Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012110595 Xt7.1-CBXT6892.3 - 3 ESTs
                                                                       ......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBXT6892.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAAACACTTGGACTGGTATTGGGAGACACTGGTTATCGACAATGCTGGAAATGCTAGACTATAACCATTACCAGGTGCAGACCCACCTTGAAAATCCTACCAAGTACCACATCCAACAAGCCCAGAAACAGCAGATGGATGATGTGATTGATGATATAATAAGCTTGGAGTCCAGTTATAACGAAGACATTCTCTTGATGGATCCTTCTATGCAAATGGCAAACACGCTGCCTGTCTCTGGTAATATGATTGACATTTATGGAAATCAAGAATCGGAGGCAAGAGCGTTGGCCAAGGAAAGGCAAAAGAAGGACAATCACAACCTCATTGAAAGAAGGCGAAGATTTAACATCAATGATCGCATTAAAGAATTAGGAACTCTAATACCCAAATCGAACGATCCTGACATGAGGTGGAACAAGGGAACGATATTAAAAGCCTCGGTGGATTACATTCGCAAACTGCAACGAGAACAGCAGCGGTCAAAGGAGGTCGAGAACAAGCAGAAGAAACTGGAGCACGCCAACCGCCATCTGCTCCTGAGGATACAGGAGCTAGAGATGCAAGCTCGCGCACATGGCCTTTCCATTATGCCTTCTACTGGCCTCTGCTCAACAGACCTTGTCAACAGAGTCATCAAACAGGAGCCAATGCTCGACAGTTGCAATCAGGAGATTCTGTCAAACCACCACGACCTTTCCGGCACAACCACTCTGGATCTCACTGATGGAACCATTACTTTCAGCAATAACCTGAGGAACATGACTGACTCCCCAACAGCCTACAGCATCCCCACCAAGCTGGGCTCTAAACTGGAAGACATGTTTATGGACGATACACTTTCTCCAAGAGTAAATGATCCACATCACACCATATCTCCTGGGGCCTCCAGAACAAACAGCAGAAGAAGCAGCATCAGCATGGAAGAAAACGACCACTGTTAGCACAAGCTACAGGACATGCTCTTACAAACTGTAATACTTTTATTGTTTCAGAGCGGTAGATAACTATACTTCTAGCTTTCTGGATAGCTCACTTTCATAGAAACTTTGTTGTGTTCGCCCTATAGGCCAGCACTTATATATATTTTATTTTTTTTAGACTTTTGTAAAGATTTTTTTGGTGTATATCATGACTTCGGTTTGCCTCCAAAGTATTATGAGAAAATGGCTGGTGCATCCTCGGGCGAGCGGAGATTGTCTAACGTGTTTAAACCAGGTTCCCTCCACCACAACCATACTGTCAAGATATTCCGGCTTATCTTTCAACAGACCGCGTATCTCTGTCCTGTGGAAATAACGGCACGGAAACAAGTATGAGATGGGAAGTACGTCGAATACCTCAACCCATTTGGGTGGTCCGGTCCTAAGAAAATGGCTATGCAAGACTCTGAGAATATTTTTGAAGATAAGACAAGGAAGGGCCCTCAATCAAGTTTTTTTTTCTGGGCCCCTTGGTTTCTATCGAATTGCATTTCGAGTAAAATGAAAAAGTTTTTTGGCTAATCTTTAAAGGATCAAAAGAAGAGAACACAAAGAATAAAAATCAAATACAATAAATAAAAAGCAAAATACAAAAACAGGAAAAGTAGATGAAAAAGAGGCTG
                                                  Xt7.1-CHK-1008248200                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACTTGGACTGGTATTGGGAGACACTGGTTATCGACAATGCTGGAAATGCTAGACTATAACCATTACCAGGTGCAGACCCACCTTGAAAATCCTACCAAGTACCACATCCAACAAGCCCAGAAACAGCAGATGGATGATGTGATTGATGATATAATAAGCTTGGAGTCCAGTTATAACGAAGACATTCTCTTGATGGATCCTTCTATGCAAATGGCAAACACGCTGCCTGTCTCTGGTAATATGATTGACATTTATGGAAATCAAGAATCGGAGGCAAGAGCGTTGGCCAAGGAAAGGCAAAAGAAGGACAATCACAACCTCATTGAAAGAAGGCGAAGATTTAACATCAATGATCGCATTAAAGAATTAGGAACTCTAATACCCAAATCGAACGATCCTGACATGAGGTGGAACAAGGGAACGATATTAAAAGCCTCGGTGGATTACATTCGCAAACTGCAACGAGAACAGCAGCGGTCAAAGGAGGTCGAGAACAAGCAGAAGAAACTGGAGCACGCCAACCGCCATCTGCTCCTGAGGATACAGGAGCTAGAGATGCAAGCTCGCGCACATGGCCTTTCCATTATGCCTTCTACTGGCCTCTGCTCAACAGACCTTGTCAACAGAGTCATCAAACAGGAGCCAATGCTCGACAGTTGCAATCAGGAGATTCTGTCAAACCACCACGACCTTTCCGGCACAACCACTCTGGATCTCACTGATGGAACCATTACTTTCAGCAATAACCTGAGGAACATGACTGACTCCCCAACAGCCTACAGCATCCCCACCAAGCTGGGCTCTAAACTGGAAGACATGTTTATGGACGATACACTTTCTCCAAGAGTAAATGATCCACATCACACCATATCTCCTGGGGCCTCCAGAACAAACAGCAGAAGAAGCAGCATCAGCATGGAAGAAAACGACCACTGTTAGCACAAGCTACAGGACATGCTCTTACAAACTGTAATACTTTTATTGTTTCAGAGCGGTAGATAACTATACTTCTAGCTTTCTGGATAGCTCACTTTCATAGAAACTTTGTTGTGTTCGCCCTATAGGCCAGCACTTATATATATTTTATTTTTTTTAGACTTTTGTAAAGATTTTTTTGGTGTATATCATGACTTxGxTTxGCCTCCAAAGTATTATGAGAAAATGGCTGGTGCATCCTCGGGCGAGCGGAGATTGTCTAACGTGTTTAAACCAGGTTCCCTCCACCACAACCATACTGTCAAGATATTCCGGCTTATCTTTCAACAGACCGCGTATCTCTGTCCTGTGGAAATAACGGCACGGAAACAAGTATGAGATGGGAAGTACGTCGAATACCTCAACCCATTTGGGTGGTCCGGTCCTAAGAAAATGGCTATGCAAGACTCTGAGAATATTTTTGAAGATAAGACAAGGAAGGGCCCTCAATCAAGTTTTTTTTTCTGGGCCCCTTGGTTTCTATCGAATTGCATTTCGAGTAAAATGAAAAAGTTTTTTGGCTAATCTTTAAAGGATCAAAAGAAGAGAACACAAAGAATAAAAATCAAATACAATAAATAAAAAGCAAAATACAAAAACAGGAAAAGTAGATGAAAAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN      34     113                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                         PROTEIN --- Bb ---- 3e-007     BAD93381.1 Myc [Branchiostoma belcheri] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN --- Sc ---- 9e-008     NP_009447.1 Basic helix-loop-helix-leucine zipper (bHLH/Zip) transcription factor that forms a complex with another bHLH/Zip protein, Rtg1p, to activate the retrograde (RTG) and TOR pathways [Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 5e-026     NP_001023416.1 W02C12.3h [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 4e-032     NP_001015077.1 CG17469-PA.3 [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 3e-039     BAE06557.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 3e-043     XP_783071.2 PREDICTED: similar to IGHM enhancer 3a-binding transcription factor [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Dr ==== 2e-080     NP_570998.1 microphthalmia-associated transcription factor a [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 5e-116     NP_032627.1 microphthalmia-associated transcription factor [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Hs ---- 1e-120     NP_937801.1 microphthalmia-associated transcription factor isoform 5 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Gg ---- 5e-122     NP_990360.1 Mitf [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xt ---- 5e-154     AAI35969.1 Unknown (protein for MGC:122210) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- ?? ---- 5e-154     NP_001093747.1 microphthalmia-associated transcription factor [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 4e-154     BAD08295.1 micophthalmia-associated transcription factor type M [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBXT6892.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------ATG---ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------ATG------------------TAG---------------ATG------------------------------------------TAA---------TAG---------TAG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------ATG---------------TAA------------------------------------------------------TAA------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
  5   1   2       bld Tbd1      in                         CBXT6892.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAAAACACTTGGACTGGTATTGGGAGACACTGGTTATCGACAATGCTGGAAATGCTAGACTATAACCATTACCAGGTGCAGACCCACCTTGAAAATCCTACCAAGTACCACATCCAACAAGCCCAGAAACAGCAGATGGATGATGTGATTGATGATATAATAAGCTTGGAGTCCAGTTATAACGAAGACATTCTCTTGATGGATCCTTCTATGCAAATGGCAAACACGCTGCCTGTCTCTGGTAATATGATTGACATTTATGGAAATCAAGAATCGGAGGCAAGAGCGTTGGCCAAGGAAAGGCAAAAGAAGGACAATCACAACCTCATTGAAAGAAGGCGAAGATTTAACATCAATGATCGCATTAAAGAATTAGGAACTCTAATACCCAAATCGAACGATCCTGACATGAGGTGGAACAAGGGAACGATATTAAAAGCCTCGGTGGATTACATTCGCAAACTGCAACGAGAACAGCAGCGGTCAAAGGAGGTCGAGAACAAGCAGAAGAAACTGGAGCACGCCAACCGCCATCTGCTCCTGAGGATACAGGAGCTAGAGATGCAAGCTCGCGCACATGGCCTTTCCATTATGCCTTCTACTGGCCTCTGCTCAACAGACCTTGTCAACAGAGTCATCAAACAGGAGCCAATGCTCGACAGTTGCAATCAGGAGATTCTGTCAAACCACCACGACCTTTCCGGCACAACCACTCTGGATCTCACTGATGGAACCATTACTTTCAGCAATAACCTGAGGAACATGA
  3   1   2      seed Tbd1      in                         CBXT6892.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCAAGCTCGCGCACATGGCCTTTCCATTATGCCTTCTACTGGCCTCTGCTCAACAGACCTTGTCAACAGAGTCATCAAACAGGAGCCAATGCTCGACAGTTGCAATCAGGAGATTCTGTCAAACCACCACGACCTTTCCGGCACAACCACTCTGGATCTCACTGATGGAACCATTACTTTCAGCAATAACCTGAGGAACATGACTGACTCCCCAACAGCCTACAGCATCCCCACCAAGCTGGGCTCTAAACTGGAAGACATGTTTATGGACGATACACTTTCTCCAAGAGTAAATGATCCACATCACACCATATCTCCTGGGGCCTCCAGAACAAACAGCAGAAGAAGCAGCATCAGCATGGAAGAAAACGACCACTGTTAGCACAAGCTACAGGACATGCTCTTACAAACTGTAATACTTTTATTGTTTCAGAGCGGTAGATAACTATACTTCTAGCTTTCTGGATAGCTCACTTTCATAGAAACTTTGTTGTGTTCGCCCTATAGGCCAGCACTTATATATATTTTATTTTTTTTAGACTTTTGTAAAGATTTTTTTGGTGTATATCATGACTTGGTTTGCCTCCAAAGTATTTTGAGAAACTGCTTTGTACATACCTGGACTAACGGAGAATGTCAAACCTATTTAAAGCAGCTTCCCTCCACCACAACCATACTGTCAAGATATTCAGGTTAATCTCTCAACAGACCGCGTCTCATTGTCATATGGAAATAAAGGCACAGAAACAAGCAAAAAAAAAAAAAAA
  3   1   1       add TbA       out                   TTbA034e11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTTAGCACAAGATACAGGACATGCTTTTTCAAACTGTAATACTTTTATTGTTTCAGAGCGGTAGATAACTATACCTCTCGCTTTGTGGATAGCTCACTTTCATAGAAACTTTGTTGTGTTCGCCCTATCGGCCAGCAGCTGGTATATTTTTTATTTTTTTTAGACTTTTGTAAAGATTTTTTTGGTGTATATCAGGACTCGGTTTGCCTCCAAAGTATTATGAGAAAATGGCTGGTGCATCCTCGGGCGAGCGGAGATTGTCTAACGTGTTTAAACCAGGTTCCCTCCACCACAACCATACTGTCAAGATATTCCGGCTTATCTTTCAACAGACCGCGTATCTCTGTCCTGTGGAAATAACGGCACGGAAACAAGTATGAGATGGGAAGTACGTCGAATACCTCAACCCATTTGGGTGGTCCGGTCCTAAGAAAATGGCTATGCAAGACTCTGAGAATATTTTTGAAGATAAGACAAGGAAGGGCCCTCAATCAAGTTTTTTTTTCTGGGCCCCTTGGTTTCTATCGAATTGCATTTCGAGTAAAATGAAAAAGTTTTTTGGCTAATCTTTAAAGGATCAAAAGAAGAGAACACAAAGAATAAAAATCAAATACAATAAATAAAAAGCAAAATACAAAAACAGGAAAAGTAGATGAAAAAGAGGCTGACTTGAAAAAAAAAAAAAAAAAAGCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)