Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012110571 Xt7.1-CAAO9581.3 - 2 ESTs
                                                                       ........-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAO9581.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGATACAAGTTTGCTGATANCAAATGGTCAGTCACGGGCAAGGCTGAACCTGCTATGCCAGGGCGGTTGTATGTTCATCCAGACTCACCAGCCACAGGCGCACACTGGATGAGGCAGCTAGTATCCTTCCAGAAGTTGAAGCTCACAAACAACCATCTGGATCCATTTGGACATATCATCCTGAATTCAATGCACAAGTACCAGCCACGGCTCCACATTGTTAAGGCAGATGAGAACAATGGTTTTGGGTCGAAGAATACAGCTTTCTGCACACACGTATTTTCTGAGACAGCTTTTATTGCCGTCACTTCATATCAGAACCACAAGATCACGCAGTTAAAGATAGAGAACAATCCATTTGCTAAAGGATTTCGGGGAAGTGATGACATGGAGCTACACCGAATGTCCAGGATGCAGAGCAAAGAGTACCCAGTGGTCCCAAGGAGCACAGTCCGTCAGAAGGTGTCATCTAACCACAGCCCATTCTCTCAAGAAACACGCAATATTACAGGATCCTCCACCCTAAATTCCCAGTACCAGTGTGAGAATGGGGTCAGTAGCACCTCCCAGGATCTGCTGCCAACTTCCAATGCATATCCTTCCCTGCCCCATGAGTCTGGACCCATATATCACTTGTGGCATGAAACTTTGACACCTGTTGAGAAGTGTATGTAGGTTATCTTCTTCAACAGCACCAGTTAAGCAATATTGTTCCTTCCTCCGTAGGCAGTAGCGGCGCTGTTTAAACTTCCACTTCCGCCCATGTGACTCGCACCAAGATGGCGGCACCCATGAGGAAAACGTGAATCGTGTTGGATTGTTATGCTACCAAATAACTTAGAAGCATGTCTCGGCTGATTGTGAAAAATCTCCCTAACGGGGTAAGAATGTGCCTACGAT
                                                  Xt7.1-CHK-1008261533                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGTTTGCTGATANCAAATGGTCAGTCACGGGCAAGGCTGAACCTGCTATGCCAGGGCGGTTGTATGTTCATCCAGACTCACCAGCCACAGGCGCACACTGGATGAGGCAGCTAGTATCCTTCCAGAAGTTGAAGCTCACAAACAACCATCTGGATCCATTTGGACATATCATCCTGAATTCAATGCACAAGTACCAGCCACGGCTCCACATTGTTAAGGCAGATGAGAACAATGGTTTTGGGTCGAAGAATACAGCTTTCTGCACACACGTATTTTCTGAGACAGCTTTTATTGCCGTCACTTCATATCAGAACCACAAGATCACGCAGTTAAAGATAGAGAACAATCCATTTGCTAAAGGATTTCGGGGAAGTGATGACATGGAGCTACACCGAATGTCCAGGATGCAGAGCAAAGAGTACCCAGTGGTCCCAAGGAGCACAGTCCGTCAGAAGGTGTCATCTAACCACAGCCCATTCTCTCAAGAAACACGCAATATTACAGGATCCTCCACCCTAAATTCCCAGTACCAGTGTGAGAATGGGGTCAGTAGCACCTCCCAGGATCTGCTGCCAACTTCCAATGCATATCCTTCCCTGCCCCATGAGTCTGGACCCATATATCACTTGTGGCATGAAACTTTGACACCTGTTGAGAAGTGTATGTAGGTTATCTTCTTCAACAGCACCAGTTAAGCAATATTGTTCCTTCCTCCGTAGGCAGTAGCGGCGCTGTTTAAACTTCCACTTCCGCCCATGTGACTCGCACCAAGATGGCGGCACCCATGAGGAAAACGTGAATCGTGTTGGATTGTTATGCTACCAAATAACTTAGAAGCATGTCTCGGCTGATTGTGAAAAATCTCCCTAACGGGGTAAGAATGTGCC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Cs ---- 1e-031     BAA92187.1 brachyury [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PROTEIN --- Bb ---- 1e-036     BAB63370.1 T-brain [Branchiostoma belcheri] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 2e-040     NP_511085.2 CG11202-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 1e-042     BAE06821.1 T-box transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 3e-042     NP_498088.1 T BoX family member (47.0 kD) (tbx-2) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 1e-045     XP_797010.2 PREDICTED: similar to T-box protein AmphiTbx6/16 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bf ---- 2e-055     AAG34889.1 T-box protein AmphiTbx4/5 [Branchiostoma floridae] =======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dr ---- 1e-101     NP_570990.1 T-box 5 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 1e-107     NP_035667.1 T-box 5 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 3e-109     NP_542448.1 T-box 5 isoform 3 [Homo sapiens] --------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Gg ---- 4e-110     NP_989504.1 T-box 5 [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xt ---- 4e-119     AAZ79652.1 T-box transcription factor 5 [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xl ---- 2e-119     AAD23592.1 T-box transcription factor Tbx5 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- ?? ---- 2e-119     NP_001079170.1 T-box transcription factor Tbx5 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAO9581.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAG------------------------TAA---------------------TAG------------------------------------ATGTGA------------------------TGA---------------------------ATG------------------------------TGA---TGA------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  3   1   2      seed Te5       out                        CAAO9581.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGATACAAGTTTGCTGATANCAAATGGTCAGTCACGGGCAAGGCTGAACCTGCTATGCCAGGGCGGTTGTATGTTCATCCAGACTCACCAGCCACAGGCGCACACTGGATGAGGCAGCTAGTATCCTTCCAGAAGTTGAAGCTCACAAACAACCATCTGGATCCATTTGGACATATCATCCTGAATTCAATGCACAAGTACCAGCCACGGCTCCACATTGTTAAGGCAGATGAGAACAATGGTTTTGGGTCGAAGAATACAGCTTTCTGCACACACGTATTTTCTGAGACAGCTTTTATTGCCGTCACTTCATATCAGAACCACAAGATCACGCAGTTAAAGATAGAGAACAATCCATTTGCTAAAGGATTTCGGGGAAGTGATGACATGGAGCTACACCGAATGTCCAGGATGCAGAGCAAAGAGTACCCAGTGGTCCCAAGGAGCACAGTCCGTCAGAAGGTGTCATCTAACCACAGCCCATTCTCTCAAGAAACACGCAATATTACAGGATCCTCCACCCTAAATTCCCAGTACCAGTGTGAGAATGGGGTCAGTAGCACCTCCCAGGATCTGCTGCCAACTTCCAATGCATATCCTTCCCTGCCCCATGAGTCTGGACCCATATATCACTGCACAAAGAGAAAAGGTAAGCATGTAAGATTGAGTTTAATGCAGTGTGCATGTTCAGTACTAAAACAGAAAAAGGACCCATTTCCTTCAGGATCAACTCTGTGTTATTACAATTTCTTTTACTTTACAGTGAAAGTTTTGGCTTTTTTTTATCCTCCTCCTCAAAAAGTATGAACTCCTTTGCTTTAGACAACAATGCAATATGATTGAGTATCATATATTAAATTACATTTTGCTTGG
  5  -1   2       bld Te1       out                        CBWN3916.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTATTTGCATTAACCCTCCCTCCACCGTGCTGCAAGTGACCTGTGTGGATTTGGACTTTTTTTATCTAAAAATTTACAGTCAAAATAGGAAAGCAAAAAATAATAAAGAAGATTGATAGCCTAACAGAATGCAGAATACTTCTCATTCAATTTTGTCATTGACCTATAATATTAACTACAATATGTACTACACACTCCAGATATCTGTAAACATTGTTATTATAAAGTTCTTAACACTCAATAACTAAATTTTGTCCTTTCTTTAGCAAAGAGTACCCAGTGGTCCCAAGGAGCACAGTCCGTCAGAAGGTGTCATCTAACCACAGCCCATTCTCTCAAGAAACACGCAATATTACAGGATCCTCCACCCTAAATTCCCAGTACCAGTGTGAGAATGGGGTCAGTAGCACCTCCCAGGATCTGCTGCCAACTTCCAATGCATATCCTTCCCTGCCCCATGAGTCTGGACCCATATATCACTTGTGGCATGAAACTTTGACACCTGTTGAGAAGTGTATGTAGGTTATCTTCTTCAACAGCACCAGTTAAGCAATATTGTTCCTTCCTCCGTAGGCAGTAGCGGCGCTGTTTAAACTTCCACTTCCGCCCATGTGACTCGCACCAAGATGGCGGCACCCATGAGGAAAACGTGAATCGTGTTGGATTGTTATGCTACCAAATAACTTAGAAGCATGTCTCGGCTGATTGTGAAAAATCTCCCTAACGGGGTAAGAATGTGCCTACGATTAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)