Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

1% 1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.3999999999999999    0Xt7.1-CBSW4756.3                            5 END     5           0      100                alpha-tropomyosin [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 292.0    0Xt7.1-TTpA005c15.5.5                      487 PI      76        346      885                tropomyosin 3 [Xenopus tropicalis]
     3 427.0    0Xt7.1-XZT53080.5.5                        354 PI      75        100      947                fast skeletal muscle beta-tropomyosin
     4 433.0    0Xt7.1-TGas086h18.3.5                      332 PI      79        281      885                MGC64401 protein [Xenopus laevis]
     5 223.0    0Xt7.1-CBSW4756.3                            5 PI      83        631      858                alpha-tropomyosin [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012153227 Xt7.1-XZT60830.5.5 - 1453 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT60830.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAGTTTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTCAATATAAAATGCTTTGCCTCCAATGGTCACCTCTCTCCCACATGGGTTGGATAATCCTCTCTGAGCTGTCCTTTTTATCCCAGTCTCTTCTTGGGAACCTTTCAAACTGTCCTGCTGCATTAAACAAGAATCACTTTTCTGTTGTACAGACACTCTGTAAAATAAAGGACCCACTGTGTATTTTCTCTCTCCTTCCTGCATTATTTATTGCTTATCTTTTAAAGGAACATTTAATAAAACTGCAGATTAAAGTGGGGACTGGGACAATGGGTGATCTGAATACAATCAGACATGGTGCCAATTATACAGAGCCTCTTGTTAATGACCAAAACAATTGCACAGGTATAAACCATTTATTTTATGTCTATAAAACAGCATGGGGTTTTTTTTTGTATTTTTTTTTTTTTTTAAATATTTGCCATAAATTCTGATAAAACAGGATCTCCTCACCTCTGTCACAATAGGGTTTTGTTGAAAATTGTTTTCCATTTCTTAGACAAATCTATGCAACATAAGCTTTTTCTGTAGCTTTCTATTACAATGTAAAATTGAAAGTATTTCATTCAAATGTCATGTTTTCTGTAGCAACATAATATATGTGGGGTGGCAGAGGATAAAGTGGTGGTGGACAGATCAACCCTACTTTGTGTTTTGATAGTCTTTCTGTGGTTGTTTAAAGTAGATGCAAACATGGATTTTTTTGGAAAGACAATTTTTGATATAACTCTTTTTCATAAAGGCAAATGGTAAATTTACATACCAAGGGAAATCATGTACAGTATGGTGTTGGAGGCTCAACCTAGAGACCACAGAAAATCCTAAAGTACTTGACAAAGCTCAAACAGTTGTTTTCAAAAACAATTCTTTTTAAAGATTTGTCTTATTTAAAATATGCAGTGCTTTTTAGGAATTGGAGCTGGTTAAAAAGTGGTGTAAATTTATATTTTGATGGTTCAAGACAAAAAAATTCAGATCCTTTATCGGCAAAGTTTACAGCATGTTTTCTTGTATGGTCTAGCATTTCCCTGTACTATTTTGTTTTGTTTCTGATCCAGTGGTTAAAATAAAAAAAATCAGATAAACCCAGAATAATTTAAACTTGGGAGAAATTAGCTATCTGTTTTGGATATAAATTTTTTGCGAAGCCTCACTTTTTTATTTTTACACTAGTTTTTAAGATTACAACCAAAAATGTACAACATTGTAACATGAAATAAAATGCACACTTGAAATTTAAAAAAAATCTTGTGTGATT
                                                  Xt7.1-CHK-1008264807                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTCAATATAAAATGCTTTGCCTCCAATGGTCACCTCTCTCCCACATGGGTTGGATAATCCTCTCTGAGCTGTCCTTTTTATCCCAGTCTCTTCTTGGGAACCTTTCAAACTGTCCTGCTGCATTAAACAAGAATCACTTTTCTGTTGTACAGACACTCTGTAAAATAAAGGACCCACTGTGTATTTTCTCTCTCCTTCCTGCATTATTTATTGCTTATCTTTTAAAGGAACATTTAATAAAACTGCAGATxxAxxxGGGGACTGGGACAATGGGTGATCTGAATACAATCAGACATGGTGCCAATTATACAGAGCCTCTTGTTAATGACCAAAACAATTGCACAGGTATAAACCATTTATTTTATGTCTATAAAACAGCATGGGGTTTTTTTTTGTATTTTTTTTTTTTTTTAAATATTTGCCATAAATTCTGATAAAACAGGATCTCCTCACCTCTGTCACAATAGGGTTTTGTTGAAAATTGTTTTCCATTTCTTAGACAAATCTATGCAACATAAGCTTTTTCTGTAGCTTTCTATTACAATGTAAAATTGAAAGTATTTCATTCAAATGTCATGTTTTCTGTAGCAACATAATATATGTGGGGTGGCAGAGGATAAAGTGGTGGTGGACAGATCAACCCTACTTTGTGTTTTGATAGTCTTTCTGTGGTTGTTTAAAGTAGATGCAAACATGGATTTTTTTGGAAAGACAATTTTTGATATAACTCTTTTTCATAAAGGCAAATGGTAAATTTACATACCAAGGGAAATCATGTACAGTATGGTGTTGGAGGCTCAACCTAGAGACCACAGAAAATCCTAAAGTACTTGACAAAGCTCAAACAGTTGTTTTCAAAAACAATTCTTTTTAAAGATTTGTCTTATTTAAAATATGCAGTGCTTTTTAGGAATTGGAGCTGGTTAAAAAGTGGTGTAAATTTATATTTTGATGGTTCAAGACAAAAAAATTCAGATCCTTTATCGGCAAAGTTTACAGCATGTTTTCTTGTATGGTCTAGCATTTCCCTGTACTATTTTGTTTTGTTTCTGATCCAGTGGTTAAAATAAAAAAAATCAGATAAACCCAGAATAATTTAAACTTGGGAGAAATTAGCTATCTGTTTTGGATATAAATTTTTTGCGAAGCCTCACTTTTTTATTTTTACACTAGTTTTTAAGATTACAACCAAAAATGTACAACATTGTAACATGAAATAAAATGCACACTTGAAATTTxxAAAAAAxxxxxxGTGATTATATAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              6    19    19    39   138   148   172   188   259   281   283   319   416   434   460   480   493   507   496   511   500   518   509   537   514   560   517   577   525   588   534   601   541   611   549   620   554   635   558   649   555   651   588   689   609   708   615   713   639   741   725   828   747   854   770   876   820   908   919   932   917   950   944   958   943   981   980   992   991  1004   997  1016  1014  1029  1031  1049  1044  1060  1053  1073  1057  1075  1064  1082  1071  1096  1077  1099  1088  1109  1101  1119  1104  1126  1111  1136  1112  1145  1138  1160  1136  1161  1134  1160  1138  1171  1159  1182  1154  1186  1145  1180  1094  1178  1076  1165  1067  1168  1090  1164  1029  1144  1026  1127  1055  1109  1029  1103   984  1046   946  1029   957  1008   905   981   931   974   915   964   886   934   836   910   819   873   773   871   748   843   701   828   704   806   687   786   663   774   622   752   382   704   367   686   363   676   365   662   360   650   368   605   358   545   357   469   350   447   351   433   347   418   341   408   324   402   308   390   192   298   130   190   127   173   124   172   123   173   122   172    27    72    26    50    25    45    25    43    25    43    25    43    22    38    21    38    21    39    20    39    21    44    29    47    33    57    35    62    48    73    52    74    55    77    59    78    63    84    72    93    70    93    76    98    79   104    85   112    91   116    99   125   100   125    99   129   103   129   105   128   102   125   109   131   111   133   115   132   117   134   120   137   121   140   125   144   123   141   122   141   125   142   125   143   121   142   128   144   125   141   123   141   118   139   122   137   125   139   123   139   125   139   122   137   118   136   122   136   120   137   121   136   120   135   118   133   118   133   116   132   112   131   107   132   112   130   104   126   108   126   107   124   102   121   102   121   100   122    89   120    96   119    90   119    96   120    96   119    94   118    90   119    87   117    85   114    85   113    82   110    78   109    63   103    13    38     6    15
  5   1   2  SIG                                      Xt7.1-XZT60830.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGAACAGCTGAGAGTTTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTCAATATAAAATGCTTTGCCTCCAATGGTCACCTCTCTCCCACATGGGTTGGATAATCCTCTCTGAGCTGTCCTTTTTATCCCAGTCTCTTCTTGGGAACCTTTCAAACTGTCCTGCTGCATTAAACAAGAATCACTTTTCTGTTGTACAGACACTCTGTAAAATAAAGGACCCACTGTGTATTTTCTCTCTCCTTCCTGCATTATTTATTGCTTATCTTTTAAAGGAACATTTAATAAAACTGCAGATCTATACTTTAAAAAAAAAAAAAAAA
  5   1   2                                           Xt7.1-CABK7720.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGTTAGAGGAGGAAATCGCCCAACTGGAAAAGCAGTTGCGGGTGACTGAGGATACCAGAGATAAGATTATGGATGATTTTCATCACGCTGAAGAAAGCCTCTTGGCTGCCGAGGAGAAGGCCACTAAGGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGAAAAAGTGACACAGCTAAAGAAGAA------------------------------------------------TAAAATAACATAACATCAGTCGCGTGTTCCTCAGCTTGGTTTTCTGAAGTCCCTGCTTGTCATATTTTTGCTCTTTTGAGTGCAAGTGGAATCAGCCCCTTGTTTTTGTATTGCTGAACCATTCTAGCACTCAAGCTATATAAAAATCTTTGGGGGGAGACGATGGGAGGCTAGGTTATTTGTATTTTTTTTAATTTATTGCAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTTTTTTTTTTTTAAATATTTGCCATAAATTCTGATAAAACAGGATCTCCTCACCTCTGTCACAATAGGGTTTTGTTGAAAATTGTTTTCCATTTCTTAGACAAATCTATGCAACATAAGCTTTTTCTGTAGCTTTCTATTACAATGTAAAATTGAAAGTATTTCATTCAAATGTCATGTTTTCTGTAGCAACATAATATATGTGGGGTGGCAGAGGATAAAGTGGTGGTGGACAGATCAACCCTACTTTGTGTTTTGATAGTCTTTCTGTGGTTGTTTAAAGTAGATGCAAACATGGATTTTTTTGGAAAGACAATTTTTGATATAACTCTTTTTCATAAAGGCAAATGGTAAATTTACATACCAAGGGAAATCATGTACAGTATGGTGTTGGAGGCTCAACCTAGAGACCACAGAAAATCCTAAAGTACTTGACAAAGCTCAAACAGTTGTTTTCAAAAACAATTCTTTTTAAAGATTTGTCTTATTTAAAATATGCAGTGCTTTTTAGGAATTGGAGCTGGTTAAAAAGTGGTGTAAATTTATATTTTGATGGTTCAAGACAAAAAAATTCAGATCCTTTATCGGCAAAGTTTACAGCATGTTTTCTTGTATGGTCTAGCATTTCCCTGTACTATTTTGTTTTGTTTCTGATCCAGTGGTTAAAATAAAAAAAATCAGATAAACCCAGAATAATTTAAACTTGGGAGAAATTAGCTATCTGTTTTGGATATAAATTTTTTGCGAAGCCTCACTTTTTTATTTTTACACTAGTTTTTAAGATTACAACCAAAAATGTACAACATTGTAACATGAAATAAAATGCACACTTGAAATT
  5   1   2                                           Xt7.1-CAAP6348.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGAAAAAGTGACACATGCTAAGGAAGAAAACTTAAATATGCATCAGATGTTGGACCAGACACTGCTGGAATTAAATAACATGTAAAATACATCAGTCGCGTGTTCCTCAGCTTGGTTTTCTGAAGTCCCTGCTTGTCAATATTTTTGCTCTTTTGAGTGCAAGTGGAATCAGCCCCTTGTTTTTGTTATTGCTGAACCATTCTAGCACTCAAAGGCTTATATAAAAAAAATCTTTGGGGGAGAACGAATGGGAGGGTTAGGTTTATTTGTATTTTTTTTTTAATTTATGCAGCCTATAGAATGGGTTTCATTCTACCCATGGAATTAAAGTGGGGACTGGGACAATGGGTGATCTGAATACAATCAGACATGGTGCCAATTATACAGAGCCTCTTGTTAATGACCAAAACAATTGCACAGGTATAAACCATTTATTTTATGTCTATAAAACAGCATGGGGTTTTTTTTTGTATTTTTTTTTTTTTTTAAATATTTGCCATAAATTCTGATAAAACAGGATCTCCTCACCTCTGTCACAATAGGGTTTTGTTGAAAATTGTTTTCCATTTCTTAGACAAATCTATGCAACATAAGCTTTTTCTGTAGCTTTCTATTACAATGTAAAATTGAAAGTATTTCATTCAAATGTCATGTTTTCTGTAGCAACATAATATATGTGGGGTGGCAGAGGATAAAGTGGTGGTGGACAGATCAACCCTACTTTGTGTTTTGATAGTCTTTCTGTGGTTGTTTAAAGTAGATGCAAACATGGATTTTTTTGGAAAGACAATTTTTGATATAACTCTTTTTCATAAAGGCAAATGGTAAATTTACATACCAAGGGAAATCATGTACAGTATGGTGTTGGAGGCTCAACCTAGAGACCACAGAAAATCCTAAAGTACTTGACAAAGCTCAAACAGTTGTTTTCAAAAACAATTCTTTTTAAAGATTTGTCTTATTTAAAATATGCAGTGCTTTTTAGGAATTGGAGCTGGTTAAAAAGTGGTGTAAATTTATATTTTGATGGTTCAAGACAAAAAAATTCAGATCCTTTATCGGCAAAGTTTACAGCATGTTTTCTTGTATGGTCTAGCATTTCCCTGTACTATTTTGTTTTGTTTCTGATCCAGGGGTTAAAATAAAAAAAATCAGATAAACCCAGAATAATTTAAACTTGGGAGAAATTAGCTATCTGTTTTGGATATAAATTTTTTGCGAAGCCTCACTTTTTTATTTTTACCCTAGTTTTTAAGATTACAACCAAAAATGTACAACATTGTAACATGAAATAAAATGCACACTTGAAATT
  5   1   2                                           Xt7.1-CABD1934.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGAGAGACAGGGGAAGCACTGAGAGTACAGGCTTTGTACAGCCGGGCTGAAGGGAAAGTAGGCGGAAGGGACGCTACTGTGTGAGAGAAATGGCCGGAATAACTTCTTTGGAGGCCGTCAAGAGAAAGATCAAATGCCTGCAAGATCAGGCAGATGCGGCGGAGGAGAGAGCAGAGAAGCTTCAGAGGGAGCGGGATATGGAAAGGAAACAGAGAGAAGCAGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGAAAAAGTGACACATGCTAAGGAAGAAAACTTAAATATGCATCAGATGTTGGACCAGACACTGCTGGAATTAAATTCCCAGTCTCTTCTTGGGAACCTTTCAAACTGTCCTGCTGCATTAAACAAGAATCACTTTTCTGTTGTACAGACACTCTGTAAAATAAAGGACCCACTGTGTATTTTCTCTCTCCTTCCTGCATTATTTATTGCTTATCTTTTAAAGGAACATTTAATAAAACTGCAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAATAGAATACTATTTGTTGAAGTTTTTTTTTGTATTTTTTTTTTTTTTAAATATTTGCCATAAATTCTGATAAAACAGGATCTCCTCACCTCTGTCACAATAGGGTTTTGTTGAAAATTGTTTTCCATTTCTTAGACAAATCTATGCAACATAAGCTTTTTCTGTAGCTTTCTATTACAATGTAAAATTGAAAGTATTTCATTCAAATGTCATGTTTTCTGTAGCAACATAATATATGTGGGGTGGCAGAGGATAAAGTGGTGGTGGACAGATCAACCCTACTTTGTGTTTTGATAGTCTTTCTGTGGTTGTTTAAAGTAGATGCAAACATGGATTTTTTTGGAAAGACAATTTTTGATATAACTCTTTTTCATAAAGGCAAATGGTAAATTTACATACCAAGGGAAATCATGTACAGTATGGTGTTGGAGGCTCAACCTAGAGACCACAGAAAATCCTAAAGTACTTGACAAAGCTCAAACAGTTGTTTTCAAAAACAATTCTTTTTAAAGATTTGTCTTATTTAAAATATGCAGTGCTTTTTAGGAATTGGAGCTGGTTAAAAAGTGGTGTAAATTTATATTTTGATGGTTCAAGACAAAAAAATTCAGATCCTTTATCGGCAAAGTTTACAGCATGTTTTCTTGTATGGTCTAGCATTTCCCTGTACTATTTTGTTTTGTTTCTGATCCAGTGGTTAAAATAAAAAAAATCAGATAAACCCAGAATAATTTAAACTTGGGAGAAATTAGCTATCTGTTTTGGATATAAATTTTTTGCGAAGCCTCACTTTTTTATTTTTACACTAGTTTTTAAGATTACAACCAAAAATGTACAACATTGTAACATGAAATAAAATGCACACTTGAAATTT
  5   1   2  SIG                                    Xt7.1-TTbA008o14.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAAGCACTGAGAGTACAGGCTTTGTACAGCCGGGCTGAAGGGAAAGTAGGCGGAAGGGACGCTACTGTGTGAGAGAAATGGCCGGAATAACTTCTTTGGAGGCCGTCAAGAGAAAGATCAAATGCCTGCAAGATCAGGCAGATGCGGCGGAGGAGAGAGCAGAGAAGCTTCAGAGGGAGCGGGATATGGAAAGGAAACAGAGAGAAGCAGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCCGTTACCGGCAGCTGGACGATCAGCTGAGAATAATGGACCAAACCCTGAAAACATTAATGGCTGCAGAGGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGAAAAAGTGACACATGCTAAGGAAGAAAACTTAAATATGCATCAGATGTTGGACCAGACACTGCTGGAATTAAATAACATGTAAAATACATCAGTCGCGTGTTCCTCAGCTTGGTTTTCTGAAGTCCCTGCTTGTCAATATTTTTGCTCTTTTGAGTGCAAGTGGAATCAGCCCCTTGTTTTTGTTATTGCTGAACCATTCTAGCACTCAAAGGCTTATATAAAAAAAATCTTTGGGGGAGAACGAATGGGAGGGTTAGGTTTATTTGTATTTTTTTTTTAATTTATGCAGCCTATAGAATGGGTTTCATTCTACCCATGGAATTAAAGTGGGGACTGGGACAATGGGTGATCTGAATACAATCAGACATGGTGCCAATTATACAGAGCCTCTTGTTAAGACCAAAACAATTGCACAGGTATAAACCATTTATTTTATGTCTATAAACAGCATGGGGTTTTTTTTTGTATTTTTTTTTTTTTTTTTAAATATTTGCCATAAATTCTGATAAAACAGGATCTCCTCACCTCTGTCACAATAGGGTTTTGTTGAAAATTGTTTTCCATTTCTTAGACAAATCTATGCAACATAAGCTTTTTCTGTAGCTTTCTATTACAATGTAAAATTGAAAGTATTTCATTCAAATGTCATGTTTTCTGTAGCAACATAATATATGTGGGGTGGCAGAGGATAAAGTGGTGGTGGACAGATCAACCCTACTTTGTGTTTTGATAGTCTTTCTGTGGTTGTTTAAAGTAGATGCAAACATGGATTTTTTTGGAAAGACAATTTTTGATATAACTCTTTTTCATAAAGGCAAATGGTAAATTTACATACCAAGGGAAATCATGTACAGTATGGTGTTGGAGGCTCAACCTAGAGACCACAGAAAATCCTAAAGTACTTGACAAAGCTCAAACAGTTGTTTTCAAAAACAATTCTTTTTAAAGATTTGTCTTATTTAAAATATGCAGTGCTTTTTAGGAATTGGAGCTGGTTAAAAAGTGGTGTAAATTTATATTTTGATGGTTCAAGACAAAAAAATTCAGATCCTTTATCGGCAAAGTTTACAGCATGTTTTCTTGTATGGTCTAGCATTTCCCTGTACTATTTTGTTTTGTTTCTGATCCAGTGGTTAAAATAAAAAAAATCAGATAAACCCAGAATAATTTAAACTTGGGAGAAATTAGCTATCTGTTTTGGATATAAATTTTTTGCGAAGCCTCACTTTTTTATTTTTACACTAGTTTTTAAGATTACAACCAAAAATGTACAACATTGTAACATGAAATAAAATGCACACTTGAAATTAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TGas088c12.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGAAAAAAGTGACACATGCTAAGGAAGAAAACTTAAATATGCATCAGATGTTGGACCAGACACTGCTGGAATTAAATAACATGTAAAATACATCAGTCGCGTGTTCCTCAGCTTGGTTTTCTGAAGTCCCTGCTTGTCAATATTTTTGCTCTTTTGAGTGCAAGTGGAATCAGCCCCTTGTTTTTGTTATTGCTGAACCATTCTAGCACTCAAAGGCTTATATAAAAAAATCTTTGGGGGAGAACGAATGGGAGGGTTAGGTTTATTTGTATTTTTTTTTTAATTTATGCAGCCTATAGAATGGGTTTCATTCTACCCATGGAATTAAAGTGGGGACTGGGACAATGGGTGATCTGAATACAATCAGACATGGTGCCAATTATACAGAGCCTCTTGTTAATGACCAAAACAATTGCACAGGTATAAACCATTTATTTTATGTCTATAAAACAGCATGGGGTTTTTTTTTGTATTTTTTTTTTTTTTTAAATATTTGCCATAAATTCTGATAAAACAGGATCTCCTCACCTCTGTCACAATAGGGTTTTGTTGAAAATTGTTTTCCATTTCTTAGACAAATCTATGCAACATAAGCTTTTTCTGTAGCTTTCTATTACAATGTAAAATTGAAAGTATTTCATTCAAATGTCATGTTTTCTGTAGCAACATAATATATGTGGGGTGGCAGAGGATAAAGTGGTGGTGGACAGATCAACCCTACTTTGTGTTTTGATAGTCTTTCTGTGGTTGTTTAAAGTAGATGCAAACATGGATTTTTTTGGAAAGACAATTTTTGATATAACTCTTTTTCATAAAGGCAAATGGTAAATTTACATACCAAGGGAAATCATGTACAGTATGGTGTTGGAGGCTCAACCTAGAGACCACAGAAAATCCTAAAGTACTTGACAAAGCTCAAACAGTTGTTTTCAAAAACAATTCTTTTTAAAGATTTGTCTTATTTAAAATATGCAGTGCTTTTTAGGAATTGGAGCTGGTTAAAAAGTGGTGTAAATTTATATTTTGATGGTTCAAGACAAAAAAATTCAGATCCTTTATCGGCAAAGTTTACAGCATGTTTTCTTGTATGGTCTAGCATTTCCCTGTACTATTTTGTTTTGTTTCTGATCCAGTGGTTAAAATAAAAAAAATCAGATAAACCCAGAATAATTTAAACTTGGGAGAAATTAGCTATCTGTTTTGGATATAAATTTTTTGCGAAGCCTCACTTTTTTATTTTTACACTAGTTTTTAAGATTACAACCAAAAATGTACAACATTGTAACATGAAATAAAATGCACACTTGAAATTTTTCTATACTCTTGTGTGATTATATAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGTACAGCCGGGCTGAAGGGAAAGTAGGCGGAAGGGACGCTACTGTGTGAGAGAAATGGCCGGAATAACTTCTTTGGAGGCCGTCAAGAGAAAGATCAAATGCCTGCAAGATCAGGCAGATGCGGCGGAGGAGAGAGCAGAGAAGCTTCAGAGGGAGCGGGATATGGAAAGGAAACAGAGAGAAGCAGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACCGGCAGCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAAAAGTGACACATGCTAAGGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGCATCAGATGTTGGACCAGACACTGCTGGAATTAAATAACATGTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCACTTTTCTGTGTGTTCGCTTACGTCCGTACCCTTTCCACTGCTTAATAAAACTCACGTCCTACCCTCAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGTTATTGCTGAACCATTCTAGCACTCAAAGGCTTATATAAAAAAAATCTTTGGGGGAGAACGAATGGGAGGGTTAGGTTTATTTGTATTTTTTTTTTAATTTATGCAGCCTATAGAATGGGTTTCATTCTACCCATGGAAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----G------
                                               BLH ATG     105    1936                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     105     147                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     105      96                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN     105      54                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      19      54                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     105       4                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Bf ---- 3e-007     CAB75938.1 intermediate filament protein C2 [Branchiostoma floridae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                        PROTEIN --- Cs ---- 4e-008     AAX84194.1 cytospin A [Ciona savignyi] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Br ---- 3e-010     CAA11445.1 intermediate filament protein C2 [Branchiostoma lanceolatum] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Sc ==== 3e-016     NP_014320.1 tropomyosin I; Tpm1p [Saccharomyces cerevisiae] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Sp ==== 4e-048     XP_001176877.1 PREDICTED: similar to tropomyosin 1 [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Dm ==== 1e-081     NP_732002.1 CG4898-PD [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Ce ==== 1e-085     NP_001021695.1 LEVamisole resistant family member (lev-11) [Caenorhabditis elegans] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Bb ==== 4e-106     BAA96548.1 tropomyosin [Branchiostoma belcheri] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Ci ==== 3e-108     Q07068 Tropomyosin, smooth muscle/fibroblast CTM1 [Ciona intestinalis]  ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 8e-110     AAH91033.1 Unknown (protein for MGC:107906) [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Gg ==== 2e-123     NP_990732.1 tropomyosin (CTm4) [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = ?? ==== 7e-130     NP_001079779.1 hypothetical protein LOC379469 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 1e-134     NP_033442.2 tropomyosin 2, beta [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 3e-144     NP_689476.2 tropomyosin 3 isoform 1 [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Dr ==== 2e-145     NP_571180.1 alpha-tropomyosin [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 5e-150     AAH72095.1 Unknown (protein for MGC:79010) [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZT60830.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAA---------------------ATG------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------TAA---------------ATG------------------------------------TGA---------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------TAA---------------------TGA---------------------------------------------TAATGA------------------------------------------TAA------ATG------------------------------------------TAA------------------------------------------------TGA------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------TGATAG---------------------TAGATG------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------TAG---------------------------------------TGA------------------------------------------------ATG---------ATG---TAG------------------------------------------------------------TAA------------------------------------------------TAA------------------------------------------TAA---------------------------TAA---------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   1         - Mus1      in                         CABH2721.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGGTATGAACTTTCTGTCTACATATGTGGAACATCTGTGGAGATTCTGTATTGCGCAGTGGAAAAATCTGGAGATTGTATATTTCAGATGTGCAAATTGCATTTTTTTTTTTTTTTAATTTTATCTTGATATTCTCAGAAGGATGTGGTGTTTGTGTGTGTGTGTGTGTGTACATTTATACTGAACCTGACCAGCTTATATTTGGAGGAATTTAAGGGCTGTTGAGATTCCTAATGCTCTATGCAGAGATCTAGAATCACAAATTATATTAGTATGAATGAGGATATAGTCTCATAAACCATCTCGTAAAAAGAAAATATGAGCTGGATCATGGATATCTTTTATGTGGAAAGTGTCTTGTGCTTTAAACTTTAAGTTAAAaattacagaaatgacatctcccatagacccccattagaagcaaataatgaaacattttaaagctgatttactttttctctgtaataaCAGTACATAATAGACCCCTTACCTGTATCAGACCCATACCTGTATCAGTCAGTTATCTGTTCTGCAGGCTTTATACTTCTACCTTTCTCCTTCTAATTTTTGTTTTCTCTCTCTTTTTAAACACCATTAATTGTCTGGCCTGGGCTCTTCACCGTTTCTCTTCCACGCTGTCTGCCTCCTCATCTTTTTTTCATGGATGATGGTTTCTTACCAATATTTTCTCCATCCCTCTACTCTGAATTTTCCTTCCCTCCTTTTGCCATACATCTCCTGACAACCTTTTGCCTTCCCTACTCTGTTTATTTGCTTTACATTTCTTTTCC
  3   1   1         - Tad5      in                          XZT1311.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAAATGATAATTTATGATACATATCCCCATATCAATGAGGGCAAATCAATTTTTGGTTTAAGCGGCGGTTATATCAAAGCTGCCCAAAGGCAGCTTCAAGCTTAGAATAGCTGGGGCAATCTTCTTAAGTTTCAAAGCTAATTATCTAAGCGGGGGACCCTTGAATTTTCCTAAATTGCAATTAAAACTTTCAACAAAAATGCCAGAGTCTTAAACAGTGGTAAAATCGGCTTTCTTGGTTTTCTTACATTCTTTTTAATTTTGCTTTTCCGGGGGAAAAAAACTTGTTTCTCCCTGCGCCCTAATTCCATAAAAAAACCAAAGCAATGCGGTATAACTAAGGCAGTAATTGGCCCCTAATGGCCCCTTCCAAAATCCATTTTTTTTTTTTTTGTCTGTAAGAGGCAAAGTCACAAACATTTTTTTTTTTTGTTAAATGTAAAACAGAAATA
  5   1   2  SIG                                      Xt7.1-XZT60830.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGAACAGCTGAGAGTTTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTCAATATAAAATGCTTTGCCTCCAATGGTCACCTCTCTCCCACATGGGTTGGATAATCCTCTCTGAGCTGTCCTTTTTATCCCAGTCTCTTCTTGGGAACCTTTCAAACTGTCCTGCTGCATTAAACAAGAATCACTTTTCTGTTGTACAGACACTCTGTAAAATAAAGGACCCACTGTGTATTTTCTCTCTCCTTCCTGCATTATTTATTGCTTATCTTTTAAAGGAACATTTAATAAAACTGCAGATCTATACTTTAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008268598                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCTGAGAGTTTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTCAATATAAAATGCTTTGCCTCCAATGGTCACCTCTCTCCCACATGGGTTGGATAATCCTCTCTGAGCTGTCCTTTTTATCCCAGTCTCTTCTTGGGAACCTTTCAAACTGTCCTGCTGCATTAAACAAGAATCACTTTTCTGTTGTACAGACACTCTGTAAAATAAAGGACCCACTGTGTATTTTCTCTCTCCTTCCTGCATTATTTATTGCTTATCTTTTAAAGGAACATTTAATAAAACTGCAGATCTATACTxxAAAAAAAAAAAAAAAAAAAAAA
  3   1   0       chi Tad0 5x3  in                       IMAGE:6983306                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTCGTAGATCATTATTGAGGGGTATATACTCATCCTCCANCGCCGCNCCAGGGATAAGCAAAAAATATTAATCACGACAGCCCGCGGAGCATGGTCGTTTGTGCGAGGCGACCATCATGGTTGTATTTCGAGCGAGGTGGGGCTAAGAAGATAAGATAGCTGATCGTCGCGGCGCCCTTTTATATTAATGATATTGGGGCGTACACCCTGGGCACTGAATGAGAAAATACGCAGCGGGGTGTGGCAAAATGATGTGCGTATGTGGGTATAAAACGACANAGCGCTTGGGGCGGGATATAGAATGGGGGGGAGATGCTCTCAGAACACCTATAGCACACGNGGCAGCAGATACAACGACGTGATTGTAGGAGCATACACCGTCGGTGGTCGTGTCAATGATTTTTTATNCCTCGTGCGGCGAAGAGCGTGTAATCATAATTTTTGTCTGATAAGTAAAGGCGGTTTTATAAAATGTCTCCAAACTCATGCGGTGCTGAAAAAAAATTTTCATGGGCGGATAACTGTAGAGATACTAACACGTTTATATATAAGAAGAGTGTGGGGCCGTTGTATGGTATATATGATGAGATATCATAGGCCTCGCGCGCGGAGATGATAGTGGATATCGGGTCTGTGAGACGACACANTTTTTTATCGTCCTAAGCGCGGGCAACACAATAATCCAAGGCCGACCCATTCTTTATTGTGCATTATAATAGGGGAGATAGAATATGTTGGGTCCCCTCTCTTTTGTGAATACAAAGGGCGGGACATTTCTCGGGTCGTTTTAATGAGTATGGTGAGGATGTTTATGGGATTTCTTGGTTTTCGGGGGGAGTGTTCTTGGGCCACAAACTTTTTTCAGGAAATTTTGGAGGCAGGGCTGAAAAAGGGCTCGCCGGATGTAGAATGAAAGGAGGGTATGAAGGGTCTGTGAAAACAGGAGCCTGGAACGGATGAAAACGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGTCCTAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGGTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTCAATGTAAATTCAGTAATCTGTGTGTTCGCTTACGTCCGTACCGTATCCACTGCTTAATAAAACGCGGCAAAGGCACTTGTGTNATAATATGGGCACTAAATCAGCCACCCCCGG
  3   1   0       chi Tad0 5x3  in                       IMAGE:6982966                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTAGATGTTGGAATAGGTGGATGTGATTGGTTGTTGGTTTACGAGAGATATTTGTGGTTGTTGTGAGAGGAACACCCTATTTGATCCCTCGCATGGCAGGAACATACGATAGACAGAGGGCTCTGGGGCACAAATAGGGAAAGGCGCCCGCATGTATAAAGGGGTAGGTGTGTGTGTGTTTATGGCGTAGCGGAGGTGCCTCATAAAATAAGCTCNGGGGGGGGGCTCCAAAAGGAGGAAAAATACAATATTGTTCCCCCTCTTGTAGTTTTATTAGAGGGGTTGTTCCCCGTCATCAAAGCCCAGCGGGGAGTCCGGCGAAAATTTTGGCGGGGGGGGCCTTTAGATTTTAAGGGTGGGCGTTTCTTTCCCTATCGGATTTGTGGTTTTGATATACACGTCTGTGTTCCAATACTTCCCTCCGTCTGTCTTTGGGGGGGAGGCGGGGGGAATTTGTCGTAAACCTACTGGGGAGAGAAAACGACCCACAGGTTGGTTGCCTCTTGTGCATTGTGTTGATATAGGGCCNCTATTAAAATATAAAGTGAGTTTTTTTACGCACGCGGAAAGGGGGGGGTTCGGAAGGGGCCCTGGGGGGAACCAGAGAATTATGCTTGTTACGTGAACAGGGTCTCCAGGATAAAAGAATTGGGTCCGCCAGGGGAGGAAAGGCTTGAGGAAATTTGGCCAGGGGGTAAGGGAAAAGCCCCTTCTGTTATGCTGTAATGTGATGATTTGAGGCCCTTCATGTGAACTGTGGCGCATTCCAAGTTGGTAGTAGGGAGGAAGTTGGATTCGTGTTCTAGGAGTTGTCTGGCCACAGTTTTTTCTGAAACGGTAGGAGGGTGAGAAAGGTTGCAGATGAGAGTGAGAGAGTTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAATTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTCAATGTAAATTCACTTTTCTGTGTGTTCGCTTACGTCCGTACCCTGTCACACTGGTTAACAAAATTTTAGCTAGTATCCGGCATGGTGGAAGGGGNNNAAAAANAAAGAAAANAAAA
  5   1   0       chi Tail      in                         CBSW9414.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAAGCCATCCTTAAAAAAAGCCAACAGCGGGACAGAAAGGCAAGGCTCCCAAAAAAGTATTGGGTGTCCGTAGGAATGTGTGTGCCCCCCCTCGCTGCCTTCCCTGCTACATATTTGTGAGGCTGGAACAGCTGAGAGTTTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAG
  5   1   2   11  ext Mus1 5g3  in                         CABH5671.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAAGCCAACAGCGGGACAGAAAGGCAAGGCTCCCAAAAAAGTATTGGGTGTCCGTAGGAATGTGTGTGCCCCCCCTCGCTGCCTTCCCTGCTACATATTTGTGAGGCTGGAACAGCTGAGAGTTTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGGTCTCACAGATAAACTGAA
  3   1   2       add Tad0 5g3  in                       IMAGE:6983184                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTTTTTGCGAACCAAAGTTTGTTTACCAAAAAAAAGGCCAGGGTTGGTATCCCGGTTCCGGATATTTCCCGCGGGATTTTAAAGTTCTTTTTTTGTTCACCCCTAAACCCCCCCCAACACAAAGCAGCAGGCCATGGGATCCCCTTCAAGAAAGAAAGATGCCAGATGTCTAAAACTGGGACAAGGAAAAATGCCTTTGGACAGAGCAGAACCGGGTTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACCAGCTTGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGGCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCATAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTCAATGTAAATTCACTTTTCTGTGTGTTCGCTTACGTCCGTACCCTTTCCACTGCTT
  5   1   2       add Tad0 5g                            IMAGE:6983737                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACAAGGGGCTGAGTACCGGGTCCGGAATTCCCGGGGATCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCANGCAGAGAAGTACTCCCAGAAGGAGGACAAATA
  5   1   2       add AbdN 5g                            IMAGE:7022134                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGCCGATAGAACAGTTTCGGTCCAGGTTCCCGGGATCTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGANGAGGAAATTGAAAACTGTTACCAACAACCTGAAATCTCTGNGAGCCCAGGCAGAGAAGTACTCCCCAGAAGGAGGACAAATATGNAAGAGGGAAATTTANGGTTCTCACAGATAAACCTGAAGAGGCTGAAACACGGTGCCGAGTTTTGCAGAGAGGACAGTAGCCAAGTTGGGAAAAGAACATTTGATGATTTAAAAA
  5   1   2       add Abd0 5g                            IMAGE:7002736                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAANNNNGGACTGGACTTGACAGTTCGGTCGGAATTCCCGGGATCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAAGAGGACAANTATGAAGAGGAAAT
  5   1   3   20   nb Tail 5g                              CBSW7860.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTATTTGTGAGGCTGGAACAGCTGAGAGTTTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTC
  5   1   2   14  ext Met2 5g3  in                         CUNH1207.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGTCGGATTCCGGGTCGACCCACGCGTCCGCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCCAGTTGGAAAAGAC
  5   1   2       add Tad0 5g                            IMAGE:6983510                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGCAGAGGCTGGGGTACCGGGTCCGGGAATTCCCGCGGATCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAATGAAGGACAATATGGAAAAGAAATTTAATTTCTTCCAGATAAACTGAAGGGGCTGAACCCGTGCCGA
  5   1   3   10   nb Tail 5g3  in                         CBSW3085.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGAACAGCTGAGAGTTTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGG
  5   1   3   10   nb Tail 5g3  in                         CBSW7903.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGAACAGCTGAGAGTTTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAG
  5   1   2       add Tad0 5g3  in                       IMAGE:6982693                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAAGTGCTGGTACGGGTCGGAATCCCGGGATGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAAGAGGGACAATATGAAGAGGAAATTANGGTCTCACGAA
  5   1   3   10   nb Tail 5g3  in                         CBSW5606.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAACAGCTGAGAGTTTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGA
  5   1   3   10   nb Tail 5g3  in                         CBSW6737.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCGAAACGCACATTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGG
  5   1   2       add Abd0 5g3  in                     IMAGE:6999684.b                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    NGGTTGGAACTTGAAAGTTTGGTCGGAATCCCGGGATAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAANCACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGGACAATATGAAGAGGAAATTANGGTCTCACGATAACT
  5   1   3   12   nb Tad5 5g3  in                         XZT55054.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   0       chi 1030 5x                         IMAGE:7026625.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGTTTGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGGAGGAGGCTGAAAAAGGCTGGCAAATGATGAGTGTAAAGAGGTAATGAAAGTTCATTTGAAAAACATAAGCCCCTGGAGAGATGAAAGAGAAAAATTGGGAACTTGCCAGGAAAATTCCACGGCTTGAAAAGAGGGTCCAAATCAACATTGGTCTTTAGGGAAGTCCTTAACCGGCCACAATTATTTAAAAAAAGTTTGCCTTCGTTAATAACTTGGGTGGATATCTTTTTGTTGAGGGGTGACACTCTTTGTAAATACTTTGTTCAGAATAAGTAAACATCTTGGCTCATAAAAACTTTTTTTCCATAAATAGACACATAAATTTTTGTCCCCACAACCTCTTTGTTAGATGAAGAGATAATTTTTATAAAAACCTTGTTTTATTTCTCATGTAAACACCCTTTGTAAAAATTCCTCTCCGTGGGGGGGGGGCTCCCCCCGCGTCTAATAAATAAAAATATTATCTCCCCCTCAGGTACGGGGAGCGGTACACAAAATATATTGGAACTCGGGCGAAATTATATTATGGGTTTTCCCCCTCCCAAGATAAAACAACTTTTAGAGAGGCGAGGCCTTCGAACAGAACACTATCGGCCCACGAGTCGTATTCTGATTAAAAAGCGAACCAGATTAAATCTCACATTCACGGGAGAACAAAAAGAGAAGTACATGAGGAAATATATCATAAACAAATGAATATTGTTTTTGGTCCTAGAGAACACATAGTACTAAG
  5   1   3   20   nb Tail 5g                              CBSW8267.b1 ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGTCGACCCCGCGTCCGCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGG
  5   1   3        nb TbA  5g3  in                   TTbA076d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGGGGCCCGGGCCCCGGGGCTCAGACTATGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGCCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGNAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGC
  5   1   3        nb TbA  5g3  in                   TTbA078m14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGGGGCCCGGGCCCCGGGGCTCAGACTATGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGCCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCT
  5   1   3        nb TbA       in                   TTbA028k18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGACAAGGCCGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCAGTCAAGTTCTCTCAGTCACCCTAACCCCCCACACAAGCAGCAGCCACGGACGCCATCAAGAAGAAGATGCAGAAGCTTAACCGGACAGGAAAACGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGTGGAACGAAACTTGTAGCATTGCAGAAGAAAACTAAAAGGTACTGTGGTTGAGCTGGACAAATACTCTGAAGCCCTGAAAGAACGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTCGAAGCTGAAGGAGATGTAGCCTCATTGAAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTTCTTCAGAAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACT
  5   1   3        nb HeRe 5g3  in                     EC2CAA13AB10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCTACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGGA
  5   1   3   14   nb Met5 5g3  in                          CACX412.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTA
  5   1   3   12   nb Tad5 5g3  in                         XZT16102.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGGACAATATGAAGAGGAAATTAAGGGTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTT
  5   1   0       chi 1030                            IMAGE:7030544.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAGGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCANGAGCGTCTGGCCACAGCTCTTCAAANACTGGAGGAAGCTGANAAGGCTGCAAATGANAGTGAGAGAAGTATGAAAGTCATTTGAAACAAGAGCCCTGAAAGATGAAAGAGAAAATGGGAACTGCAAGAAATCCAGCTGAAAGGAGGCCCAAGCACCATGGCTGAAGGAGGCTTGACCCGCAAAATATGGAAAAGGGTTGCCTCCGAAAACCTGGGGGGATCATTTGGAGGGGTGGACCCTGGGAACCTTGCCAAAAGGAAAACGTGGCTTGGAACTTTTTTCAAAAAAAACAAAAT
  5   1   2       add Tad0 5g3  in                       IMAGE:6983169                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGAATTCCGGGATGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCNNACACCTGAATCTCTGGAGGCCAGGCAGAGAGTACTCCAGAAGGAGACAATATGAGAGGAATTAGGTCTCACGATAACTGAAGAGCTGAACACTGCGAGTTGCAAGA
  5   1   3   10   nb Bone 5g3  in                        CBTC1296.fwd ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCACTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAATCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAG
  5   1   3        nb Tad0 5g                            IMAGE:6982497                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTCCGGGATCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGANNACTGTTACCNACACCTGAAATCTCTGGAGGCCAGGCAGAGAGTACTCCCGAAGGAGACNATATGAGAGGAATTAGGTCTCCAGATAACTGAG
  5   1   3        nb Tail      in                        CBSW10768.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGA
  5   1   2       add Tad0 5g3  in                       IMAGE:6983369                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    NGGTGCGGCTGGTCCGGGTCGGAATTCCGGGATCTCTCCCTGCATCTTCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAANNTATGAGAGGGAATTANGGTCTCCAGATAACTGAAGGAGCTGAACACTGCGAGTTGCAAA
  5   1   3   10   nb Limb 5g3  in                        CBSU7339.fwd ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTANNGGTCTCACAGATAAAC
  5   1   3   10   nb Tail 5g3  in                        CBSW12259.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAA
  5   1   3   20   nb Tail 5g                              CBSW6125.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGA
  5   1   3   10   nb Tbd1 5g3  in                        CBXT15183.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGGAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGA
  3  -1   0       chi TbA  5g   out                   TTbA003k13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTTTTTTTTTTTTTTTTTAAGAGTTAAATTATTCTTTAATTTTAATAAATAGCTATAAGAGTTTCCTCGTAGATTTCTCGCGTCCGTATCTCTGCTACAAGCGGCAACTCCCTCGCGGGGCTGGAGAGGGATCAACAACGCCACACTGCAACTTTAACACCGACCGTGCGTTCTTCTCTCTCGCCGAGATCGACTATGATTTACCTCTGAAATGTCCGGATTGGGGAGACCGGATCAATATGTACAGTATATTGGTGCAGTTATAGGGGGGGGCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTG
  5   1   3   22   nb Tad5 5g                              XZT17034.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGGAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCATAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTT
  5   1   3        nb TbA  5x3  out                  TTbA004b08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTG
  5   1   3   12   nb Tad5 5g3  in                         XZT29910.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCAGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAGGTTCTCACAGATAAACTGAAGGAGGCT
  3  -1   0       chi Tbd0 5x3  out                      IMAGE:6977848                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGATCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGACTTGGATCGTGCTCATGAGCGTCTGGCCACCGCTCTTCACAAACCTGGACGAGGCTGATAAGGCTGCAGACGAGAGTGAGAGAAGTATGAAAGTCCTCTGAACCCCAGCCCTGGACGGATGACAGAGAAAATGGGAAATGCCAAGAAACTCCAGCTGGAACAGAGGGCCAAGACCCCTTGCCTGCAAGGAAGGCTGCACCCAGCACATAATCAAAAAAGGGTTGGCCCCTATAAACCCCGGGTGCATCCCCTTGGCAAGGGGTGGACCCCCGGGAAAAACCGCTGTCACCCAACGAGATAACCGACTGGCCTGGTAAAAACCTTTTCCCAGAGAAAGAATGCGCTCCTAATAATGTCTTACGAGTCCATAAAGAGATCTCATCTGTATGCAGCGGCAAGGGGGTACAAATGCTTGGTAAAATAGAAACATACGTTCCTCTCACCATAAAAGACACCAACCAGCTCCTGTTATGAATAAGCACCCCCCCCTCCCTGGAGGAAAAAACGTCTCCCTCCTTCGGGCGGCTCGATCAACATGCCAATGAGAACACTCACCCCCCAGCCACTAGAGTGCTGCGCGCGCATAACCAGATGAGGTATCGTGCGACATATCGGGAAAATACATACACCCGTGGTGTATTTAGTATACCGTAAGACTTTAAAAATATATCGGAACAGGGAGTCCTGATCTTATTAATAACACCACTTGTCACGGCGCTGTCGACCGTTTTCTTCGCACTTTAGACCGAGCGTCACCCGCCTCTACGCCCCTATTAATATCGTGCGCAAAGAAAGAAACGCTACATGGGAGCGTAGCCTCAATAG
  5   1   3        nb Tad0 5g                            IMAGE:6983756                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGGGGATCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAATATGAAGAGGAAATTAAGGTCTCACAGA
  5   1   3   10   nb Tail 5g3  in                         CBSW6114.b1 .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGG
  5   1   3        nb Tbd0 5g3  in                       IMAGE:6977020                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAAGAGGAAATTAGGTTCTCACAGATAAACTGAANGGAGGCTGAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTTGGAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAAACTGAAGTACAAAAGCCATCAGTGAAGGAACTGGGATCACNGCTCTCA
  5   1   3   22   nb Tad5 5g                              XZT63011.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCGGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGA
  5   1   3        nb Tail      in                         CBSW2794.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGA
  5   1   3   30   nb Tbd1 5x3  out                        CBXT7453.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   3        nb Tad0 5g                            IMAGE:6982493                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCGAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCATAGAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGATATCTCTGGAGGCCCANGCAGAGAAGTACTCCCAGAATGACGACAAATCTGCAGACGGAATCANGGGTCTCACAGATA
  5   1   3   10   nb Tail 5g3  in                         CBSW7909.b1 .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCA
  5   1   0       chi Tad0 5x3  in                       IMAGE:6981688                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAANATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTTGAGGTGACCTGGAACGTGCANAGGAACGTGCTGAACTTTCAGAAAGCNAATGTGCCGAGCTTTGAGAGGGATTGGAAACTGTTACCCAACAACCTGAAAATCTCTGGGAGGCCCCAGCCAAAAAAAATACTCCCCCGAAGGGGGGGACCAATTTGGAAGAGGGAAATTTAGGGGTTCCCCCCAAGATAAAACTGGAAAGGGGGGGCTGAAACACCCGGGTCCCCAAATTTTTCCCAAAAAGAGAGAAATTTTTCCCCCAATTTGGGGAAAAAAAACCCCCTGTGGGGGGGGTTTTTTAAAAAAAAAAGACAGCGCTTTGTTT
  5   1   3   10   nb Limb 5g3  in                         CBSU708.fwd ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTT
  5   1   3   10   nb Tail 5g3  in                        CBSW11115.b1 ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAG
  5   1   3        nb Tad0 5g3  in                       IMAGE:6981739                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGANATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGANGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAACTGTTACAACAACCTGAAATCTCTGGAAGCCCANGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTCTCACAGATAAACTGAAAGAGGCTGAAACACGTGCCGAGGTTTGCAGAGGAGGACAGTAGCCCAATTGGGAAAAAACATTTGATGATTTTAGAGGATGAGCTGTATGCTTCGAAACTGAAGTACCAAGCCTTCAGGTGAAGAACTTGGATCACGCCTCTCCATGACATGACCTTCAAGGTAAAATTCCCCTTTTCCGG
  5   1   3        nb Tad0 5g                            IMAGE:6981753                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAAGAAGTCTCCCAGAAGAGGACAATATGAGGAGGAATTAGGTTTCCCGATAACTGAGGAGGTGAAAACTTGCGGTTTGCA
  5   1   3        nb Tad0 5g3  in                       IMAGE:6982553                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACNNACCTGAATCTCTGGAGGCCAGGCAGAGAGTACTCCAGAAGAGGACAATATGAAGAGGAATTANGGTCTCACGATAAC
  5   1   2       add Tad0 5g3  in                       IMAGE:6983491                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCANATATGAAGAAGTTGCTCGNTAGCTGGTGATCATTGAGGGTGACCTGNAACGTGCAGAAGAACGTGCTGAACTTTCAGAAGCAATGTGCCGAGCTTGAGGAGATTGAAACTGTACCACACCTGAAATCTCGGAGGCCAGGCGAAAAGTCTCCGAAGGGGCAAATTGAAAGGAATTAGGTTCCCATAAACGAGGGGGTAACCCGC
  5   1   3        nb Tad0 5g                            IMAGE:6984883                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAAACACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATAAAGTTCTCACAGATAACTGAAGGG
  5   1   3        nb Abd0 5g3  in                       IMAGE:6999270                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGGCCAGCACATTGCTGAGGAGGCTGACCCGCAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGNAACGTGCAGAGGAACGTGCTNGACTTTCAGAAAGCAAATGTGCCGAGCTTTGAGAGGAATTGAANACTGTACCNACANCTGAAATCTCTGAAGGCCCAGCAGAGAGTCTCCCCGANGGAGACCATTTGAAGAGAAATTAGGTCTCCAGATAACTGAGGGAGCTGAACCGTGCC
  5   1   3        nb Tad0 5g3  in                     NISC_no03c10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAA
  5   1   3        nb Tad0 5g   ?                      NISC_no03e05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTG
  5   1   3        nb Tad0 5g3  in                     NISC_no14h12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCT
  5   1   3        nb TbA  5g                        TTbA007i15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCCAAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGA
  5   1   3        nb TbA  5g                        TTbA011m01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAGAGCCACTGATGCTG
  5   1   3   12   nb Tad5 5g3  in                         XZT15759.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCCCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTTCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCCACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATT
  5   1   3   12   nb Tad5 5g3  in                         XZT20812.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTG
  5   1   3   22   nb Tad5 5g                              XZT43519.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAGGTTCTCACAGATAAACTGAAAGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTT
  5   1   3   22   nb Tad5 5g                              XZT58407.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAAT
  5   1   3   10   nb Bone 5g3  in                       CBTC10191.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAATCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGANNGAGAATTGAAACTNGT
  5   1   3   10   nb Bone 5g3  in                        CBTC3389.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAATCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGGGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCANGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAGGGTCTCACAGATAAAC
  5   1   3   20   nb Bone 5g                              CBTC804.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGGACAATATGAAGAGGAAATTAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCA
  5   1   3   10   nb Limb 5g3  in                        CBSU2613.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCAC
  5   1   3   10   nb Limb 5g3  in                        CBSU6071.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACA
  5   1   3   10   nb Limb 5g3  in                         CBSU693.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAAT
  5   1   3   10   nb Limb 5g3  in                        CBSU8974.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAANGAGGACAAATATGAAGAGGAAATTAANGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGC
  5   1   3   10   nb Limb 5g3  in                        CBSU9512.fwd ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGA
  5   1   3   10   nb Tail 5g3  in                        CBSW11623.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCC
  5   1   3   10   nb Tail 5g3  in                         CBSW1183.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAA
  5   1   3   20   nb Tail 5g                             CBSW12197.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGA
  5   1   3   10   nb Tail 5g3  in                         CBSW1913.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCA
  5   1   3        nb Tail      out                        CBSW2300.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGA
  5   1   3   10   nb Tail 5g3  in                         CBSW4157.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   3   10   nb Tail 5g3  in                         CBSW4500.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTA
  5   1   3   10   nb Tail 5g3  in                         CBSW5045.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCAGGCAGAGAA
  5   1   3   10   nb Tail 5g3  in                         CBSW5520.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAG
  5   1   3        nb Tail      out                         CBSW762.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGG
  5   1   3   10   nb Tail 5g3  in                         CBSW7751.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGANAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTT
  5   1   3   10   nb Tail 5g3  in                         CBSW8085.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCC
  5   1   3   10   nb Tail 5g3  in                         CBSW9584.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAG
  5   1   3   10   nb Tail 5g3  in                         CBSW9737.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGG
  5   1   3   20   nb Tbd1 5g                             CBXT12204.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGC
  5   1   3   20   nb Tbd1 5g                             CBXT12891.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGA
  5   1   3   20   nb Tbd1 5g                             CBXT16072.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGA
  5   1   2   10  add Tbd1 5g3  in                         CBXT2407.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATA
  5   1   3   10   nb Tbd1 5g3  in                         CBXT3901.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAA
  5   1   3   10   nb Tbd1 5g3  in                         CBXT6445.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTT
  5   1   3   10   nb Tbd1 5g3  in                         CBXT6541.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCATGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAA
  5   1   3   10   nb Eye  5g3  in                         CCAX4511.b1 ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAG
  5   1   3   22   nb Tad5 5g                              XZT34066.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCT
  5   1   3   22   nb Tad5 5g                              XZT42803.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTT
  5   1   3   10   nb Tail 5g3  in                        CBSW11067.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGA
  5   1   3   10   nb Tail 5g3  in                        CBSW11561.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGG
  5   1   3   10   nb Tbd1 5g3  in                        CBXT13282.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTA
  5   1   3   12   nb Tad5 5g3  in                         XZT49131.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGA
  5   1   3   13   nb Tad5 5g3  in                         XZT67422.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTG
  5   1   3   10   nb Bone 5g3  in                         CBTC506.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAATCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCT
  5   1   3   10   nb Tail 5g3  in                          CBSW873.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGA
  5   1   3   10   nb Tbd1 5g3  in                        CBXT21469.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGG
  5   1   3   10   nb Tbd1 5g3  in                         CBXT3065.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATA
  5   1   3        nb Tad0 5g3  in                     NISC_no18f01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTG
  5   1   3        nb Neu  5g                        TNeu026k08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCANAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTNTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAA
  5   1   3        nb Tad5      in                          XZT1318.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAGGTT
  5   1   3   12   nb Tad5 5g3  in                         XZT44239.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTG
  5   1   3   12   nb Tad5 5g3  in                         XZT47387.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGC
  5   1   3   12   nb Tad5 5g3  in                         XZT55262.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCT
  5   1   3   22   nb Tad5 5g                              XZT56983.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTG
  5   1   2   22  ext Tad5 5g                              XZT60830.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGT
  5   1   3   10   nb Limb 5g3  in                        CBSU4603.fwd ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAG
  5   1   3   10   nb Tail 5g3  in                        CBSW11218.b1 ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAG
  5   1   3   10   nb Tail 5g3  in                        CBSW12161.b1 ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATA
  5   1   3   10   nb Tail 5g3  in                         CBSW4043.b1 ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGG
  5   1   3        nb Tail      in                         CBSW8968.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAA
  5   1   3   10   nb Tbd1 5g3  in                        CBXT17973.b1 ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGAGGCGCCAGGCAGAGAAGTACTC
  5   1   3   20   nb Tbd1 5g                             CBXT21987.b1 ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCA
  5   1   3        nb Tad0 5g3  in                       IMAGE:6982059                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGANGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGGAGCTGAAACACGTGCCGAGTTTGCAGAGAGGGACAGTAGCCAAGTTTGGAAAAGACCATTGNAT
  5   1   3        nb Tad0 5g3  in                     NISC_no14g02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAA
  5   1   3        nb TbA  5g                        TTbA021p07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCAGACTAGGAAGGATCCCTCTCCCTGCTTCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAGCCATCAGTGAAGAACTGGATCACGCTCTCAA
  5   1   1       add Fat1      in                         CABC1107.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCAACATCACTGGTGATGTTCATCTCCAGTGTTGATAATAAGAGTGGTCCTGATCACTTTTGCAATTTAAATGTATTTTCTATTTTAGTTGCTTAATATATTAGCAGTTTTAGTTGTTTTTTCATTGCCGAGAGCAGGCTTTCAGTTCAACATCTCACTTGGGGCTCGTATTCACTAGCATTTTTTCCTGCATTCCCTGCGGTTGCGCTCTCCTGCGTTCCACCACAGGGGAGCGCAGGAAGAAACTCACTTTGTTCTTCCTTATGGGGCTGTACTAACGCAGGTTAGGTTTAGATCCCTTttaaagtgatactgacacgaaaaaacaactttttaaaatataaatcgacataaaaagttgcctataggtcgtgttgatcattttttactgatagggctgcttttgtaagtaattgttacttgaaatcccaaaacctgactgttttgccagcctgactgtcccttctcagcctgtcagttatagcttctaatgctaacggcctcctgctggacaaatatggccgcctcctcatagaggaacatgggggatcagatagggaatgtaaaagcttggacaaatacttttatggcaaaattataaatagcatgcaaagacattgttattacagatgtaaaaatggtttcatttctagtttcagtatctctttaagaaATAACTAGAGACCGCCGTAGCATACTTATTGGGATGGAGTACATATTTACTTTCTACTTTGCGGGCCCAGTTTTACCTAAAAGGCAGAGTTCAGCTAAATGCAGTGTCACCCATTCAGTCGAACAAACTAAACATGAACTGCGTAAATTCTCATACATAGCGA
  5   1   3   22   nb Tad5 5g                              XZT70574.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTG
  5   1   3   20   nb Bone 5g                            CBTC10307.fwd ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAATCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAANAGCAATGTGCCGAGCTTGAGGAGGAATTTGAAACTGTT
  5   1   3   10   nb Bone 5g3  in                       CBTC11343.fwd ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAATCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGA
  5   1   3   10   nb Bone 5g3  in                         CBTC549.fwd ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAATCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTTAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAANGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATNAACTGAAGGAGGCTGAAACACGTGCCGAGTT
  5   1   3        nb Limb      out                       CBSU5674.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGC
  5   1   3   10   nb Tail 5g3  in                        CBSW10163.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGG
  5   1   3   20   nb Tail 5g                              CBSW1988.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAG
  5   1   3   10   nb Tail 5g3  in                         CBSW2987.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   3   20   nb Tail 5g                              CBSW8239.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCC
  5   1   3   20   nb Tail 5g                              CBSW8934.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGG
  5   1   3   10   nb Tbd1 5g3  in                         CBXT8749.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCAC
  5   1   2       add Tad0 5g                            IMAGE:6984354                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGNTAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTTGAAACTNGTACCNACACCTGAAATCTCTGGAGGCCCAGGCGAAAGTTCTCCCGAAGGAGACATTTGAGAGGAATTAGGGTCCCCGATTACTGAGGAGCTGAACCTGCGAGTTGCAAG
  5   1   3        nb Abd0 5g                            IMAGE:7016239                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAA
  5   1   3        nb Tad0 5g3  in                     NISC_no01d05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTG
  5   1   3        nb TbA  5g3  in                   TTbA015b14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATTAAGGTTCTCACAGATAAACTGAAGGGGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCT
  5   1   3        nb TbA  5g3  in                   TTbA047o04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGGCTGAGGAGGCTGACCGCAAANTATGAAGAGGTTGCTCGTAAAGCTGGGTGATTCATTGAGGGTGAACCTGGAACGTGCCAGAGGAACGTGGCTGAACTTTCAGAAAAGCAAATGGGTGCCGAGC
  5   1   3   14   nb Met5 5g3  in                         CACX1229.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCCGAGTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTT
  5   1   3   22   nb Tad5 5g                              XZT34911.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGG
  5   1   3   10   nb Limb 5g3  in                        CBSU6855.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAGGTTCTCACAGATAAACTGAAGGAGGCTGA
  5  -1   2       add Tad0                               IMAGE:6982292                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGGCTCCTTTTTCAATTGGTTAAGGTAGGGAGTGGCCATAAAATGTGCCTTAAAAGACTGGGACACAAAGGAAAAATATTTCCTCTTGGGACCTTGGGGCCGGAACACAGGGGGTTGAAGGCCATACCCAAAAAAGGGGGGCTCTGTGGTGAGAAAGATCCTAAACCAGGTTTGGAGGGATGGAAACTTATAGCCATTTGCGAGAAAGAAAATTAAAAAGGGTACTGGGGGATTAAGCTGGATCAAATTATTTTGAAGGCCCTGAAAGATTCCTCAAGGGGAAGCTGGGAATTTGCAGAGAAGAAAGCCCACTGATGTGAAAGGGGATTTAGCTTCATTGAACAGGGGCTTCCAGGTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGGTGTTTTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTCAATGTAAATTCACTTTTCTGTGTGTTCGCTTACGTCCGTACCCTTTCCAC
  5   1   3        nb Met5      in                         CACX1483.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAAAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAA
  5   1   3   12   nb Tad5 5g3  in                         XZT37536.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATT
  5   1   3   22   nb Tad5 5g                              XZT38261.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAAGGAGGACAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAAGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCCAGTTGGA
  5   1   3   12   nb Tad5 5g3  in                         XZT65784.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGT
  5   1   3   22   nb Tad5 5g                              XZT68861.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATG
  5   1   3   10   nb Bone 5g3  in                        CBTC5458.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGG
  5   1   3   10   nb Limb 5g3  in                        CBSU3982.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATG
  5   1   3   10   nb Tail 5g3  in                         CBSW1747.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGG
  5   1   3   10   nb Tail 5g3  in                         CBSW5254.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGC
  5   1   3   10   nb Tail 5g3  in                         CBSW8083.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGG
  5   1   3   20   nb Tbd1 5g                             CBXT13573.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCAGAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGTGACCTGGAACGTGCAGAGGACGTGCTGAACTTTCAGAAAGCAATGTGCCGAGCTTGA
  5   1   3        nb Neu  5g3  in                   TNeu086b19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGAGCGTCTGGCCACAGCTCTTCAAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGC
  5   1   3   22   nb Tad5 5g                              XZT37129.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGANAGTG
  5   1   3   20   nb Bone 5g                             CBTC1675.fwd ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAATCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAANAGCAATGTGCCGAGCTTGAGGAGGAATTGAAACTGTTACCNACACCTGAAATCTCTGGAGGCCAGGCAGAGAAGTACTCCCAGAAGGAGACAAAATATGAGA
  5   1   4      seed TbA  5g3  in                   TTbA049g11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGGGCCCGGGGCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCT
  5   1   3   22   nb Tad5 5g                              XZT39891.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   3   12   nb Tad5 5g3  in                         XZT53177.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTT
  5   1   3        nb AbdN 5g                            IMAGE:7025628                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTTGGAAAAGACCATTGGATGATTTAAAAAGATGAAGCTGTATGCTA
  5   1   3        nb Tad0 5g3  in                     NISC_no01e09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAA
  5   1   3        nb TbA  5g3  in                   TTbA068m09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGGAAGGATCCCTCTCCCTGCATCTTCTGTCTAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACGATAATGGAGCACAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATAGCAGAAGAAACTAAAAGGTACTGAGGATGTGGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTATAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGATAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCC
  5   1   3   12   nb Tad5 5g3  in                         XZT55455.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTG
  5   1   3   10   nb Tail 5g3  in                         CBSW4864.b1 ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGANATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGA
  5   1   3   10   nb Tail 5g3  in                         CBSW6468.b1 ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGA
  5   1   0       chi Tad0 5x3  in                       IMAGE:6982966                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAGGAAGGTCCCTCTCCCTGCATCTTCTGTCCCGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCTGATGACAGTGAGAGAGGTATGAATGTCATTGTCAACAGAGCCCTGTAGGATGAAGAGTAACTGGAACTGTATGACCTCTCGCTGAAAGATGCCTAGCGCATTGCTGACGCGGCTGACCGCGGCTATGAATAGGTTGAATCATCGCAGGTGATCTTGAAGATGACTGGCAAATCCTCCATTACATGCTTTACCTCAAAAAGCCACTGTGTATGTCTTCACTGATTGGTTATGTACCTATCACGCAATCTTTTCGTTGTGTGATGTTTGTCCTGTTAACCCCCTTTTTTAGAATTGCGGTT
  5   1   3   22   nb Tad5 5g                              XZT25052.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGA
  5   1   3   10   nb Bone 5g3  in                        CBTC7205.fwd .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAATCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGA
  5   1   3   10   nb Tail 5g3  in                         CBSW5294.b1 .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAGGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGG
  5   1   2       add Tad0 5g                            IMAGE:6984585                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGGACAATATGAAGAGGAAATTANGGTCTCACGATAACTGAAAGAGCTGAACACTGCGAGTTGCGAGAGACAGTACCAGTGGAAGACATGAG
  5   1   3   12   nb Tad5 5g3  in                         XZT64053.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTT
  5   1   3   12   nb Tad5 5g3  in                         XZT50566.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCC
  5   1   3   22   nb Tad5 5g                              XZT64782.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTA
  5   1   3   12   nb Tad5 5g3  in                         XZT18937.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGT
  5   1   0       chi Gas1 5x                            IMAGE:6990940                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGATCGCTCTCCCTGCATCTTCTGTCCGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCACACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACACATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGACGGATGAAGACAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCCGTAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCCGAGCTTGAGGCAGAAATGAAAACCTGTTTCCCAACAACCTGAAATCTTTGGACGCCCCGGCCAGAGAAGTTACTCCCCCGACGGAGGCACATTTTTGAGCAGGCAAATTTCGGGTTCTTCCCGGGAATAAACCTGGAAGGAGGGCTGGAAACACGTTGCCCAAGTTTTGCCGAAGAGGAACCGTTTGCCCCATTTTGGAAAAGACCCCTTTGGATGAATTTTTTATCCAATGAGCCTGTTTTGCTTCCAAAAACCTGAAGTTCCCAAGGCCCTTTTCTTTGGAA
  5   1   3   10   nb Mus1 5g3  in                         CABH9266.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCGATTCAATTCGGCCGAGGCTTCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAG
  5   1   3   12   nb Tad5 5g3  in                         XZT39427.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTG
  5   1   3        nb Tad5      in                            XZT42.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGGATCCCTCTCCCTGCATCTTCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGGAATTAGGGTCTCACAGATAAACTGAAGGAGGCTGA
  5   1   3   22   nb Tad5 5g                               XZT9972.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGGATCCCTCTCCCTGCATCTTCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCCAGTTGGAAAAGACCATTGATGATTT
  5   1   3   10   nb Tbd1 5g3  in                        CBXT12266.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTG
  5   1   3   22   nb Tad5 5g                              XZT28344.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAG
  5   1   3   12   nb Tad5 5g3  in                         XZT60036.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTA
  5   1   3   10   nb Limb 5g3  in                        CBSU8586.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTG
  5   1   3   20   nb Tail 5g                              CBSW2159.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCGCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGA
  5   1   3        nb Tail      out                        CBSW6678.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGA
  5   1   3   10   nb Tail 5g3  in                         CBSW9217.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCA
  5   1   3        nb HdA  5g                        THdA032j12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCTCTCCCTGCATCTGTCTGTCAAGCTTCTCGTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCATAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAA
  5   1   3   10   nb Mus1 5g3  in                         CABH9673.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTCAATTCGGCACGAGGCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAG
  5   1   3   22   nb Tad5 5g                              XZT26080.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAAGAGGGACAATATGAA
  5   1   3        nb TbA  5g3  in                   TTbA028f07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCCCTCTCCCTGCGTCTTCTGTTATGATCTCTCTGTCACACTAACCCCCCACACAAGCAGCACCCTTGGACGCCATCAAGAAGAAGATGCTTATGCTTAAACTGGACAAGGAAAATGCCTTGCACAGAGCATAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGTGCAAACAACTGGAGGATGAACTTGTAGCATTGCTCAAGAAACTAAAAGGAATTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGAAGAAGCTGGAACTTGCAGAGAACAAAGCCTCTGATGCTGAAGGAGATGTAGCCTCATTGAACACGCGCATCTAGCTGGTAGAGGACGAGTTGGATCGTGCTCAGGACCGTCTGGCCACACCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGATAGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCACAAATATGAAGAGGTCGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCATAAAGCATAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCATAGAAGTACTCCCA
  5   1   3   10   nb Mus1 5g3  in                         CABH1565.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTA
  5   1   3   10   nb Limb 5g3  in                        CBSU2091.fwd ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAANGAGGCTGAAACACGTGCC
  5   1   3   10   nb Tail 5g3  in                         CBSW1839.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACT
  5   1   3   20   nb Tbd1 5g                              CBXT8277.b3 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGT
  5   1   3   12   nb Tad5 5g3  in                          XZT7503.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCCCTCTCCCTGCATCTTCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGANTTAGAAGATGAGCTGTATGCT
  5   1   3   20   nb Limb 5g                             CBSU6117.fwd ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTAC
  5   1   3   10   nb Tail 5g3  in                        CBSW12238.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGG
  5   1   3        nb Tail      in                         CBSW1387.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGG
  5   1   3   10   nb Tail 5g3  in                          CBSW629.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAA
  5   1   3        nb Tad0 5g                            IMAGE:6981724                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACN
  5   1   3        nb Tad0 5g3  in                     NISC_no13g07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGC
  5   1   3        nb TbA  5g                        TTbA047f07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGNGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTTGGAGAANGAATTGAAAACTGTTACCAACAACCTGAAATCTCT
  5   1   3        nb TbA  5g3  in                   TTbA069j09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCA
  5   1   3   12   nb Tad5 5g3  in                         XZT26823.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   3   22   nb Tad5 5g                              XZT35143.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGNAAAGACCCATGATGATTT
  5   1   3   22   nb Tad5 5g                              XZT37770.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTA
  5   1   3   22   nb Tad5 5g                              XZT45436.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTG
  5   1   3   12   nb Tad5 5g3  in                         XZT47806.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   3   12   nb Tad5 5g3  in                         XZT49241.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCCAGTTGGGAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAG
  5   1   3   22   nb Tad5 5g                              XZT63964.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTNGCAGAGGAGACAGTAGCCAAGTTGGAAAAGACCATTTGATGATT
  5   1   3   22   nb Tad5 5g                              XZT66216.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATT
  5   1   3   12   nb Tad5 5g3  in                         XZT67320.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGA
  5   1   3   12   nb Tad5 5g3  in                         XZT70036.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   3   10   nb Limb 5g3  in                        CBSU1194.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCCAGTTG
  5   1   3   10   nb Limb 5g3  in                        CBSU1386.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAA
  5   1   3   10   nb Limb 5g3  in                        CBSU3340.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   3   20   nb Limb 5g                             CBSU7588.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAG
  5   1   3   10   nb Limb 5g3  in                        CBSU8536.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTC
  5   1   3   10   nb Limb 5g3  in                         CBSU944.fwd .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   3   10   nb Tail 5g3  in                        CBSW10954.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAG
  5   1   3   10   nb Tail 5g3  in                        CBSW11378.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGG
  5   1   3   10   nb Tail 5g3  in                        CBSW11518.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGG
  5   1   3   10   nb Tail 5g3  in                        CBSW11755.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTAC
  5   1   3   10   nb Tail 5g3  in                         CBSW1619.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   3   10   nb Tail 5g3  in                         CBSW1702.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAA
  5   1   3   20   nb Tail 5g   out                        CBSW1971.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACT
  5   1   3   20   nb Tail 5g                              CBSW3750.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGG
  5   1   3   10   nb Tail 5g3  in                         CBSW4758.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGG
  5   1   3   10   nb Tail 5g3  in                         CBSW6260.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAG
  5   1   3   10   nb Tail 5g3  in                         CBSW6296.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGA
  5   1   3   10   nb Tail 5g3  in                         CBSW7949.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTG
  5   1   3   10   nb Tail 5g3  in                         CBSW9238.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAG
  5   1   3   20   nb Tbd1 5g                             CBXT21552.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTC
  5   1   3   10   nb Tbd1 5g3  in                        CBXT21639.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAG
  5   1   3   10   nb Tbd1 5g3  in                        CBXT21819.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAA
  5   1   3   10   nb Tbd1 5g3  in                         CBXT4132.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAA
  5   1   3   10   nb Tbd1 5g3  in                         CBXT4848.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGA
  5   1   3        nb Tad0 5g                            IMAGE:6986149                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGGAAATAAGGGTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAG
  5   1   3        nb Tad0 5g3  in                     NISC_no04c01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTG
  5   1   3        nb Tad0 5g3  in                     NISC_no21h09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAA
  5   1   2       add TbA  5g                        TTbA018a04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCTTCTCCCTGCATCTTCTGTCACCTTAAGCGCGCGCCTAACCCCCCACACAAGCAGCAGCCATGGACTTTTTCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGANATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTT
  5   1   3        nb TbA  5g3  in                   TTbA025e06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGGATTTAGAAGATGAGCTGTATGCT
  5   1   3   10   nb Mus1 5g3  in                         CABH4379.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTT
  5   1   3   14   nb Met5 5g3  in                         CACX1312.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCCATGACATGA
  5   1   3   14   nb Met6 5g3  in                          CACY937.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATG
  5   1   3   22   nb Tad5 5g                              XZT61013.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACNAAGCCATCAG
  5   1   3   10   nb Tail 5g3  in                        CBSW11233.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGG
  5   1   3   10   nb Tail 5g3  in                        CBSW11513.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCANG
  5   1   3   10   nb Tail 5g3  in                         CBSW5449.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAANGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTG
  5   1   3   10   nb Tail 5g3  in                         CBSW9322.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGG
  5   1   3   10   nb Tail 5g3  in                         CBSW9763.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGG
  5   1   3   10   nb Tbd1 5g3  in                        CBXT11728.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCAC
  5   1   3        nb Tad0 PIPE                          IMAGE:6985757                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGAACAATATGAAGAGGAAATTANGGTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAG
  5   1   3        nb Tad0 5g3  in                     NISC_no10f06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCANATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTG
  5   1   3        nb Tad0 5g3  in                     NISC_no19d12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGA
  5   1   3   14   nb Met5 5g3  in                         CACX1274.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCCAGTTGGAAAAGACCATGATGATTTA
  5   1   3   10   nb Eye  5g3  in                         CCAX6776.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACCTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGA
  5   1   3        nb Neu  5g                        TNeu138m22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTCCCTGCATCTTCTGTCGAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCGGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCATAAACTGGAGGAGGCTGAGAAGGCTGCAATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAAAAAGCAAATGTGCCGAGC
  3   1   2       add Tad0 5g3  in                       IMAGE:6983169                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAGCGCCCCCTTTTCCTTGGGAAAAGGGAATATATTTGCCACAGAATGGTCTTTATAACAACTTGGGGACCAAGGGGAAAAAATTGGCCTTTGGATACAGGAGCCAAAGAAACAGGGGTTTAAGGCTCGGACCAAGAAAGGGGAGGCATGAGGGAGAAGGAGCAAAACAGGTTGGAGGATTGAACTTGTTAGCATTGCAGAAGAAAATTAAAAGTTACTGAGGATGGAGCTGGACAAATATTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTCAATGTAAATTCACTTTTCTGTGTGTTCGCTTACGTCCGTACCCTTTCCACTGCTTA
  5   1   0       chi Tad0 5x3  in                       IMAGE:6983306                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCAGCCTAACCCCCCTCACGAGCAGCAGCCATGGGCGCCATCAAGACGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGAGAGAGCAGAACAGGGTGAAGCAGACAAGATGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGCTCCCGGGACCGTCTGGGCACAACTCTACACTGATTCGAGGAGGCTGAGAGAGCTGCTGATGACAGATACACAGGCGACTAGGTAATCGCGGACCGAGGCATGCGAGGAGCCGAATATCTGCGATCTCATCCGACTACAGCTGAGCTCTGCCTTTCCACCTTGGACTCGGGCGGGCCTAGCGTTTGCTTGGTTGAGCCATTTCTGTCGAACTAACACTGCGCCTTCACGTCTCGGTTAGTACATCCGCCACCTACCCTGCCCTTATCTCCTGCGTTGCACATGCGTGGCGGAAGCCCTTGCCCTCTCCCTTCCTGCTTCATCATCTTCTCCGCTCTCATCTGTCGATCGATTCTCCTACCAGCTGACCTGGCCTGTACTGGGCTAACCTCATCTTCCCCG
  5   1   3        nb Tad0 5g                            IMAGE:6983539                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAAGAGGGACAATATGAAGAGGAAATTANGGTCTCACAGATAAACTGAAGGAGGCTGAA
  5   1   3        nb Tad0 5g                            IMAGE:6985089                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATAANGGTCTCACAGATAACTGAAGGAGCTGAACACGTGCGAGTTTGCGGAGGAAGTA
  5   1   3        nb AbdN 5g                            IMAGE:7005479                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGGAGGCTGAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCCAGAAAC
  3  -1   3        nb Hrt1      in                         CAAQ5052.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTATGGGCGAGAGGCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTTCATATAAAATGCTTTGC
  5   1   3   10   nb Mus1 5g3  in                         CABH3580.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCCCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGNAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTCAATATAAAA
  5   1   3   10   nb Mus1 5g3  in                         CABH1137.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGATTCGAATTGGACGAGGTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGGAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTTCATATAAA
  5   1   3   10   nb Mus1 5g3  in                         CABH2477.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACNAAGCCATCAGTG
  5   1   3   10   nb Mus1 5g3  in                         CABH9000.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTANCAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTCAATATAAAATGCTTTGCCCTCC
  5   1   3   20   nb Bone 5g                             CBTC1786.fwd ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAATCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCATGCAGAGAAGTACTCCCAGAAGGAGGGACAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACT
  5   1   3   10   nb Mus1 5g3  in                        CABH11381.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGATTCAATCGGCACGAGGCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTTCATATAAAATGCTTTG
  5   1   3   10   nb Mus1 5g3  in                         CABH6033.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCGATTCGCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTA
  5   1   3   10   nb Mus1 5g3  in                         CABH8768.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGG
  5   1   3   10   nb Hrt1 5g3  in                        CAAQ11818.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCGTGCCGGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAAGTACAAGCCATCAGTGAAGAACTGGA
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ9648.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAG
  5   1   3   10   nb Mus1 5g3  in                         CABH5330.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATCGATTCGGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTA
  5   1   3   10   nb Tail 5g3  in                         CBSW9262.b1 ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGA
  5   1   3   20   nb Mus1 5g                              CABH3992.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCATCTTCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAGGTACAAAGCCATCAGT
  5   1   3   10   nb Mus1 5g3  in                          CABH856.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTT
  5   1   3   10   nb Mus1 5g3  in                         CABH8625.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGAT
  5   1   2       add TbA  5g3  in                  TTbA006l19.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCTTCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAG
  5   1   3   10   nb Tail 5g3  in                         CBSW3611.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGG
  5   1   3        nb Tad5      in                          XZT5049.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCTTCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAG
  5   1   3   12   nb Tad5 5g3  in                          XZT7431.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCTTCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTAC
  5   1   3   10   nb Mus1 5g3  in                        CABH10963.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTCAATATAAAATGCTTTG
  5   1   3   10   nb Mus1 5g3  in                         CABH2215.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCCAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCT
  5   1   3   10   nb Mus1 5g3  in                         CABH2486.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTTGGAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAA
  5   1   3   10   nb Limb 5g3  in                        CBSU7866.fwd ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATA
  5   1   3   10   nb Tail 5g3  in                         CBSW3710.b1 ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATT
  5   1   0       chi Tad0      in                       IMAGE:6982986                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACCTAAGAAGGCTCTCTGTNACCCTAACCCCCCACACAAGCAGCTTTAAAGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACCCGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCTTTTTTTGGAGCGNCAGGCCACAGCNCATCTTTAACTGGAGGAGGCCCACACGCTGCAGACGACAGTGAGAGAGGTATGATGGTCATTGAAAACAGAGCGCTGGCGGTTGCATAGAAACTGTACCTGCAAGATATCCAGATGAATGAGGCCACTCACATGGATTAGTAGCTATACGCTAATTGATCAGTTTCTCATCACTGGCTACTTTGAACGTTCCTGCTCCTCGCAAGGATTTTCATATTTTGCCCCTTATTGGCGAGGAATGCTTCTTACATTTTCCCATCCTCCAACTCTTGTGCTCTCTTGATCCTCCACATTGGTGTCCGTCATTAAATTCTTCCCTCTCCGTTTTATTCTTACATCCTG
  5   1   3   12   nb Tad5 5g3  in                         XZT10031.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   3        nb Tad5                                  XZT3821.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCTGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTCNATGTAA
  5   1   3   10   nb Tail 5g3  in                        CBSW11705.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCTGTCAAGTTCTCTCCGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGG
  5   1   3   10   nb Hrt1 5g3  in                        CAAQ12864.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCA
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ4570.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGC
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ6610.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATTAAGGTTCTCACAGATAAACTGAAGGAGGCTNGAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATG
  5   1   3   10   nb Mus1 5g3  in                        CABH11259.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACAT
  5   1   3   10   nb Mus1 5g3  in                         CABH2401.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTT
  5   1   3   20   nb Limb 5g                             CBSU9638.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAANCTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTT
  5   1   2       add Tad0 5g                            IMAGE:6985770                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGGCAGGGGCTGGGTACCGGGGTCCGGAATTCCCGGGGGATGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACATTGATGATTTAGAGATGAGC
  5   1   3        nb Tad0 5g   ?                      NISC_no18d01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAG
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ5209.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCACGAGGCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACTATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTCAATATAAAATGCTTTGCCTCCA
  5   1   3   10   nb Mus1 5g3  in                         CABH5813.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCGATTCGTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAAGTACAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTTCATATAAAATGCTTTGC
  5   1   3   10   nb Limb 5g3  in                        CBSU6432.fwd ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGA
  3  -1   3        nb Limb      out                       CBSU6438.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCT
  5   1   2       add Tad0 5g3  in                       IMAGE:6983184                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTANGGTCTCACAGATAAACTGAAG
  5   1   3   30   nb Hrt1 5g                              CAAQ8697.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGGCACGAGGCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTCAATATAAAATGCTTTGC
  5   1   3        nb Lun1      in                        CABD13940.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATCGATTCGCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTCAATATAAAATGCTTTTG
  5   1   3   22   nb Tad5 5g                              XZT39592.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAG
  5   1   3   10   nb Tbd1 5g3  in                        CBXT18591.b1 ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAA
  5   1   3   10   nb Mus1 5g3  in                        CABH11136.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTG
  5   1   3   10   nb Mus1 5g3  in                         CABH2198.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAAC
  3  -1   3        nb Hrt1      in                        CAAQ11691.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTCAATATAAAATGCTTTGCCCTCCA
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ8047.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTTGG
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ8510.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGA
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ8553.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCATCGATTCGTGTCACCCTAACCCCCCACACAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTCAATATAAAATGCTTTGCC
  5   1   3   10   nb Mus1 5g3  in                         CABH1141.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGA
  5   1   3   10   nb Mus1 5g3  in                         CABH1872.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGA
  3  -1   3        nb Mus1 PIPE in                         CABH5932.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACNAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTTCATATAAAATGCTTTGCC
  5   1   3   10   nb Mus1 5g3  in                         CABH5996.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACNAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTCAATATAAGATGCTTTGC
  5   1   3   10   nb Mus1 5g3  in                         CABH7657.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAAAGGACAGTAGCCAAGTTGGAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACA
  5   1   3   10   nb Mus1 5g3  in                         CABH9987.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTNCATATAAAATGCTTTGC
  5   1   3   10   nb Limb 5g3  in                        CBSU5545.fwd ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTT
  5   1   3   10   nb Hrt1 5g3  in                        CAAQ11811.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGA
  5   1   3   10   nb Hrt1 5g3  in                        CAAQ12332.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCCAGT
  5   1   3   10   nb Hrt1 5g3  in                        CAAQ12873.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAANAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTCAATGACATGACTTTCATATAAAATGCTTTGC
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ1322.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACATTGATGATTTAGAGATGAGCTGTATGCTCAGAAACTGAAAGTACAAGCCATCAGTGAAGAACTGG
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ1716.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAG
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ2096.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCGAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGA
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ2900.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGT
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ3192.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGG
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ3773.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTCNATATAAAATGCTTTG
  3  -1   3        nb Hrt1      in                         CAAQ4501.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAGTACAAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTCAATATAAAATGC
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ6851.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGANATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTT
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ9657.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGAAACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTT
  5   1   3   10   nb Mus1 5g3  in                        CABH10045.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTTCTCTCTGTCACCCTAACCCCCCACACAAGCAGCAGCCATGGACGCCATCAAGAAGAAGATGCAGATGCTTAAACTGGACAAGGAAAATGCCTTGGACAGAGCAGAACAGGCTGAAGCAGACAAGAAGGGAGCAGAGGAGAAGAGCAAACAGCTGGAGGATGAACTTGTAGCATTGCAGAAGAAACTAAAAGGTACTGAGGATGAGCTGGACAAATACTCTGAAGCCCTGAAAGATGCCCAGGAGAAGCTGGAACTTGCAGAGAAGAAAGCCACTGATGCTGAAGGAGATGTAGCCTCATTGAACAGGCGCATCCAGCTGGTAGAGGAGGAGTTGGATCGTGCTCAGGAGCGTCTGGCCACAGCTCTTCAGAAACTGGAGGAGGCTGAGAAGGCTGCAGATGAGAGTGAGAGAGGTATGAAGGTCATTGAAAACAGAGCCCTGAAGGATGAAGAGAAAATGGAACTGCAAGAAATCCAGCTGAAAGAGGCCAAGCACATTGCTGAGGAGGCTGACCGCAAATATGAAGAGGTTGCTCGTAAGCTGGTGATCATTGAGGGTGACCTGGAACGTGCAGAGGAACGTGCTGAACTTTCAGAAAGCAAATGTGCCGAGCTTGAGGAGGAATTGAAAACTGTTACCAACAACCTGAAATCTCTGGAGGCCCAGGCAGAGAAGTACTCCCAGAAGGAGGACAAATATGAAGAGGAAATTAAGGTTCTCACAGATAAACTGAAGGAGGCTGANACACGTGCCGAGTTTGCAGAGAGGACAGTAGCCAAGTTGGAAAAGACCATTGATGATTTAGAAGATGAGCTGTATGCTCAGAAACTGAAAGTACAAGCCATCAGTGAAGAACTGGATCACGCTCTNCATGACATGACTTCNATATAAAAT
  5   1   3   10   nb Mus1 5g3  in                        CABH10290.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................