Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK3553.3.5                         22 END     1          50        4                (no blast hit)
     2   2.0    0Xt7.1-CAAQ7133.3                            3 END     1          50       33                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012111889 Xt7.1-CAAK1870.5 - 2 ESTs
                                                                       .-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK1870.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATCAGTTGGGTGCTGAAGCAGGGAAGGAGGAGGGAGCGGGGAGCATCGGGCTCTTGTGGCAGCGCACTTACATTGGCCTGAGGGAGGGGTCCCCCTTCATGGCGAGGAGGGTCCCTTATTGCGGAAGCTGCCAGCTTGCTGCGTAACAGGTAGAGAGGGATCGTGATCTGGGGGAGCGGGATTTACCTGCGGCTGGATGTGCGCCCTGGGCTAGTGGCTCTGTCAGCATGAGTGCCGTATCCCAGCACCAAGCTGTCCAGAGCCCCCTGGATAAGCCCTCGGGAAATGCCATCCTCTGCAACAACTGTGGCAATGCCTGTAAGGGAGAGGTGCTGCGGGTGCAAAACAGATATTTCCATATTAAATGTTTCGTATGTAAAGTGTGCGGCTGTGACCTGGCCCAGGGAGGCTTCTTTGTCAGACAAGGAGATTATGTTTGTACTCAGGACTACCAGCGACTGTATGGAACCCGGTGCTTCAGCTGTGATGAATTCATTGAGGGAGAAGTTGTTTCTGCCCTAGGGAAAACCTACCACCCCGGCTGTTTTGTATGTGCGGTATGTAGGAACCCTTTCCCCCCCGGTGACCGTGTCACTTTCAACGGCAAGGAGTGCATCTGCCAAAAATGTACCATGTCTCCGACTGCCGGAAGCGGCAACTTCTGCATCCAGGCGCTCCGAAATTGCGGCGGTTGTGGCTTGGAAATAAAGAATGGCCAGTCACTGGTAGCACTGGAAAAGCACTGGCATTTGGGATGTTTCAAATGCAAAACCTGTGGCATGCCTCTGAAAGCAGAGTATATCAGCAAAGATGGGATTCCATATTGTGAAACAGACTATCACGCTAAATTTGGCATAAAATGTGACCACTGTGAGAAATTCATCACAGGCCGAGTGTTGGAGGCTGGAGAAAAGCACTATCACCCAACGTGTGCGTGCTGTGTCCGCTGCAGCCAGATGTTTGCAGAAGGCGAGGAGATGTACCTGCAAGGAAACTCAATATGGCACCCCATATGTAGGCAGGCGGCCAAAACAGAGGAAAGGAATAAGGAGACAAGAACATCCTCAGAGAGCATCATTTCAGTACCTGCATCAAGCACATCAGGATCCCCGAGCAGAGTTATTTATGCCAAACTCGGGGATGAAATTCTTGACTACAAGGATTTGGCGGCCCTGCCTAAAAATAAAGCCATCTATAATATTGACCGTCCTGATATGATCTCCTACTCTCCATATATCAGTTACTCTGCAGATGACAGACATAGTTATGGGGAGGGAGACCAAGATGATCGGTCACTTAAACAGTACAGAGCTTCCAGCCCCAGCTCGACTGGATCTTTAGGGTATGGTCGTTATACCCCCACCTCCCATTCTCCGCAGCATTGCAGCAGAACAGGCAGTGAAAGTGGCCGCAGCACGCCCAGTCTATCCATGTGCTCA
                                                  Xt7.1-CHK-1008257833                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGGGTGCTGAAGCAGGGAAGGAGGAGGGAGCGGGGAGCATCGGGCTCTTGTGGCAGCGCACTTACATTGGCCTGAGGGAGGGGTCCCCCTTCATGGCGAGGAGGGTCCCTTATTGCGGAAGCTGCCAGCTTGCTGCGTAACAGGTAGAGAGGGATCGTGATCTGGGGGAGCGGGATTTACCTGCGGCTGGATGTGCGCCCTGGGCTAGTGGCTCTGTCAGCATGAGTGCCGTATCCCAGCACCAAGCTGTCCAGAGCCCCCTGGATAAGCCCTCGGGAAATGCCATCCTCTGCAACAACTGTGGCAATGCCTGTAAGGGAGAGGTGCTGCGGGTGCAAAACAGATATTTCCATATTAAATGTTTCGTATGTAAAGTGTGCGGCTGTGACCTGGCCCAGGGAGGCTTCTTTGTCAGACAAGGAGATTATGTTTGTACTCAGGACTACCAGCGACTGTATGGAACCCGGTGCTTCAGCTGTGATGAATTCATTGAGGGAGAAGTTGTTTCTGCCCTAGGGAAAACCTACCACCCCGGCTGTTTTGTATGTGCGGTATGTAGGAACCCTTTCCCCCCCGGTGACCGTGTCACTTTCAACGGCAAGGAGTGCATCTGCCAAAAATGTACCATGTCTCCGACTGCCGGAAGCGGCAACTTCTGCATCCAGGCGCTCCGAAATTGCGGCGGTTGTGGCTTGGAAATAAAGAATGGCCAGTCACTGGTAGCACTGGAAAAGCACTGGCATTTGGGATGTTTCAAATGCAAAACCTGTGGCATGCCTCTGAAAGCAGAGTATATCAGCAAAGATGGGATTCCATATTGTGAAACAGACTATCACGCTAAATTTGGCATAAAATGTGACCACTGTGAGAAATTCATCACAGGCCGAGTGTTGGAGGCTGGAGAAAAGCACTATCACCCAACGTGTGCGTGCTGTGTCCGCTGCAGCCAGATGTTTGCAGAAGGCGAGGAGATGTACCTGCAAGGAAACTCAATATGGCACCCCATATGTAGGCAGGCGGCCAAAACAGAGGAAAGGAATAAGGAGACAAGAACATCCTCAGAGAGCATCATTTCAGTACCTGCATCAAGCACATCAGGATCCCCGAGCAGAGTTATTTATGCCAAACTCGGGGATGAAATTCTTGACTACAAGGATTTGGCGGCCCTGCCTAAAAATAAAGCCATCTATAATATTGACCGTCCTGATATGATCTCCTACTCTCCATATATCAGTTACTCTGCAGATGACAGACATAGTTATGGGGAGGGAGACCAAGATGATCGGTCACTTAAACAGTACAGAGCTTCCAGCCCCAGCTCGACTGGATCTTTAGGGTATGGTCGTTATACCCCCACCTCCCATTCTCCGCAGCATTGCAGCAGAACAGGCAGTGAAAGTGGCCGCAGCACGCCCAGTCTATCCATGTGCTCAGACAGC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     228     271                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MIN     228     197                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH OVR     228     242                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               ORF LNG     228      19                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                                                       PROTEIN --- Sc ---- 7e-009     NP_013016.1 Paxillin-like protein 1; Ykr090wp [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Cs ---- 1e-013     BAB68342.1 Cs-LHX3 [Ciona savignyi] --------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bb ---- 7e-018     BAB91364.1 LIM homeodomain protein [Branchiostoma belcheri] -----------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ---- 2e-021     BAE06429.1 Ci-Fhl1/2/3 [Ciona intestinalis] ---------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bf ---- 3e-022     AAC69756.1 LIM-domain protein [Branchiostoma floridae] ----------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Sp ==== 4e-038     XP_784724.2 PREDICTED: similar to CG31332-PD, partial [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ==== 3e-046     NP_509702.3 UNCoordinated family member (unc-115) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ==== 8e-074     NP_649930.4 CG31352-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Dr ---- 8e-135     NP_001014385.1 hypothetical LOC541550 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Hs ==== 0          NP_115808.2 actin binding LIM protein family, member 2 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 0          NP_808346.3 actin-binding LIM protein 2 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Gg ==== 0          XP_420811.2 PREDICTED: similar to actin binding LIM protein family member 2 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 0          AAH81248.1 MGC86228 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === ?? ==== 0          NP_001087805.1 MGC86228 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK1870.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG------------------------------------------TAA---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2   10  bld Te1  5g3  out                        CBWN8170.b1 .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATCAGTTGGGTGCTGAAGCAGGGAAGGAGGAGGGAGCGGGGAGCATCGGGCTCTTGTGGCAGCGCACTTACATTGGCCTGAGGGAGGGGTCCCCCTTCATGGCGAGGAGGGTCCCTTATTGCGGAAGCTGCCAGCTTGCTGCGTAACAGGTAGAGAGGGATCGTGATCTGGGGGAGCGGGATTTACCTGCGGCTGGATGTGCGCCCTGGGCTAGTGGCTCTGTCAGCATGAGTGCCGTATCCCAGCACCAAGCTGTCCAGAGCCCCCTGGATAAGCCCTCGGGAAATGCCATCCTCTGCAACAACTGTGGCAATGCCTGTAAGGGAGAGGTGCTGCGGGTGCAAAACAGATATTTCCATATTAAATGTTTCGTATGTAAAGTGTGCGGCTGTGACCTGGCCCAGGGAGGCTTCTTTGTCAGACAAGGAGATTATGTTTGTACTCAGGACTACCAGCGACTGTATGGAACCCGGTGCTTCAGCTGTGATGAATTCATTGAGGGAGAAGTTGTTTCTGCCCTAGGGAAAACCTACCACCCCGGCTGTTTTGTATGTGCGGTATGTAGGAACCCTTTCCCCCCCGGTGACCGTGTCACTTTCAACGGCAAGGAGTGCATCTGCCAAAAATGTACCATGTCTCCGACTGCCGGAAGCGGCAACTTCTGCATCCAGGCGCTCCGAAATTGCGGCGGTTGTGGCTTGGAAT
  5   1   2      seed Brn3      out                        CAAK1870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGTGTCACTTTCAACGGCAAGGAGTGCATCTGCCAAAAATGTACCATGTCTCCGACTGCCGGAAGCGGCAACTTCTGCATCCAGGCGCTCCGAAATTGCGGCGGTTGTGGCTTGGAAATAAAGAATGGCCAGTCACTGGTAGCACTGGAAAAGCACTGGCATTTGGGATGTTTCAAATGCAAAACCTGTGGCATGCCTCTGAAAGCAGAGTATATCAGCAAAGATGGGATTCCATATTGTGAAACAGACTATCACGCTAAATTTGGCATAAAATGTGACCACTGTGAGAAATTCATCACAGGCCGAGTGTTGGAGGCTGGAGAAAAGCACTATCACCCAACGTGTGCGTGCTGTGTCCGCTGCAGCCAGATGTTTGCAGAAGGCGAGGAGATGTACCTGCAAGGAAACTCAATATGGCACCCCATATGTAGGCAGGCGGCCAAAACAGAGGAAAGGAATAAGGAGACAAGAACATCCTCAGAGAGCATCATTTCAGTACCTGCATCAAGCACATCAGGATCCCCGAGCAGAGTTATTTATGCCAAACTCGGGGATGAAATTCTTGACTACAAGGATTTGGCGGCCCTGCCTAAAAATAAAGCCATCTATAATATTGACCGTCCTGATATGATCTCCTACTCTCCATATATCAGTTACTCTGCAGATGACAGACATAGTTATGGGGAGGGAGACCAAGATGATCGGTCACTTAAACAGTACAGAGCTTCCAGCCCCAGCTCGACTGGATCTTTAGGGTATGGTCGTTATACCCCCACCTCCCATTCTCCGCAGCATTGCAGCAGAACAGGCAGTGAAAGTGGCCGCAGCACGCCCAGTCTATCCATGTGCTCAGACAGCAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)