Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAQ7590.3                           65 END     1          50        1                Unknown (protein for MGC:154421) [Xenopus laevis]
     2   2.0    0Xt7.1-THdA046c05.3                          4 END     1          50       25                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012111966 Xt7.1-TTbA047m23.5 - 2 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA047m23.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAAGTCGGGGTCCCAAGCGAATAAGCTCATGCACCTGCACAACAGCGAAGTGGGGAGACAGGTGCTAAAGGCCTCGCTGGAGATGAAATGCAAGTGTCATGGCGTCTCGGGATCTTGTTCCATAAAGACCTGTTGGCGGGGGCTGCAAGAGCTCCGGGAGATTGCGCTGGACCTCAAAACTAAATATCTGTCAGCCACCAAGGTGGTGCATAGGCCCATGGGTACCCGCAAGCAGCTGGTCCCCAAGGACATCGACATTCGGCCGGTGCAGGAAACAGAAATGATTTATCTACAGAGCTCCCCGGACTATTGCTTGAAAAATGAAAAGATGGGATCTCACGGGACCCACGAGAGGCAGTGCAATAAGACGTCCAACGGCAGCGACAGTTGCGACCTAATGTGCTGTGGGCGGGGCTACAACCCCTACATGGACAAAGTGGTGGAGAGATGCCACTGTAAGTACCACTGGTGTTGCTACGTGACCTGCAAAAAATGTGAAAGGACTGTGGAGCGGTATGTGTGTAAATGAGGTGCCCCGGGGGGCCCCCGCTCTGCCTGGAGGAGCGCTAATAAACACCCCAACAAAGCACCGTCCGTCCTTGGAAGAGGCCTTCTTCAGGATTCCTTCCCGGCGAGCTGGTGAGCCATGGAGGCAATAAGCAACTTCCATCCCCAAGTCCTACGGTTCATCTGCCCAAGGATTGTGTTTTGTACTTGTATCATTAGGTGCCAAATGCCATAAAAAAAGACTAAAAAATATCAAAATGGAGGTTAAAGTGGACCTTGAAGGACCTGCTGGTAGGAGAAGGAGAAGAAGGGAACCAATTGTTTTTGGACTGAACCCTCGTATCTAGGTGGGTCAGGCCTTGATGGATCCAGGCGTGTTTTGCCTTTGCCAATACAATTGTATCATGTGATCTATTCCGGATGATGTCATAGCATGATGTCATGGAGAGAACGACTCACATAAGGATGGCCAATCATTTCAACGCAGCCATATTGTAAATAAAGGTCCTCTTGGGTGACCCAAAAGGGACAAACTGATCTTCCCAAATCCCGGACTGGCTGTTCCAACTGGAAAATCCTCATGGAGTAAAGAGTTAATAATTCTCATTACATCAACTGTGTTTACATTCTGGGGAATTTCATCCAGACCCCCCCC
                                                  Xt7.1-CHK-1008260429                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGGGGTCCCAAGCGAATAAGCTCATGCACCTGCACAACAGCGAAGTGGGGAGACAGGTGCTAAAGGCCTCGCTGGAGATGAAATGCAAGTGTCATGGCGTCTCGGGATCTTGTTCCATAAAGACCTGTTGGCGGGGGCTGCAAGAGCTCCGGGAGATTGCGCTGGACCTCAAAACTAAATATCTGTCAGCCACCAAGGTGGTGCATAGGCCCATGGGTACCCGCAAGCAGCTGGTCCCCAAGGACATCGACATTCGGCCGGTGCAGGAAACAGAAATGATTTATCTACAGAGCTCCCCGGACTATTGCTTGAAAAATGAAAAGATGGGATCTCACGGGACCCACGAGAGGCAGTGCAATAAGACGTCCAACGGCAGCGACAGTTGCGACCTAATGTGCTGTGGGCGGGGCTACAACCCCTACATGGACAAAGTGGTGGAGAGATGCCACTGTAAGTACCACTGGTGTTGCTACGTGACCTGCAAAAAATGTGAAAGGACTGTGGAGCGGTATGTGTGTAAATGAGGTGCCCCGGGGGGCCCCCGCTCTGCCTGGAGGAGCGCTAATAAACACCCCAACAAAGCACCGTCCGTCCTTGGAAGAGGCCTTCTTCAGGATTCCTTCCCGGCGAGCTGGTGAGCCATGGAGGCAATAAGCAACTTCCATCCCCAAGTCCTACGGTTCATCTGCCCAAGGATTGTGTTTTGTACTTGTATCATTAGGTGCCAAATGCCATAAAAAAAGACTAAAAAATATCAAAATGGAGGTTAAAGTGGACCTTGAAGGACCTGCTGGTAGGAGAAGGAGAAGAAGGGAACCAATTGTTTTTGGACTGAACCCTCGTATCTAGGTGGGTCAGGCCTTGATGGATCCAGGCGTGTTTTGCCTTTGCCAATACAATTGTATCATGTGATCTATTCCGGATGATGTCATAGCATGATGTCATGGAGAGAACGACTCACATAAGGATGGCCAATCATTTCAACGCAGCCATATTGTAAATAAAGGTCCTCTTGGGTGACCCAAAAGGGACAAACTGATCTTCCCAAATCCCGGACTGGCTGTTCCAACTGGAAAATCCTCATGGAGTAAAGAGTTAATAATTCTCATTACATCAACTGTGTTTACATTCTGGGGAATTTCATCCAGACCCCCCCCCCCCCC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 1e-038     NP_501822.1 C. elegans WNT family CWN-2 (40.4 kD) (cwn-2) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bb ---- 9e-044     AAF19839.1 secreted protein Wnt7 [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-042     NP_476924.1 Wnt oncogene analog 5 CG6407-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 4e-046     AAD52655.1 Wnt-5 protein precursor [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 8e-054     XP_786346.2 PREDICTED: similar to Wnt-4 protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Bf ---- 2e-059     AAF80555.1 Wnt11 [Branchiostoma floridae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 1e-078     CAJ82831.1 wingless-type MMTV integration site family, member 11 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dr ---- 8e-093     NP_571151.1 wnt11-related [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Mm ---- 3e-094     NP_033545.1 wingless-related MMTV integration site 11 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Hs ---- 5e-095     NP_004617.2 wingless-type MMTV integration site family, member 11 precursor [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Gg ---- 2e-101     NP_990115.1 Wnt-11 protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Xl ---- 1e-103     AAH78589.1 WNT11-R protein [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- ?? ---- 1e-103     NP_001087079.1 WNT11-related protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA047m23.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------TGA---ATG------------------------------------------------------------------------------------ATG---TAA------------------------------TAA---------TGA------------TAG------------------------------------------------------------------------------------------------------------------------------TGA---------ATGATG---------------------TAA------------------------------------TAA------------------------------------------------------------------------------ATG---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2      seed TbA       out                  TTbA047m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAAGTCGGGGTCCCAAGCGAATAAGCTCATGCACCTGCACAACAGCGAAGTGGGGAGACAGGTGCTAAAGGCCTCGCTGGAGATGAAATGCAAGTGTCATGGCGTCTCGGGATCTTGTTCCATAAAGACCTGTTGGCGGGGGCTGCAAGAGCTCCGGGAGATTGCGCTGGACCTCAAAACTAAATATCTGTCAGCCACCAAGGTGGTGCATAGGCCCATGGGTACCCGCAAGCAGCTGGTCCCCAAGGACATCGACATTCGGCCGGTGCAGGAAACAGAAATGATTTATCTACAGAGCTCCCCGGACTATTGCTTGAAAAATGAAAAGATGGGATCTCACGGGACCCACGAGAGGCAGTGCAATAAGACGTCCAACGGCAGCGACAGTTGCGACCTAATGTGCTGTGGGCGGGGCTACAACCCCTACATGGACAAAGTGGTGGAGAGATGCCACTGTAAGTACCACTGGTGTTGCTACGTGACCTGCAAAAAATGTGAAAGGACTGTGGAGCGGTATGTGTGTAAATGAGGTGCCCCGGGGGGCCCCCGCTCTGCCTGGAGGAGCGCTAATAAACACCCCAACAAAGCACCGTCCGTCCTTGGAAGAGGCCTTCTTCAGGATTCCTTCCCGGCGAGCTGGTGAGCCATGGAGGCAATAAGCAACTTCCATCCCCAAGTCCTACGGTTCATCTG
  5   1   2       bld Limb      out                       CBSU7815.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCACCGTCCGTCCTTGGAAGAGGCCTTCTTCAGGATTCCTTCCCGGCGAGCTGGTGAGCCATGGAGGCAATAAGCAACTTCCATCCCCAAGTCCTACGGTTCATCTGCCCAAGGATTGTGTTTTGTACTTGTATCATTAGGTGCCAAATGCCATAAAAAAAGACTAAAAAATATCAAAATGGAGGTTAAAGTGGACCTTGAAGGACCTGCTGGTAGGAGAAGGAGAAGAAGGGAACCAATTGTTTTTGGACTGAACCCTCGTATCTAGGTGGGTCAGGCCTTGATGGATCCAGGCGTGTTTTGCCTTTGCCAATACAATTGTATCATGTGATCTATTCCGGATGATGTCATAGCATGATGTCATGGAGAGAACGACTCACATAAGGATGGCCAATCATTTCAACGCAGCCATATTGTAAATAAAGGTCCTCTTGGGTGACCCAAAAGGGACAAACTGATCTTCCCAAATCCCGGACTGGCTGTTCCAACTGGAAAATCCTCATGGAGTAAAGAGTTAATAATTCTCATTACATCAACTGTGTTTACATTCTGGGGAATTTCATCCAGACCCCCCCCCCCCCCCCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)