTAATACTCCACCAGGNGTGATGGGTCGCAGAAATACATATGTTTGCACAGATCGGCACAGCTCTGAAAGACATTCACTTCTCCATAATGACAAAGAGAACAG
  5   1   2      seed Gas                            TGas026b13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACCAGGGTGATGGGTCGCAGAAATACATATGTTTGCACAGATCGGCACAGCTCTGAAAGACATTCACTTCTCCATAATGACAAAGAGAACAGCTCAACCCCATCTCGTCCACCTGCACTTTCACCATCCACACAGAGTATTGCAGAACGAAGCAGTCTTTCCAGGGGATCCAATGTTCGTAGCACTTTCCATGGGGGCCATGTGCGAGATCGGAGAGGCCAAAACCCACCCCCTAGTTCTCCAACCCACCCCCATGAAGGATTAAATCAAAGTCGGACCAGAGCCACATCAAACCTGTTTAGTAAACTGACCTCCAAACTGACCCGCAGGGTCACAGACGAATCTGAGAGAGTCTGGAGACCTGAGGTCACAGGTAGCTATATACCTTGGAATAAAACGTCGGCCAACTCCAGCCTGCTCAGACCTCCCAGGGATGTGAGAAGGTCAAGTCAGCACCCACCCTTGCAGCCAACAGAAACCTCCATTGCTCCCAACAGCCCTTCCTCAATAGGAAGGCCAAGCCCCCTACCAGGCAAGCTACGCCCACTTATCACTGTTGGGACAGTGGGACTTTAAGAAAGGGAGGTCTGCTCTGTGTGGAAATATACTGAGATGTTGTGACTCTTAATACTGAGACTGTATCCCTTCTAGGAATAATCATGCAGTCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)