Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 28 Feb 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-XZT71647.3.5                      13864 END     2           0        0                hypothetical protein LOC549446 [Xenopus tropicalis]
     2   1.0    0Xt7.1-TGas090a09.3                         12 END     7           0       58                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 730.0    0Xt7.1-XZT67603.3                         3271 PI      79        297     1297                unnamed protein product [Xenopus laevis]
     4 176.0    0Xt7.1-CAAL10426.3                          11 PI      82       1103     1296                keratin complex 2, basic, gene 5 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012153233 Xt7.1-XZG34262.5.5 - 1173 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             26    51    94   124   194   222   236   276   253   295   283   315   307   343   353   376   364   381   369   382   366   384   373   389   381   391   377   390   385   392   373   383   377   385   374   384   373   383   379   385   376   386   379   391   382   395   371   397   382   399   381   403   388   405   393   411   401   416   395   421   405   428   411   433   416   434   419   438   422   438   413   439   411   439   413   441   419   444   415   444   419   448   417   453   415   450   415   450   412   448   415   447   395   443   402   444   406   443   393   433   384   432   377   427   377   432   358   419   363   414   350   409   346   394   307   388   306   385   296   381   292   377   268   360   245   325   237   323   237   316   228   311   229   309   211   299   208   294   211   293   204   290   202   282   196   270   184   258   188   250   178   241   179   231   180   219   179   219   176   218   177   218   179   218   175   215   171   216   177   218   179   220   180   222   180   220   182   220   178   217   171   216   169   213   164   213   169   221   171   221   168   221   172   225   164   219   158   215   158   213   151   210   156   217   158   214   158   209   161   208   162   211   161   207   160   206   153   209   153   208   155   210   160   214   159   215   164   214   166   217   162   213   159   215   157   214   160   216   160   215   131   216   131   222   134   225   130   225   127   228   125   263   125   276   121   278   113   294   112   294   111   296   107   299   111   311   108   310   101   314    94   309    89   304    86   306    86   305    87   307    85   310    85   311    84   312    80   309    79   310    73   307    74   285    70   280    79   288    74   307   310   401   352   438   379   475   389   478   410   478   408   473   398   472   418   473   399   469   402   465   419   462   395   460   410   459   413   456   410   457   418   457   377   452   406   452   407   451   419   453   416   446   407   444   395   437   392   436   379   434   389   431   383   426   381   423   327   370   258   332   232   281   221   260   134   211   123   132    39    48    23    29    10    15
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAATTTCCAGTGGTTACAGTAGTGGAGTTTCCAGTGGGTTCGGTGGTGGCTACTCTGCCTACTCCAGCAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGTGAGCTCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCATTGGAGAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCCAAGACAAGCAAGCGTAGCATTGTAGTGAAGACAGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAATCCTCAGATGTTTTCTCAAAACCATGAGCACTTTAACCTTTGCTGTCCCACAGCCTGGGCTCTGAAAGATGAGCCTCCTTTAAGGCAGAAATCAGGAAGGATTCCTTGGGTAGATGTTCTTCACCCATTCTCACTGATCACCCCA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --C--C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 T----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------C-T
                                               BLH ATG      58    1286                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      34     229                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      58     129                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI       8      50                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      58      12                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Sc ---- 4e-009     NP_012117.1 involved in translocation of macromolecules between the nucleoplasm and the NPC;Mlp2p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 5e-033     NP_476616.1 CG6944-PA [Drosophila melanogaster] --------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Sp ---- 6e-036     NP_999665.1 nuclear intermediate filament protein [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 2e-036     NP_001076764.1 Intermediate Filament, A family member (ifa-1) [Caenorhabditis elegans] --------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 1e-079     CAC24550.1 intermediate filament protein IF-A [Ciona intestinalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Br ---- 3e-082     CAA11446.1 intermediate filament protein D1 [Branchiostoma lanceolatum] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bf ==== 7e-084     CAA11448.1 intermediate filament protein D1 [Branchiostoma floridae] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 3e-162     NP_990263.1 otokeratin [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dr ==== 6e-180     NP_956374.1 keratin 8; etID43142.8; etID33550.23; etID43142.23 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 0          NP_002264.1 keratin 8; Keratin-8 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 0          NP_112447.2 keratin complex 2, basic, gene 8 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Xl ==== 0          AAH44116.1 Unknown (protein for MGC:53564) [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 0          NP_001080525.1 keratin 8 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Xt ==== 0          NP_001002797.1 hypothetical protein MGC69490 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZG34262.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAA---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------ATG---------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------TAA---------------------------------TGA---------------------------------------------------------------------------------------------------------TAA---TAA---------------TAAATG------------------------------------------------------------TAA---TGA------ATG---------------TAA---------TGA------------------------------------------ATG------------------TGA---------------------------------------------------------------------------------------------------------------TAG------------------------------------TAG------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   1       chi TbA       in                   TTbA062e20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACAACTTCCTCATCAGAAACAACAGAGTCTCAGTCTGATGATGTTCAAGTCTTTTCCCCTAAGAAAGGACAGAAAAAGAAGAGTGTTGAGACTCTGTTGTTTTTGCTAGGTCCCTTTTTTCTTTTTGCTAGGCTGAACAACCCCGGGGATTCCCCGGGCCCCGGGGCGCCTTCTCCTAAACCTTTCCTGAAGTTCCTACTCCTCCGCCACCTAACGGTTCCGCCATGTCTATCCAAAACCACCAGAAGTCCACCCTACCGCACCAGCAGCCGCCACCCCCCGCTCCGGCCGGCTTCCACAGCTACCTCCGTACAGCGGGGCCCCCGCCAGCCAGCAGAAGCCAGCACTGCCTCCTTCCAGCCTGGGAATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTTGCAGGTGTGGGCTCTGCAGGNATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCT
  5   1   1         - In62 5g                         IMAGE:8952510.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTTTTGATTAAAGAGGAAATCATCAAAATCGAATTCGTCCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAACGATGTGGATGAGGCCTATATGAACAAGTACAGCTAGAGGCACGCTTGGAAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGGAGGAGCTGCGCGAGCTGCATCCAGATTTCGACACTTCGGTCGTGCCTGTCTATGGACAACAACCGCAGCCTTTGACCTTCCGAAATGGCCACTCTTTCG
  5   1   1         - Neu  5g3  in                   TNeu130l01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCATATAAGCGGAGCCTCTCCCTGCAACTCCAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCA
  5   1   1         - In63 5g                         IMAGE:8958559.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCTTTTTAATTGTAGAAGATCTATCGATTCAAATTCGTCCCCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAATGATGTGGATGAGGCCTATATGAACAAGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCTGCGTCAGCTGTATGAGAGAGCTGCGCGAGCTGCCATCCAGATTTCGACCTTCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACTTCGAATGGCC
  5   1   1         - In63 5g                         IMAGE:8957941.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCTTTTATTTATTTCTCTTTTTTTTTAAATAATAAACGTTTTTCTACTCTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCCTTGACCTTCGAATTG
  5   1   1         - In60 5g                         IMAGE:8948099.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTTGTATATACTAATGTATTCTCCCTAATTTCGAATTCGTCCCAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTTGTCCTGCTGAAGAATGATGTGGGATGAGGGCTATATGAACAAAGTTACAGCTAGAAGCACGCTTGGAAGCCACTGACAGAATGAGATTAAACTTTCATAGCGTCAGACTGTATGAAGAGGAAGCTGCGCGAGCTTGCATTCCCAGAATTTTCGAACCCTTCGTACGTGCTTGTCTATGAACAAACAACCGCAGCCTTGACTTCAATGGCTACATTCCACAAAGGCTCGAACCAGATAGTAAGAATATTGCCAATCAAGAACACGATTTCTACGAGTTCAAAGAAAGACCGTGGATC
  5   1   1         - In62 5g                         IMAGE:8956254.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTGATTTAATTTAAATTTGGTGAATTCTTTATTCGTCCCCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGATGTGGATGAGGCCTATATGAACAAGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAGAGGAGCTGCGCGAGCTGCATCCCAGATTTCGACACTTCGTCGTGCTGTCTATGGACACACGGCAGCTGACTCGATGCATCATCGCGAGTTCGAGCCAGTTATGAGATATTTGCCACAAGAGCGGTTTAAAAGTCG
  5   1   1         - In66 5g                         IMAGE:8964887.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCTCCGATTTAACTACATAAGAAAAAAATATAAAAGGCCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTAGAGAATGAATTTGTCCTGCTGAAGAAGATGTGGATGAGCCTATATGAACAAGTACAGCTAGAGGCACGCTAGAGCCCTGACAGATGAGATTAACTTCTGCGTCAGCTGTATGAGAGGAGCTGCCGAGCTGCAATCCCAGATTTCCGACCTCCGGTCGTGCCTGTCCTATGGAACACAACCGCAGCCCTTGAACCCTCG
  5   1   1         - Neu  5g                        TNeu128a22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGAGGCCTCTCCCTGCAGCTCCAGCCTGTCCTGCGCTGTGTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTGCCGCCATGTGTATCAAAACCACCAGAGTGACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCGTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAG
  5   1   1         - In54 5g                         IMAGE:8947115.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTTTTTGGGAGGGTTTCATTCTAAACAAATATTCCCCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTACTTCCTGCGTCAGCTGTATGAGAGGAGCTGCGCGAGCTGCATCCCAGATTTCCGACCTTCGTCGTGCTGTCTATGGGACAACACCGCAGCTGGACTCGATGCATCATCGCGAGTCGAGCCAGTATGAGAATTTGCCAACAAGAGCCGTTAAAAAGTTCCGAAGAGACAGTGT
  5   1   1         - In62 5g                         IMAGE:8956204.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGATTTAATTAAGGATGATATACGATTATGAATTCGTCCAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAAGATGTGGATGAGCCTATATGAACAAGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACCCCTTCGTCGTGCTGTCTATGGACAACACGCAGCCTTGAACTCGATGCATCATCGCAGAAGGTCGAGCCAGGTATGAGATATTGCAACAGAGCGTTAAAAGTCGGAGAGCATGTTATC
  5   1   1       chi Tbd0 5x                            IMAGE:6978579                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTGGTGCCCGTCCAGAATTCTCCGGATATGCGCTCACAAAATCTCTGAGTGCTACTCCTCCGCCCCTTTCGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTATTGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCATAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCGTGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGAAAAGATGCGCCTGGAGTCTGAGCTGGAAATATGCAGGGCCGGTAGAGGACTCTAGAACATTATGAGATGAAATCAACAGCCCACTAGCTGGAAATGACTTTCCTGCTGAAAAGTGTGAGAAGCCTAAAAACAGTCCCTTCAGTATTTGGGGCCTGATAAGAAAATTTCTATCTACGATTTAATTCTCGCTCTGCTCCTATCTAATTCCAGGTTTTAATCAATTCCTTACTATACCTTTTTA
  5   1   1         - Neu0 5g                            IMAGE:6995856                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTCCCTGCAACTCCAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCCGACACTTTCCGTCGNTGCTGGTCTATGGGACAACAACCTGCCG
  5   1   1         - In66 5g                         IMAGE:8965735.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGTTTCCCCGCTACGCATCCACAAAATAATAACGTCCCTTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGATGTGGATGAGGCCTATATGAACCATGTACAGCTAGAGGCACGCTTGGAGGCTCTGACAGATGAGATTACCTTCCTGCGTCAGCTGTATGAGAGAGCTGCGCGAGCTGCAATCCCAGATTTCGACACTTCCGTCGTGCTGTCTATGACAACAACCGCAGTCTGACCTCGATGCATCATCGCAAGTCGAGCCATAATGAGATATGCTACAGGATCGGTTAAAAGTCCGAGAGCCT
  5   1   1         - In66 5g                         IMAGE:8965614.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTTTTTGAAGTTTATATTCTAAAAAAAAAACGTCCCCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAGAGAGCTGCGCGAGCTGCATCCCAGATTTCCGACCCTTCGTCGTGCTGTCTATGGACACACGCAGTCTTGATCTCGAATGCATCATCGCAGAGGTCGAGCACAGTATGGAAGAATATGCCAACAAGAAGCCGGTTTAAAAGTTCGAGAGGCA
  5   1   1         - Neu0 5x3  in                       IMAGE:6991515                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGGTTCGGAATTTTCGGGATGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAAAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAAATATGCAGGGCCTGGGAGAGGACTTTTAGAACAATTTGAGAGAGAAATCCTACAAGCGGCAAAGAGCTGGAAAAATGAATTGGGCCTGCCTGAAAAAGATGTGGAAGGAAGGCTATATGAACAAAGGACAGCTTAAAGGCACGCTTTGGAGGGCCTGGACAGAAGAAGATTAACTTTCCGGGGCTCAGCTGGTAATAAAAAAGGAACTGGCCTAAAGCTTGAATTCCCCAAATTTCCAAAAAATTTTCGGACGGGGAGTGTCTATGGGAAAAAGAGACGGTGGAGCCTTTGAAACGGCAATGGGGTTGGTTTCGTTAAGAGGGGTCCGAGAGCCTACGCATGTGAAGGAATAGTTGCCAAA
  5   1   1         - In54 5g                         IMAGE:8944841.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGTGTTTAACAAAGGATTTCCCTCTTCTTCTTATTCGTCCCCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGTAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAGATGAAATCAACAATCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAACGATGTGGATGACGCCTATATGAACAAGTACAATTAAAGGCACGCTTGGATGGCCTGACAGTATATATAACTTTCTTGCTTAGCTGTTGAATAGGACTGCCCGAGCTGCAATCAAATTCCTATCTTCTGTCTGTGTCTTGGAAACATCTCATCCT
  5   1   1         - TpA  5g3  in                   TTpA014k08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGGATTCCCCGGGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGC
  5   1   1   22    - Gas7 5g                              XZG39573.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTC
  5   1   1         - Gas1 5g                            IMAGE:6987735                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATATCCCCGGGATCTCTCTAAACTTACTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAAAAAGCAGGGACTGGAAGAGGACTTTAATAAAAATATGAAAAGGAAATCAACATGCTGCCAGAGTTGTGAAATGAATTTAGTCCGGATGAACAAGAAGTGGATCAGGGCTACAGAACTANCGAAATAATAAGAGAACTCCTGGAAGCCCCGAAAAAGAAATAATTTTATGCAATTCTGTATGATAAGGAATGAACAGCAGCATCN
  5   1   1         - 1030 5g                         IMAGE:7092316.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCATCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACTCAGCAACATGGACGCCTTGTTTGAGGCCTACATCGGCAACCTGATGCGCCAGCTGGATGGCCTGTGCCAATACTAGATGCGCTTGGAATCTGAGCTGGTAAATATGCAGGGCTTGTTAAAGAACTTTATAACTAATATTAAATGAATCAACATCGTC
  5   1   1         - 1030 5g                         IMAGE:7093161.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTTTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAATA
  5   1   1         - 1030 5g                         IMAGE:7091638.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTATGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTGAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAATATGCAGGTCCTGGTAAAGGGATTTAAGAACAAAATGAAGATGAATCAT
  5   1   1       chi 1030 5x                         IMAGE:7026070.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCGTGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGAGCCAAAGACAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGGTAAAGACTTTAAGAACAATATGAAGAATGAATCAACCCGCGCCCGAGCCTGGAAAATTGATTTTGTCCCTGCTGAAAAAGGATGTGGATGAAGCCCTATATGGACCAAGGGACCGCCTTGAGGGCCCCCTTGGGAAGGCCCGGGAAAGAAGAAAATTAAACTTCCCGGGGGTACGCTTGTATATAAAAAAAGAGACTTGCGCCGAAACCTGCAATTCCCACGAATTTCCCAAACAATTTCCCGGTCGTGGGGTTGTTCTATGGGGAAAAAAAAACCCGGTCAGC
  5   1   1         - 1030 5g                         IMAGE:7028007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAACTGGGAAATATGCAGGGCCTGGGTAAAGGACTTTTAGGCCAAATATGAGGATGAAATCAACAAGCGCACAGAGCTGGGAGAAGGAATTTGTCCTGCTGAAAAAAGGATGTGGGATGAAGGCCCTATTTGACCAAGGGTACAGCCTAAAAGGGCAACGCTTGGGAGGGCCCTGGACAGAATGAAATT
  5   1   1       chi 1030                            IMAGE:7029052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCNGGGATTANAGTGGTCGGTGTCAATAAAAACCTGCTGGCCCCCCTCGATCTGTAGAATTACCCCACCATTCCAGCAGGCATGAACCAAGATAAAGAATACCATCCAGACTCCCCAAAGAATACGTCCGTCACTTCTCTTTGGAATTGGTGAGTTTCCTTAAATCAGTGTTATAACTGGCATGCCGGAAACCGTGGGGGGCCGTCCTCGTTGGAGAAAATAAGAAGGGCCGACAACCTTACAAAAGTAAGATTAGACAATGGATATACATGGTCTTATCCTGGCCGTATATTATTGGTTATTTTTGTGCCGCGGAGAAGACTTAGGGGCCGTCCTCAGTCGCGGAGCGTCTGTGGGGATCGCAGGGTATTTTTGAACGGAAAAACGCATGCTTAGTTAATAATGGGGCGCACGATGGAAGCGAGTGACTGAGTTGAATCCACAGGCTTTCCCNCGTGTATTATCATTCTCGATTATGCTCTATCTTTGTTTGTGTGTGTATCTAAGAAGTATAAGAATTTTGTCTGTTATGAAGAGCTGCCTCGTAAACAACCGTGTAGGTGTTTTGGTTAAGATACGACGTTTATTTCATTGTATATTTCACCTGTATATTTGTGTGTGCGTTAGAACCACCGACGCN
  5   1   1         - 1030 5g                         IMAGE:7027909.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTATCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTG
  5   1   1         - 1030 5g                         IMAGE:7094734.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTG
  5   1   1         - 1030 5g                         IMAGE:7093949.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTG
  5   1   1         - 1030 5g                         IMAGE:7092257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTG
  5   1   1         - 1030 5g                         IMAGE:7027800.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTG
  5   1   1         - 1030 5g                         IMAGE:7092770.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTG
  5   1   1         - 1030 5g                         IMAGE:7026584.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTGTCCTGCGCTATCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATTCGGCAACTGAAGCGCCCGCTGGATGGCCTGGGCCAAAACAAGATGCGCCTGGGAATCTGAGCCGGGGAAATATGCAAGGGCCTGGGTAGAAGGAATTTTAAAAACAAATATGGAAAAATGAAATCCCACCAAGCGCAACAAAAGCTGGGAAAATGGAATTTGGTCCTTGGCTGAAAAAAGGATGTTGGGATGAAGGCCCAAATTTAAACAAGGGTACAGCCTAAAGGGCACCCCTTTGGGAGGCCCCGGACCGAAATGAGATTTAATTTTTCTTGGCTTCTAGCATGTTATTAAAAAAGGAAGCTTGGCCCGAGACTTTGAAATACCCAAAAATTTTCCCGAAACACTTTCTCGGCCCAGTGGTGTGTTTTTTGTGGAAAAAAATAAACCTCGCAN
  5   1   1         - Neu  5x3  out                  TNeu078g02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATCCCCGGGGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTGTGAGGCCTACATCGGCAACCTG
  5   1   1         - 1030 5g                         IMAGE:7025749.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTG
  5   1   1         - 1030 5g                         IMAGE:7028954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTG
  5   1   1         - 1030 5g                         IMAGE:7029036.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTG
  5   1   1         - 1030 5g                         IMAGE:7026918.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTG
  5   1   1         - 1030 5g                         IMAGE:7092194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTG
  5   1   1         - 1030 5g                         IMAGE:7092745.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGGAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAGA
  5   1   1         - Tbd0 5g                            IMAGE:6979895                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCCGGGATGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTTACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACCAGCGCACATAGCTGGAAAATGAATTTGTCCTGCTGAAGAAAGATGTGGATGAGGCCTATATAAACAAGCACAGCTTGAGGCCCGCTTGGTAGGCCCGAAAGATGAGATTACTTCCTGCGTC
  5   1   1         - 1030 5g                         IMAGE:7093742.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATTGC
  5   1   1       chi 1030                            IMAGE:7091773.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCTCCAAAGTCACCTACCGCACCATCAGCGCATCCCCCCGCTCCGGCTGCTTCATCAGCTACTCATACAGCGGGGCCCCCGCAACCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGAATCCAGCTATGGGGGCTCCAGCATTGGGGGCAAGAGGTTCGGTAGTGGCTACAGGAGCGGTTTTGAGTGCTCAGGAGAGACACATAAGAGGATCACATCTTTTTTTTGTCATACAATCCCTTCGTACACAATAAATAATGACAAAGTACTTTCAATCTCCTCTATTCATCATAATAGCTTCATCCTATAATTCTATAAAGGAAAATATTGACTCACTTCTTATCTTGAGGGATAATATTTCTGGCATCTTCCAAGATTCTCCTATAACACTTATATTATAATCTTTTTAATCCTGCTTTTAACCTAAATTTCATATGTTCCCTATTAAAATCTTGTATTTGGAATACTATAATAAATAATTCTATTATATAATATGTACAATTCAAAATATATTTGAAATTTATCATTAGCATTTTAATTAATATATATCTAAATTCTTTATTTATTTTAAAC
  5   1   1         - 1030 5g                         IMAGE:7093009.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTAGAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGGAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCATAACAAGAAGCTAGAAAACATGTGGAGTCTTCTTGCATAAACAAAATGCCACACGCAGCAACTTAGGACGCCTTGTTTGAGGCCTTACTCTGCAACCAGAGGCGCCAGCTTGGATGGCCTGGGGCAAGACAAAATGCGCCTGGAATCTGAACTGGTAAT
  5   1   1         - 1030 5g                         IMAGE:7027536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTGTCCTGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGGCCAAAAAAAAATGCCCCCGGGAGTCTGAACTGGGAAAAATGCCAGGCCCGGGTAAAGGGATTTTAAAAACAAATTTGGAAGATGAAATCAACCCGGGGCACCGAAACCTGGGAAAAGGAATTTTGTCCCGGCTGAAAAAAAGGATGGTGGAAGAAAGCCCTTATTTGAAAAAAGGTACCACCTAAAGGGCACGCCTTGGGAAGGCCCCTGGAAAAAAAGAAGAATTA
  5   1   1         - 1030 5g                         IMAGE:7091759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTGTCCTGCGCTATCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGATCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAAGGATCACATTTGTCAGTGTCAATCAAAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACTAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACTTGGACGCCATGTTTGAGGCCTACATCAGCAAACCTGAGCGCCAGCTGGATGGCCTGGGCTAAGACAAAATGCCCCTGGAGTCTGACCTGGAAAATATGCATGCCTGG
  5   1   1         - Tbd0 5g                          NISC_nl05h04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGGATGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGA
  5   1   1         - Gas  5g                        TGas069b07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGGGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTG
  5   1   1         - Neu  5g                        TNeu051i04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGGGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCACAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCT
  5   1   1         - Tbd0 5g3  in                     NISC_nl14c05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGATGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGC
  5   1   1         - Tbd0 5g                            IMAGE:6980628                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTGTCCTGCTGAAGAAGATGTGGATGAGGCTATATGAACAGGTACAGCTAGAGGCACGCTGGAGCCCTGACGATGAAATAACTTCCTGCTCACTGTAGAAAAGACTGCCCAGCTGAATCAAATTCAAACTTCGCTGCG
  5   1   1         - Gas1 5g                            IMAGE:6986309                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCGCTCTCTAAACTTACTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATTCACAGGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAAGATGTGGATGAAGCCTATATGAACAGGTACAACTAGAGGCCGCTTGAAGGCCTGACAGATAAATTACTTCTGGCTCACCGTATGAAAAGACTGCCCGACTGCATTCCA
  5   1   1         - Neu  5x3  out                  TNeu078c19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGGGTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAAGTGTGGGCTCTGCAGGGATCACAATGGTGAGTGTCAATCAGAGCCTGCTGGCACGCCTGAACCAGGAGATAGAACACACCATTCAGCACGGGACGACCGATGAGAATGAACACATCAAGACTCTCAACAACAAGGTCGACTCTGTCATAGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTTGAAACCAAGTGGAGTCTCCTGCAGAACCAGAATGCCACACGCAGCAACATGGACGCCATG
  5   1   1         - Neu  5g   ?                    TNeu124p20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGGGCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGC
  5   1   1         - Tbd0 5x3  in                       IMAGE:6976667                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATAANCTTNCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGGACACAACCGCAGCCTTGGACCTCGATGGCATCATCGCAGAAGTCCGAGCACAGTATGAAGATAATGGCAACAAGAAGCGTTTTAGAAAGTCGAAAGCATGGTATCCAGTTTAAGTACCCAGGAATTGCAGGGCATCAACTGGGTCGCCCATGGTTGATGGACCTGA
  5   1   1         - Neu0 5g3  in                     NISC_ng25h02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGT
  5   1   1   12    - Gas7 5g3  in                         XZG17905.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAAGTACAGCTAGAGGCACGCTTGGA
  5   1   1         - Tbd0 5g3  in                       IMAGE:6976604                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAAAGAATTTGTCCTGCTGAAGAAAGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTTGGAGGCCCTGACCGATGAAATTAACTTCCTGCGTCAGCTGTAATGAAGAAGAACTGCGCGAAGCTGCAATCCCCAGATTTCCCGAAACTTCCGTCGGGGCGGTCCATGGGAAAAAAACCGCAACCTTGGACCTCCGATGG
  5   1   1         - Gas1 5g                            IMAGE:6986878                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAATTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAG
  5   1   1         - Neu0 5g3  in                       IMAGE:6991526                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCGGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGAAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAAAGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTTCGACACTTCCCGTCGTGGCTGTCTATGGACAACAACCGCAGGCTTTGACCTCGATGGCATCATCGCCAGAAGGTCCGACCCCATTAAGAA
  5   1   1         - Neu0 5g                            IMAGE:6993659                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAAACAATATGAAGATGAAATCCAACAGCGCACAGAGCTGGAGAATTGATTTGTCCTGCTGAAGAAGGATGTGGATGAAGGCTATATGAACAAAGTACAGCTAGAAGGCCCGCTTGGAGGGCCCTGACAGAATGAGAATAAATTTCCTGCGTCAACCTGTAATGAAGAAGAAACTGGCCGCGAGCTTGGAATTCCCAGAATTTTCCGAAACCTTCCGGTCGGTGGCGGTTCTAATGGGGAACAAACAAACCGGCAGGCCCTTTGGAACCCCCCAAGGGGGCATCTAATTCCCACAAAAAAGGTTCCCGAAAACCCCACGCTGTA
  5   1   1         - Neu0 5g                            IMAGE:6994389                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGGAGATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAAGCCTATATGAACAACGTACAGCTAGAGGCACGCTTGGAGGCCCCGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCATTCCCAGAATTTCCAACCTTTCCGTCGGGGCGGCCTATGGGAAAAACAACCGGCAGCCCTTGGACCTCCGAGGGGCATTATTCCCCAAAGGTTCCAAAAACCC
  5   1   1         - Gas1 5g3  in                     NISC_mq10e01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAAT
  5   1   1         - Gas1 5g3  in                     NISC_mq15c04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTG
  5   1   1         - Tbd0 5g3  in                     NISC_nl16e10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAG
  5   1   1   12    - Gas7 5g3  in                         XZG17160.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGA
  5   1   1   22    - Gas7 5g                              XZG25553.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGCTATCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCCTGAGGCGCCCGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCT
  5   1   1   12    - Gas7 5g3  in                         XZG34262.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGC
  5   1   1   22    - Gas7 5g                              XZG45815.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGA
  5   1   1         - Gas7 5g3  in                         XZG58044.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCAT
  5   1   1         - Gas7 5g3  in                         XZG59282.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATC
  5   1   1         - Gas7 5g3  in                         XZG62647.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATTTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTTCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTG
  5   1   1         - Thy1      in                        CBST3671.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGC
  5   1   1   10    - Te1  5g3  in                        CBWN12678.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGCTCTCTAAACTTCTGAGTACTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCCTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCCGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGAT
  5   1   1         - Te1       in                        CBWN14492.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTACTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCCTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCCGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGC
  5   1   1         - Tbd1      in                        CBXT22065.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCTCTCTAAACTTCTGAGTACTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAAATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGGCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTGGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAAC
  5   1   1         - Egg  5g3  in                   TEgg051e16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAAT
  5   1   1         - Gas       in                   TGas051b12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGGGCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGC
  5   1   1         - Gas  5g                        TGas051o08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATG
  5   1   1         - Gas  5g3  in                   TGas067f18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATG
  5   1   1         - Gas  5g3  out                  TGas067j19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGAGTGTCCCTGGCACAGGGAGTGGCACCGACCCCTGGCACTGGCACAGGGAGTGGCACCGACCCCTGGCACTTTGTGCTGACGCACCTTTATTCTGCCTCTCTAGTTTGTGCCTGTAAATATGGCCGAAACGTTGCGCTAAAAGTGATTTACTGATTTCCATACAGATACAGTATCTGTAGCCCACTCTTTATTAGCTGCTACAGTCGCAGGACTTTTGCATCAAGTTGTACTGAAGTAATCT
  5   1   1         - Gas  5g3  in                  TGas092h24.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATG
  5   1   1         - Gas  5g                        TGas129l08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGG
  5   1   1         - Neu  5g3  in                   TNeu058l22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATG
  5   1   1         - Neu  5g3  in                   TNeu074e22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATG
  5   1   1         - Neu  5g3  in                   TNeu111e23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTGTAAGAACAAATA
  5   1   1         - Neu  5g3  in                   TNeu132d07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGGGCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCGTCAGCAGCTACTCGTACAGCGGGGCGCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAACCTGGGATCCAGCTATGGGGGCGCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAAGGATCACAGCGGGCAGTGTGAATCAGAGCCTGCTGGCGCCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTGAGGACCGAGGAGAAGGAGCAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTGTCCTAGAACAGCAGAACAAGATGCTAGAAAC
  5   1   1         - Gas  5g                       TGas089l24.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTG
  5   1   1         - Tbd0 5x3  in                       IMAGE:6977222                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCCACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGATGTGGATGAGGCCTATATGAACAATGTACAGCTAGAGGCACCCTGGGAGGCCCTGACAGAAGAAAATAAACTTCCTGCGTCAACCTGGAATAAAAAAGGAACTTGCGCGAAGCTGCAATACCCCAAATTCCCCGAAAACTTTCCGGCCGTGCTTGTTCAATGGGAAAAACAAACCGGAAGCCCTTGGAACCTCCAAATGGGAACTCAATCCGCAAAAAGGGTCCCGCAAAGCACAGAGTTATGGGAAGGAATATTTTGGGCCAAAAAAAAGAAAAGCCCTGTTTTTTATAAAAAGGTCCCAAAGAGAGCCA
  5   1   1         - Gas1 5g3  in                       IMAGE:6981548                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACGTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCCGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCCGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGGAAATGAATTTGTCCTGCTGAAGAAAGATGTGGGATGAGGCCTATATGAACAAAGTACAGGCTTAGAGGCACGCTTGGGAGGCCCCTGACCGATGGAGATTAACTTCCCTGGGGTCAGCTGGAATGAAAAAGGAAGCTTGCGCCGAGCCTGCCAATCCCAGAATTTCCGGACACTTTCCCGGTCGGGCTGGCCCAAGGGAACAAAAAACCCC
  5   1   1         - Neu0 5g                            IMAGE:6995209                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGCTCTCANACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTTCCGTCGTGCTGTCTATGGACAACAAACCGCAGCCCTTGACCTCGCATGGGCATCATCGCCAAGAGG
  5   1   1         - Neu0 5g3  in                     NISC_ng05h07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAA
  5   1   1         - Tbd0 5g3  in                     NISC_nl10f02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGC
  5   1   1         - Gas  5g                        TGas018l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGC
  5   1   1         - Gas  5g                        TGas021h14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCTCTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGGAACCAGAAGGCCACACTCAGCATCATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGG
  5   1   1         - Gas  5g                        TGas026o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAAT
  5   1   1         - Gas  5g                        TGas027j09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCCCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTNTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATNTGTCCTGCTGA
  5   1   1         - Gas  5g                        TGas042e08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGAGTCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGCGTGGGCTCTGCAGGGATCAC
  5   1   1         - Neu  5g                        TNeu028e15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATG
  5   1   1         - Neu  5g                        TNeu033c20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAA
  5   1   1         - Neu  5g                        TNeu049i18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCT
  5   1   1         - HdA  5x3  out                 THdA017c09.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCTCTCTAACTTCTGAGTTCTGCTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGATCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCTACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCGAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGATATCTACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAAGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAG
  5   1   1   12    - Gas7 5g3  in                         XZG15846.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATG
  5   1   1         - Gas  5g   ?                    TGas053p06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGCCAAGACAAGATGCGCCTGGAGTCTG
  5   1   1         - Gas  5g   ?                    TGas077p10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAG
  5   1   1         - Gas  5g3  in                   TGas102a04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCTCTCTAAACTTCTGAGTTCTACTCCTCCGGGGTGACGGGGCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGGTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGGGGGCAGCATTGGGG
  5   1   1         - Neu  5x3  out                  TNeu078g01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCAT
  5   1   1         - Neu  5g3  in                   TNeu109c03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGGCACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAATATGCAGGGCCTGGTAGAGGAC
  5   1   1         - Neu  5g                        TNeu002a04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCTCTCTAAATTCTGAATTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCANAATCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTG
  5   1   1         - Gas  5g3  in                   TGas103j20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGGGCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCCTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAACTATGGGGGCGGGAGCATTGGGGGCTCCAAGTTCGGGAGTGGCTACAAGAGCGGGTTTGGGGGTGCAAGTGTGGGCTCTGCAAGGATCACAACGGTCAGTGTCAATCAAAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCACAGGTCAGGACCGAGGAGAAGGAACAATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGA
  5   1   1         - Gas1 5g                            IMAGE:6986228                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTCTAAACTATCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAGATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGACGCCCTGACAGATGAGATTAACTTCCTGCGTCA
  5   1   1         - Gas1 5g3  in                       IMAGE:6989777                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGGATAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTNCGG
  5   1   1         - Neu0 5g                            IMAGE:6995706                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAAGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAAGTCCGAGCACAGTATGAAGATATTGCCAANCAGAGCCGTTTTAGAAGTCGAGAGCA
  5   1   1         - Neu0 5g3  in                     NISC_ng21a01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGAT
  5   1   1         - Neu  5g                        TNeu007g07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCTCTCTAAACTTCTGATTCTACTCCTCCGCCACTACGGTTCCGCCATGTCTATCAAAACCACCAGNATCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTG
  5   1   1         - Neu  5g                        TNeu023o18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCANGGCCTGGTAGAGGACTNTAAGAACAAATATGAAGATGAAATC
  5   1   1         - Neu  5g                        TNeu044k11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGC
  5   1   1         - Neu  5g3  in                   TNeu110g23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGC
  5   1   1         - TpA       in                  TTpA047b12.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCTCTAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGC
  5   1   1         - Neu  5g                        TNeu135a19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGAAGCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGAT
  5   1   1         - Gas1 5g                            IMAGE:6988142                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCCGACACTTTCCGTCGTGGCTGGTCTATGGGACAAACAAACCGCCAAGCCTTTGAACCTCGNA
  5   1   1         - Neu0 5g3  in                       IMAGE:6993054                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTTCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCNGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAAGTCCGAGCACAGTATGAAGATATTGCCAACAAGAACCCGTTTTA
  5   1   1         - Neu0 5g                            IMAGE:6996042                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGGACAACAACCGCAGCCTTTGACCTTCGATGGGCATTCATCCGCAGAGGGTCCCGAGC
  5   1   1         - Neu0 5g3  in                     NISC_ng13e02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCA
  5   1   1         - Gas  5g                        TGas009a09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCTCTAAACTCTGNATTCTACTCCTCCGCCACTAACGTTCCGCCATGTCTATCAAAACCACCAGNATCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGAGTGTCCCTGGCACAGGGAGTGGCACCGACCCCTGGCACTGGCACAGGGAGTGGCACCGACCCCTGGCACTTTGTGCTGACGCACCTTTATTCTGCCTCTCTAGTTTGTGCCTGTAAATATGGGCCAAACCGTGGCCCTAAAAGTGATTTACTGATTTCCATACAGATACAGTATCTGTAGCCCACTCTTTATTAGCTGCTACAGTCGCAGGACTTTTGCATCAAGTTGTACT
  5   1   1         - Neu  5g                        TNeu048i06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCTCTAAATTCCTGGTTCTACTCCTCCGCCACTACGGTTCCGCCATGTCTATCAAAACCACCAGGATCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAAGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAATGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTT
  5   1   1   24    - Te5  5g                             CAAO11608.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCA
  5   1   1         - Gas7 5g3  in                         XZG29883.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGAATG
  5   1   1   20    - Te1  5g                              CBWN7649.b1 .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTAAACTTCTGAGTACTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCCTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCCGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTC
  5   1   1         - Egg  5g3  in                   TEgg030j07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGC
  5   1   1         - Tbd0 5g                            IMAGE:6978994                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCANGGCCTGGTAGAGGACTTTTAGACAAATATGAAGATGAAATCACAAGCGCACAGAGCTGGAGAATGATTTGTCCTGCTGAAGAGGATGTGATGAGGCTATATGAACAGGTACAGCTAAAGCACGCTGGGAGCCTGACGATGAAATTACTTCTGCGTCACTGTATGAGAAGACTGCCCAGCTGCATCCAAATTCGAACTTCGTGTGCGTCATGAAACACGCCACTGACTCATGCTCTCACAGTCAAACATTAAAATGCC
  5   1   1         - Neu0 5g                            IMAGE:6994181                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAAATTTCCGACACTTCCCGTCGTGGCTGGTCTATGGAACAACAAACCGCAGCCCTTGGACCTCGAATGGGCATCAATCGCCAGAA
  5   1   1         - Abd0 5g                            IMAGE:7017653                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTG
  5   1   1         - Gas1 5g   ?                      NISC_mq05g12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAG
  5   1   1         - TbA  5g                        TTbA071i17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAACTTCTGAGTGCTACTCCTCCGCCACTAACGGTTCCGCCATGATCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGGAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGTGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAAAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAGGACTCTCAACAACGAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACGTGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACGAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAATGATGTGGATGACGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATG
  5   1   1         - Gas  5g3  in                   TGas121a02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGGCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCA
  5   1   1         - Neu  5g                        TNeu060d02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCGGGATCACAGCGGTCAGTGTCATCAGAGCCTGCTGGCACCCCTTAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCTAGGAGAAGGAACACATCAAGACTGTTAACAACAAGTTCGCCTCTT
  5   1   1         - Gas1 5g                            IMAGE:6988358                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAAGCTGCNGCGAGCTGCAATTCCCAGATTTTCCGAACACTTCCCGGTCGNTGCCTGGTCTATTGGGACCAAACAAACCGGCAGGCCCTTTGGACCCTCCGA
  5   1   1         - Gas1 5g3  in                       IMAGE:6989765                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGATCTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGNAGCACGCTTGGAGGCCCTGACAGATGAGATAACTTCCTGCGTCAGCTGTATGAAGAGAGCTGCGCGAGCTGCAATCCAGATTNCGACCTTCGTCTGCTGCTATGACACAN
  5   1   1         - Gas1 5g   ?                        IMAGE:6989809                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGCCCTGACAGATGAGATTAACTTCTGCGTCAACTGTATGAAGAGAGCTGCGCGAGCTGCAATCCCAGATTCCGACCTTCCGTCGTGCGN
  5   1   1         - Gas1 5g   ?                      NISC_mq06g06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGA
  5   1   1         - Neu0 5g3  in                     NISC_ng02a06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAA
  5   1   1         - Neu0 5g3  in                     NISC_ng03e03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACCAATATGAAGATGAA
  5   1   1         - Neu0 5g3  in                     NISC_ng09e12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATG
  5   1   1         - Tbd0 FL   in                    IMAGE:5336297.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTG
  5   1   1         - Neu  5g                        TNeu006i18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCATGTGTGGGCTCTGCAGGGATCACAACG
  5   1   1         - Neu  5g                        TNeu017p23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTNTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATNTGTCCTGCTGAAGAAGATGTGGAT
  5   1   1         - Gas7 5g3  in                         XZG57552.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCG
  5   1   1         - Gas  5g3  in                   TGas066m13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCATCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCATCATGTCATGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAAGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGAGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATG
  5   1   1         - Neu  5g3  in                   TNeu089l22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTGCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGCCTGGTAGAGGACTTTAAAACAAATATGAAGATGAAATCA
  5   1   1         - Tbd0 5g                            IMAGE:6980728                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTTAGACCAATTTGAAGATGAATTCACAAGCCCCAAAACCTGGAGATGAAATTGTTCTGGCTAAAAAAGATTTGGATGAGGCCTAATGAAACAGGAAACTTAAGGCCCCTTGGAGCCCTACAAAAAAATACTCCCGGCCCCGTTAAAAAGAACTCCAAGCGTACC
  5   1   1         - Gas7 5g3  in                         XZG29064.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCA
  5   1   1       chi Gas7 5x3  in                         XZG43534.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGCAAGCGTAGCATTGTAGTGAAGACAGTGGAGACCAAGGATGGGAGAGTGCTGTCAGAATCCTCAGATGTTTTCTCAAAACCATGAGCACTTTAACCTTTGCTGTCCCACAGCCTGGGCTCTGAAAGATGAGCCTCCTTTAAGGCAGAAATCAGGAAGGATTCCTTGGGTAGATGTTCTTCACCCATTCTCACTGATCACCCCAAGCATGCTAAATGTCAAGCAAGCTGGCCCAATAACACTAACACCCCCCCCCCCC
  5   1   1   12    - Gas7 5g3  in                         XZG53839.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATAAACTTCCTGCGTCAGCTGTATGA
  5   1   1         - Gas8 5g3  in                          st63n12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGGGCTCGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAA
  5   1   1         - In63 5g                         IMAGE:8961145.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAACTTCTTGAGTTCTACTCCCCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTACTTCCTGCGTCAGCTGTATGAGAGAGCTGCGCGAGCTGCATCCCAGATTTCGACACTTCGTCGTGCTGTCTATGGACAACACGCAGCTTGACTCGATGCATCATCGCAGAGTCGAGCCAGTATGAGATATTGCAACAGAGCGTTAGAGTCGAAACATGTATCAGTAGTACAGACTGCAGCTCGCTGTCGCATGCCAGACTGAAATCAGCGAAATATGACTGAACGCACACAAAGGGTGATCTGGATGGAGCCCTCAGG
  5   1   1         - Gas       in                   TGas114d15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATG
  5   1   1         - Gas1 5g3  in                       IMAGE:6981524                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGGAGGCCTGACAGATGAGATAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCAGATTTNCGAA
  5   1   1         - Neu0 5g                            IMAGE:6992045                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTCCCGACACTTCCGTCGTGCTGTCTATGGACAAACAACCGCAGCCTTTGACCCTCGATGG
  5   1   1         - TpA  5x3  out                  TTpA078n03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCTCGAGCTGCAATCTCAGATTTCCGACACTTACGTCGTGCTGTCTATGGACAACAACCG
  5   1   1   12    - Gas7 5g3  in                         XZG25406.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTG
  5   1   1         - Gas7 5g3  in                         XZG35797.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTTCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAG
  5   1   1         - Gas8      in                          st11a13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACTTCTGAGTTCTACTCCTCCGCCACTAACGGGTTCCGCCATGTCTATCANAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCANCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCANGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACANCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCANGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTATAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCANCAACATGNACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGNGCCAGCTGGATGGCCTGG
  5   1   1         - Gas8 5g3  in                          st22g22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGANGCC
  5   1   1   20    - Eye  5g                              CCAX1261.b1 .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGA
  5   1   1         - Gas1 5g                            IMAGE:6988850                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCTTGGGTACCGGGGTCTCGGAATTCCCGGGGATGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCCATCCAGATTCCGACACT
  5   1   1         - Gas1 5g                            IMAGE:6990985                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAANGATGTGGATGAGGCCTATATGAACAGGTACAGCTAGAGGCACGCTTGGAAGCCCTGACAAATGAGATAACTTTCTGCGTCAGCTGTATGAA
  5   1   1         - Neu0 5g   ?                      NISC_ng10g10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTG
  5   1   1         - Neu0 5g3  in                     NISC_ng20b11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTG
  5   1   1         - Neu0 5g3  in                     NISC_ng28c01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCACAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGACATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGACAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCACGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAG
  5   1   1         - TbA  5g                        TTbA043j17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGGGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACACAACCGCAGCCTTGACCTCGA
  5   1   1   25    - Gas6 5g   ?                          ANBT1690.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGAATTCCGACACTTCCGTCGTGCTGTCTATGGAACACAACCGCAGCCTTGACCTCGATGGCATCAT
  5   1   1         - Gas8 5g                               st93k07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAG
  5   1   1         - Neu0 5x3  out                      IMAGE:6992373                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAAGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAAGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCACAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAGATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAANAAAAGATGTGGGATGAGGCCTATATGAAACAAGTACAGGCTAGAAGGCACGCTTGGAATGCCCCTGACAGATGAGATTAACTTTCCTGGCGTCCGCCTGTATTGAAAAAGAAACTGCCGCCGAGCTGCAAATCCCCAGAGTTTTCCGAAACTTTCCCGTTA
  5   1   1         - Neu0 5g                            IMAGE:6993979                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCCGTCGTGGCTGTCTATTGGACAACAAACCCGCAGCCTTTGACCTCGNATGGGCATCAATCGCAGAAGTTCCCGAA
  5   1   1         - Gas7 5g3  in                          XZG5408.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTTCGAGCACAGTAT
  5   1   1         - Gas7      in                         XZG58767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAAAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGG
  5   1   1   12    - Gas7 5g3  in                          XZG5888.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AACTTCTGAGTTCACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTGCCAACAAG
  5   1   1         - Gas8      in                          st11e02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGNATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACNGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCANGGATCACAGCGGTCAGTGTCAATCANAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCANAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCNCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAANGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGG
  5   1   1         - Gas8 5g3  in                          st13o16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAACGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGANGCCCTGACAG
  5   1   1         - Gas8 5g3  in                          st27j13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGG
  5   1   1         - Gas8 5g3  in                          st28d24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATG
  5   1   1         - Gas8 5g3  in                           st5d15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTG
  5   1   1         - Gas8 5g3  in                          st71a08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAA
  5   1   1         - Gas8      in                          st82l03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAG
  5   1   1         - Neu0 5x3  in                       IMAGE:6992967                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAAGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCCGTCGTGCTGTCTATGGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAAGG
  5   1   1         - Neu0 5g                            IMAGE:6994685                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGANATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAAGAGGAGCTGCGCGAGCTGCAAATCCCAGATTTTCCGACACTTCCNGTCGTGGCTGGTCTATGGGACAACAAACCCGCAGCCCTTTGAACCTCGAAA
  5   1   1         - Gas1 5g3  in                     NISC_mq03h10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCAC
  5   1   1         - Tbd0 5g3  in                     NISC_nl15g05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGC
  5   1   1         - Tbd0 5g3  in                     NISC_nl15g09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATG
  5   1   1         - Tad0 5g3  in                     NISC_no03h12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAG
  5   1   1         - Gas  5g                        TGas022o02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAAGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCACGTCATGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCTGCAACCTGAGGCGCCA
  5   1   1         - Gas  5g                        TGas029m05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTNTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATNTGTCCTGCTGA
  5   1   1         - Gas  5g                        TGas042l21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTNTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATNTGTCCTGCTGA
  5   1   1         - Neu  5g                        TNeu012g01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTTCTGGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCANAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTTCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCANGGCCTGGTA
  5   1   1         - TbA  5g   out                  TTbA059c17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAATATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCAT
  5   1   1         - Gas7 5g3  in                         XZG59580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCAT
  5   1   1         - Gas8      out                        st103o13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAAGCCTATATGA
  5   1   1         - Gas8 5g                              st105i06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAAGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAG
  5   1   1         - Gas8 5g3  in                         st112p04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTCGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAA
  5   1   1         - Gas8 5g                               st15p21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGA
  5   1   1         - Gas8 5g3  in                          st33b11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAG
  5   1   1   10    - Te1  5g3  in                         CBWN2760.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTCTGAGTACTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCCTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCCGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATC
  5   1   1         - Gas1 5g3  in                     NISC_mq20c03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAAGATGAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGC
  5   1   1         - Neu  5g                        TNeu032n09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCANGGATCAC
  5   1   1   24    - Gas6 5g                              ANBT2540.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGA
  5   1   1   14    - Gas6 5g3  in                         ANBT1665.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAAAG
  5   1   1   14    - Gas6 5g3  in                         ANBT2636.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCT
  5   1   1         - In63 5g                         IMAGE:8957771.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAATGTTACTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCGAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAAGATGTGGATGAGCCTATATGACAAGTACAGCTAGAGGCACGCTTGGAGCCCTGACAGATGAGATTACTTCCTGCGTCAGCTGTATGAGAGAGCTGCGCGAGCTGCATCCAGATTTCGACCTCGTCTGCTGCTATGACACCACGCAGCTGACTCGATGCATCATCGCGAGTCGACCCAGATGAGATTGCACAGAATCGGCTAAAAGTCAGAGCATG
  5   1   1         - Neu0 5g                            IMAGE:6994868                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGGCACAGAGCTGGAGAATGAAATTTGTCCCTGCTGGAAAAAAGAATGTGGAAAGAAGCCCTATATGGAACCAAGGGTACCAAGCTAGGAGGGCACGCTTTGGGAGGCCCCCTGTACCGAATGGAGAATTAAAGTTTCCCTGGCGTTCAACCTGTATTGAAAAAAGGAGCCTGCCGCGGAAACTGGCAAATCCCCAGAAGTTTTCCGAACAACTTTTCCCTTCGGGGCCTGTTCTTAAGGGGAAAAAAACAAACGGGGAAGCCACTTGGGAACCTCGGAAGGGGCAATACATTTCGGCAAAAAAGGGTCCCCAAGGCCCCAAGTAATGGGGAAAAAAAATTGGGCCCAAAAAAAAAAAGACCCCTTGTTTAATAAAAATTTTCACAAAAAAAACATGTGTTTATACACAA
  5   1   1         - AbdN 5g                            IMAGE:7023953                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAAGTACAGCTAGAGGCACGCTTGGAAGCCCTGACAGATGAGATTAACTTTCCTGCGGTCAGCTTGTAATGAAGAAGAACCTGCGGCGAGCTTGCAATCCCAGAATTTTCCAAACACTTCCCGGTCGGTGGCTGGTCTAAGGGGAACAACAAACCGGCCAAGCCTTTGGAACCTCCCAATGGGGCCATTCCATCTCCCAAAAAGGGTTCCCGAAAACA
  5   1   1         - Neu0 5g                          NISC_ng02h02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAG
  5   1   1         - Neu0 5g   ?                      NISC_ng15f04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGA
  5   1   1         - Neu0 5g3  in                     NISC_ng17a11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGA
  5   1   1         - Neu0 5g3  in                     NISC_ng21h08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGG
  5   1   1         - Te5  5g3  in                        CAAO11765.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAGACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCC
  5   1   1   12    - Tad5 5g3  in                         XZT45305.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGA
  5   1   1         - Neu0 5g                            IMAGE:6993991                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCCTGAAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCCAGATTTCCCGACACTTCCGTTCGTTGCTGGTCTATGGGACAAACAACCGGCAGGCCTTGGAACCTCGGATGGGGCATCATTCCCCAAAAAGGTCCCCAAGCACCAGTTATTGGAAGAAAAATTTGGC
  5   1   1         - Gas7 5g3  in                         XZG28798.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGA
  5   1   1         - Tbd0 5g3  in                     NISC_nl15d07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAA
  5   1   1   14    - Gas6 5g3  out                        ANBT2202.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGAGTGTCCCTGGCACAGGGAGTGGCACCGACCCCTGGCACTGGCACAGGGAGTGGCACCGACCCCTGGCACTTTGTGCTGACGCACCTTTATTCTGCCTCTCTAGTTTGTGCCTGTAAATATGGCCGAAACGTTGCGCTAAAAGTGATTTACTGATTTCCATACAGATACAGTATCTGTAGCCCACTCTTTATTAGCTGCTACAGTCGCAGGACTTTTGCATCAAGTTGTACTGAAGTAATCTGCCAGCTTTGTGCAGAAGTTTAGAACTAGGACTAGAAGTTAAGGCCATGCCTTGTGCCATTTGCCTTGTGTGTTTGAGCCACACTCCTTCTGCAGATGACATTATAACAAACAATGATTAATGGTTTGATTCCTGTTGGGTGTCACCTGGGCA
  5   1   1   10    - Ovi1 5g3  in                         CABI8200.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCAT
  5   1   1         - In63 5g                         IMAGE:8958986.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCGTCGTGCTGTCTATGGACAACAACGCAGCTGACTCGATGCATCATCGCAGAGGTCGAGCCAGTATGAGATTTGCAACAGAGTGTTAGAGTCGAGAGCATGTTATCAGGTTAAGTTACCAAGAAAC
  5   1   1         - In63 5g                         IMAGE:8961003.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCTACTCCTCCGCCACTAACGAGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTACTTCCTGCGTCAGCTGTATGAGAGGAGCTGCGCGAGCTGCATCCCAGATTCGACCCTTCGTCGTGCTGTCTATGGAACAACACGCAGCTGACCTCGATGGCATCATCGCGAGGTTCGAGCCCAGTATGAGATTTGCAACAGAGGCCGTTTAAAGTCCGAAGCATGTTATCCAAGG
  5   1   1         - In66 5g                         IMAGE:8963978.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTACTTCTGCGTCAGCTGTATGAGAGGAGCTGCGCGAGCTGCAATTCCAGATTTCGACCCTTCGTCGTGCTGCATGGACAACATCGCAGCTTGACCTCGATGCATCATCCGAAAGGTCCGAGACCAGTATGAAGATATTGTGCCACAGAAGCGCGTTTA
  3  -1   1         - Lun1      in                         CABD1119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCGAGAGGCCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCGCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGC
  5   1   1       chi Neu0                               IMAGE:6993317                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGGCTGGGTACCGGGTCCGGGAATTCCCNGGGATATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGNATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCCGAGAGAAGAACAGATCAGGACTCTCAACCACAAGTTCGGCCTCTTTTCTTGACCAAGGTGCGTTTCCTAGAACAGCCGAAACAAAATGCTTGAAAACCAATGGGAATCCCCTGCCAAAACCGAAAAGGCCCCACCCCCCAAACTGGGACCCCCTTTTTTTAGGGCCTAATTCGGGACAACCTTAGGGGCCCCCCCTTGGGAATGGGCCTGGGGGCCCAAAAAAAAAAAAAAGCCCCCCCCGGGGATCTCTAAAAACCTGGGGGAAAAAATTTAACCAGGGGCCCTTGTTTAAAAAAAAACTTTTTTTTAAAAAAAACAAATTGTTGGGAGGGAGAGAAAAATTTCCTCCCAAAAGGCGCCCACAAAAAAAAGGGGGGAGAAAAAAAAAAAAATATTTTTCTCCCCCCCGCGCGAGAAAAAAAAAGAAGAGGTTGGTGTGAAAGAAAGGCGGCCTTCTTTTTTTAAAAAAAAGGAGGGTGGCCCCTCCTCTTTGGGGGCGGCCCCTCTTTGTGGGAGGCCCCCCCCAACAAAAAAAAAAAAAAAAATAAATATTTCTTCTCGTCCCCCCCCCCCCCTCTTTTATATAAAAAAAAGAAAAAGAATTTCCCCCCCCGCCTTNCTTTTTTTCCCCCCCCCAAATTTTTTTTAAAAACACCCCTCTCCCGCGGGGGGG
  5   1   1         - Lun1      out                       CABD14399.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGC
  5   1   1         - In60 5g                         IMAGE:8951240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTTCCTTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGATGTGGATGAGCCTATATGACAGTACAGCTAGAGGCACGCTTGAGCCCTGACGATGAGATTACTTCTGCGTCAGCTGTATGAGAGAGCTGCGCGAGCTGCATCCAGATTTCGACCCTCGGTCCTGCTGCTATGACAACACCGCAGCTTGACTCGATGGCATCATCGCAAGGTTCGGGCCAGATGAGAATTTGGCACAGGTCGGTTAGAAGTCAAGC
  5   1   1         - Gas8      out                         st28h21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCTCCGCCACTAACGGTTCCGCCATGGTCTATCAAAACCACCAGAGTCACCTTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGAGTGTCCCTGGCACAGGGAGTGGCACCGACCCCTGGCACTGGCACAGGGAGTGGCACCGACCCCTGGCACTTTGTGCTGACGCACCTTTATTCTGCCTCTCTAGTTTGTGCCTGTAAATATGGCCGAAACGTTGCGCTAAAAGTGATTTACTGATTTCCATACAGATACAGTATCTGTAGCCCACTCTTTATTAGCTGCTACAGTCGCAGGACTTTTGCATCAAGTTGTACTGAAGTAATCTGCCAGCTTTGTGCAGAAGTTTAGAACTAGGACTAGAAGTTAAGGCCATGCCTTGTGCCATTTGCCTTGTGTGTTTGANCCACACTCCTTCTGCAGATGACATT
  5   1   1         - Gas8      in                          st34m01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCANCAGCTACTCGTACAGNGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAANCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGANAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCANAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGNAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCANGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGA
  5   1   1         - Gas8 5g3  in                          st37e18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTCCTCCGCCACTAACGGTTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAA
  5   1   1         - Gas8      in                          st16p09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCTCCGCCACTAACGGTTCCGCCATGATCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGTAGGTGCTTCCAGTTCCATTTGCCTGACACCCTTCCCTTTACACCTATGGGGAGCCCAGCTCTAA
  5   1   1         - Gas8 5g3  in                          st43m22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGANGCCCTGACAG
  5   1   1         - Gas8 5g                               st54f23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCTCCGCCACTAACGGTTCCGCCATGCTCTATCANAACCACCANAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGNTACTCGTANAGCGGGGCCCCCGCANCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGNAGTGGCTACAGGAGCGGGTTTGGGGGTGCANGTGTGGGCTCTGCANGGATCACAGCGGTCANTG
  5   1   1         - Gas8 5g3  out                         st83m10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGAGTGTCCCTGGCACAGGGAGTGGCACCGACCCCTGGCACTGGCACAGGGAGTGGCACCGACCCCTGGCACTTTGTGCTGACGCACCTTTATTCTGCCTCTCTAGTTTGTGCCTGTAAATATGGCCGAAACGTTGCGCTAAAAGTGATTTACTGATTTCCATACAGATACAGTATCTGTAGCCCACTCTTTATTAGCTGCTACAGTCGCAGGACTTTTGCATCAAGTTGTACTGAAGTAATCTGCCAGCTTTGTGCAGAAGTTTAGAACTAGGACTAGAAGTTAAGGCCATGCCTTGTGCCATTTGCCTTTGTGTGTTTGAGCCACACTCCTTCTGCA
  5   1   1         - Gas1 5g                            IMAGE:6988895                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAATTTCTGCGTCAGCTGTATGAGGA
  5   1   1         - Neu0 5g                            IMAGE:6995541                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCANGGCCTGGTAGAGGACTTTTAGAACAAATATGAAGATGAAATCCACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAANAAAGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGGAGCACGCTTGGAGGGCCTGACAGATAGAATTACTTTCCTGCGTCAGCTGAATGAAAAAGAAACTGCGCGAAGCTGCAATTCCCAGATTTCCGGAACCCTCCCGTCGTTGCTGTCCTATGGGAAAAACAACCGGCCAGCCCTTGGACCTCCCAATGGGGAATCAATTCCCCAAAGAGGTCCCGCAACCCACCGGTAAGGGAAGAAAAATTTGGGCC
  5   1   1         - Lun1      in                         CABD6887.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATC
  5   1   1   12    - Gas7 5g3  in                          XZG5155.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCCCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTGCCAACAAGAGCCGTT
  5   1   1         - Gas7 5g3  in                         XZG56078.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAG
  5   1   1         - Gas8 5g3  in                         st104c17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGG
  5   1   1         - Gas8 5g3  in                         st105i10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACA
  5   1   1         - Gas8 5g3  in                          st16n11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGTAGGTGCTTCCAGTTNCATTTGCCTGAC
  5   1   1         - Gas8 5g3  in                          st19b08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCTCCGCCACTAACGGTTCCGCCATGGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGA
  5   1   1         - Gas8 5g3  in                          st53o16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACA
  5   1   1         - Gas8 5g                               st58a08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTG
  5   1   1         - Gas8 5g3  in                          st76h03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAAGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAG
  5   1   1         - Gas8 5g3  in                          st88n01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCTCCGCCACTAACGGTTCCGCCATGGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAG
  5   1   1         - Gas8 5g3  in                          st94l23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGG
  5   1   1         - In66 5g                         IMAGE:8962713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCCACCTAATATCGGGGGTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTTAGAGGACTTTAAGAACAAATATGAAGATGAATCAACAAGCGCACAGAGCTGGAGATGAATTTGTCCTGCTGAGGAAGATGTGGATGAGCCTATATGACAAGTACAGCTAGAGCACGCTTGAAGCCTGACGATGAGATTACTTCTGCGTCAGCTGTATGAGAGAGCTGCCGAGCCTGCAATCCTGATTTCCGACCTCGGTCCTGCCTGTCTTGACCATCGCAAGCTGACTCGATGCATCATCGCAGAGTTTCGAACCAGATTGTA
  5   1   1         - Gas8 5g3  in                           st2d03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGA
  5   1   1         - Gas8 5g3  in                          st32d16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCA
  5   1   1         - Gas8 5g3  in                          st49k17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCNAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAG
  5   1   1         - Gas8      in                          st84a21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAG
  5   1   1         - Gas8 5g                               st85h24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTG
  5   1   1         - Gas8 5g3  in                          st86a23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGA
  5   1   1         - Gas8 5g3  in                          st95m04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACA
  5   1   1         - Gas8 5g3  in                          st96k22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGNCCTGACAG
  5   1   1         - Gas8 5g3  in                          st99h21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAAGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTG
  5   1   1         - Gas8 5g3  in                           st9b16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAG
  5   1   1         - In63 5g                         IMAGE:8960545.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAATCCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGCTATATGACAGTACAGCTAGAGGCACGCTTGAGCCTGACGATGAGATACTTCTGCGTCAGCTGATGAGAGAGCTGCGCGAGCTGCATCCCGGATTTCGACCCTCGTCGTGCCTGTCTATGACACACGCAGCTGACTCGATGCATCATCGCAAGGTTCGAACCAGATATGAGAATTGGCTCA
  5   1   1         - Gas8 5g3  in                          st18j01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCANAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAANAAGGTAGGTGCTTCCAGTTCCATTTGCCTGACACC
  5   1   1         - Gas8 5g3  in                          st56n07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGAC
  5   1   1         - In63 5g                         IMAGE:8958139.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGTAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGTCTGGTAGAGGACTTTAAGACAAATATGAAGATGAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGTCTATATGAACAAGGTACAGCTAGAGGCACGCTTTGAGGCCCTGACGATGAGATTAACTTCCTGCGTCAGCTGTATGAGAGGAGCTGGCGCGAGCTGCAATTCCAGATTTCGACCTTCGTTCTGCTTGTCTATGACACATCGCAGCCTTTGACCTCGAATGACATCATCGCAGGTTCGAATCAAGGATTGAAGGATATTGTGC
  5   1   1         - In63 5g                         IMAGE:8960079.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCCGCCACTAACGGTTTTTGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAGAGAGCTGCGCGAGCTGCAATCCCAGAATTTCCGACCCTTCGTCGTGCTGTTTTATGACAAACAACCGCAGCTGACTCGATGCATCCATCCGCGAAGTTCGAGCCACAGGTATAGAAAGAATATGCCACACAAGAAGGCGTTTAAAGAAGTCA
  5   1   1         - In63 5g                         IMAGE:8960135.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCCGGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGTACAGCTAGAAGCACGCTTGGAGGCCCTGACAGATGAGATTACTTCCTGCGTCAGCTGTATGAGAGAGCTGCGCGAGCTGCAATCCAGAATTTCGACCCTTCGTCTGCTGTCTATGACACAACGGCAGCTTGACTCGAATGGCATCATCCAGTCCAACAGATTGAGAATATTGCCACAAGAAGACCGTATAAAGCTCCGA
  5   1   1         - In66 5g                         IMAGE:8966172.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCGCCACTAATCGGATACCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGTACAGCTAGAGGCACGCTTGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAGAAGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACCCTCGTCGTGCTGTCTATGACACACCGCAGCTGAACTCGATGCATCATCGCTAAGTCGAGCCACGTATGAGATTGGCTACAGAGTCGGTTAAAAGTCCAAAGACCATGTAATCCAG
  5   1   1         - Neu0                               IMAGE:6992942                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGTACCGGGTCTCGGAATTCTCCGGGATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCCGAGCACAGTATGAAGATATTGGCCAAAAGAGCCGTTTTAGAAGTCGAGAGCATGTATTCAGTTAAGTACCAAGAACTGCAAGC
  3  -1   1         - Lun1      in                         CABD3703.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTGCCAACAAGAGCCGTTTAGAAGTCGAGAGCATGTATNCAGTTAAGTACCAAGAACTGCAGGCATCAGCTG
  5   1   1         - Gas8      in                          st74j12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCANAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCANAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAA
  5   1   1         - Gas1 5g3  in                     NISC_mq07c06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTG
  5   1   1         - Neu0      in                       IMAGE:6992603                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGGTACCGGGGTCCGGAAATTCCCGGGATAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGTAGGTGCTTCCAGTTCCATTTGCCTGACACCCTTCCCTTTACACCTATGGGGAGCCCAGCTCTAAACCGTTGTCTGTGTCTCTTTGGGCAGGATGTGGATGAAGCCTATATTGACAAAGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAAGATTAACTTCCTGCGTCAGCTGTATGAAGAAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCCGTCGTGCTGA
  5   1   1         - Neu  5g                        TNeu041f20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCG
  5   1   1         - Tbd0 5g   ?                      NISC_nl19f07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGGATAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAG
  5   1   1         - Gas  5g                        TGas012n16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCACTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGT
  5   1   1         - Gas1 5g                            IMAGE:6990695                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCTGCGTCAGCTGTATGAAGAGAGCTGCGCGAGCTGCAATCCAGAATTTCGAACACTTCGTCGTGCTGTCTATGGACNNACACCN
  5   1   1         - Gas8 5g3  in                          st37n08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAACGGTTCCGCCATGTCTATCAAAACCACCAGAAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGA
  5   1   1         - Gas1 5g3  in                     NISC_mq15b10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATG
  5   1   1   12    - Gas7 5g3  in                          XZG4844.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTACGGTTCCGCCATGGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCAT
  5   1   1         - Tbd0 5g                            IMAGE:6980981                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAANGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTNCGACAN
  5   1   1   22    - Gas7 5g                              XZG13460.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGA
  5   1   1         - Gas  5g                        TGas044k14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACGGTTCCGCCATGTCTATCAAAACCACCAGGATCACCTACCGCACCAGCAGCGCCACCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAAGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAATGGAGTCTCCTGCAGAACCAGAAAGCCACACGCAGCAACATGGACGCCATGTTTG
  5   1   1         - Lun1 5g3  in                         CABD1588.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACGGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGA
  5   1   1         - Gas8 5g                                st2i02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGGTTCCGCCATGATCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCANCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCANGACCGAGGANAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCANCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGNTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGANATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAG
  5   1   1         - Gas8 5g3  in                          st34i21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGGTTCCGCCATGTCTATCAAAACCACCAGAAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAA
  5   1   1         - Neu  5g                        TNeu007f19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACGGTTCCGCCTGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTG
  5   1   1         - In62                            IMAGE:8953086.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCCCGGGATTAAGGAGGGAGGCAACCCAAACGAATTCGTCCCCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTTGTCCTGCTGAAGATTGATGTGGATGATGCCTATATGAACATGTACAGCTAGAA
  5   1   1         - Tbd0                               IMAGE:6980685                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCTAAGGGGGCCTGTTATCAAACCACCAGAGTCACCTCCTCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCATATTCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAATTTTTGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAAATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGATTTGTCTGCTGAAGAAGATTGGATATGCCTATATAACAAGTACACTAGAGCAGCTTGGAGCCTGACAATGAATTACTCCTGCTCACTGTTGATAGGACTGCCAACGCATCCAATT
  5   1   1         - Gas1 5g                            IMAGE:6990313                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGATCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACATAGCTGGAGAATGAATTTGTCCTGCTGAAAAAGGATGTGGATGAGGCCTATATGAACGAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAAATTTACTTCCTGCGTCAACTGTATGAAGAGGACCTGCGCGAGCTGCAATCCCAAATTCGGAACTTTCCTCG
  5   1   1         - Gas8 5g3  in                          st81i03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGAGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGG
  5   1   1       chi Tbd0 5x                            IMAGE:6979445                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAAGAAGGACGGATCAGAACTCTTCACAACAAGTTTGCCCTCTTTCTTTGAAAAGGGGGGTTTCCCAAAAAACCCAAAAAAAAGGTGTTAAAAACCCAGGGGGAGTCCCCTGGGAAAACCAAAAGGGCCCCCCCCCAACAATTGGGACCCCTGTTTTGGGGGCCCATATGGGCAAACCTGGGGGGGCCCCCCTGGGGGGGGGGGGGCGACAAAAAAAAAAAACCCCCCGGGGGTTTTTACAGGGGGAAAAAAAAATGCGGGGGCCGGGGGGGGAGATTTTTTTTAAAAACAATTTTTTGAGAAAATAAATCCTCCCCCCCCCCCCCCCGCCCGGGGGAAAAATTTTTTTTTCCTCCCCCCAAAAAAAGAGGGGGGGGGAGCCCCTCTTTTTAAAAGAAGGGG
  5   1   1         - Neu0 5g3  in                     NISC_ng26g04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGA
  5   1   1         - TbA  5g                        TTbA040k15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATC
  5   1   1         - Gas8      in                          st40o13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCCGCCATGTCTATCAAAACCACCAGAAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACNGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTANAANAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGNAACATGGACGCCATGTTTGAGGCCTACATCGGNAACCTGAGGCGCCNGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGG
  5   1   1         - Neu  5g                        TNeu046g03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTC
  5   1   1         - Gas8 5g3  in                          st36n08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAA
  5   1   1         - Gas8 5g3  in                          st96f06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACA
  5   1   1         - Gas  5g                        TGas013k20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTCCGCCTGTCTATCAAAACCACCAGATCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGAGTGTCCCTGGCACAGGGAGTGGCACCGACCCCTGGCACTGGCACAGGGAGTGGCACCGACCCCTGGCACTTTGTGCTGACGCACCTTTATTCTGCCTCTCTAGTTTGTGCCTGTAAATATGGCCGAAACGTTGCGCTAAAAGTGATTTACTGATTTCCATACAGATACAGTATCTGTAGCCC
  5   1   1   20    - Ovi1 5g                              CABI2253.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTGCCAACAAGAGCCGTTTAGAAGTCGAGAGCATGTAT
  5   1   1         - Gas8 5g3  in                         st112n01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTCGCCATGTCTATCAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCANAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACA
  5   1   1         - In66                            IMAGE:8964563.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCTTTGTTCTATTCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCGACACTTCGTCGTGCTGTCTATGGACACAACGCAGCCTGACTCGATGCATCATCGCGAGTCGAGCCAGTATGAGAATTTGCACAGATCGTTAAAGTCGAGAGCATGTATCAGTTAGT
  5   1   1   20    - Te1  5g                              CBWN8546.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGCCATGGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCCTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCCGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGA
  5   1   1         - Neu0 5g                            IMAGE:6994214                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAAAGGAGCTGCGCGAGCTGCCATCCCAGATTTCCGACACTTTCGTCGTGCTGTCTATGGGACAACAACCGCAGCCTTTGACCTCCATGGGCATCATCGCCAGAAGGTCCGAGCACAGTTATGGAAGATAATGGCCCACCAAGGAGGCCG
  5   1   1         - Limb      in                        CBSU9321.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGCCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCTTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGC
  5   1   1         - TpA  5g                        TTpA013k18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATGGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAANATCAACAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAAGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTG
  5   1   1         - Gas  5g                        TGas046b18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATGTCTATCAAAACCACCANAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGNGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGATGTGGAT
  5   1   1         - TbA  5g                        TTbA009l20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATGTCTATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTC
  5   1   1         - In63 5g                         IMAGE:8958055.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTGTCTATTCAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGATTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCATAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAATGATGTGGATGAGGCTCTATATGAACAAGGTACAGCTAGAGGCATGCTTGGAGGGCTCTGACAGATGAGATTACTTTCCTGCGTCAGCTGTATGAGAGGAGCTGCGTCGAGCTGCAATCCCAGATTTCCGACATTTCCGTCGTGCTGTCTATGACAACACTGCAGCTTGACCTTCGATGGCATCATCGCAAGGTTCGAGTCACAGATGAGAATTTGTCCACAAGAGCCCGTTTAGAAGTCCGAGAGCCATTGTTATTCCAGTTAAGTAACTC
  5   1   1         - Neu                            TNeu029g14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGGCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGTAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATNTGTCCTGCTGAAGAAGATGTGGAT
  5   1   1         - Neu0                               IMAGE:6991650                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGATAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTGCCCACAAAGAGCCGTTTAGAAGTCGAGAGCATGTATCAAGTTTAGTACCAAGAACTGCC
  5   1   1         - Gas6                                 ANBT2369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGGGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCGGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGAGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGAAGGTCACGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTACAACAGCACAACAAGATGCTAAAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAGCATGGACGCCATGGTTGACGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACTGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTG
  5   1   1         - Lun1      in                         CABD8302.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTGCCCACAAGAGCCGTTTAGAAGTCGAGAGCATGTATCAA
  5   1   1         - TbA                            TTbA068h23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTGCCAACAAG
  5   1   1         - Lun1      in                         CABD1503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTGCCAAC
  5   1   1         - Lun1      in                         CABD5661.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTGCCAACAAGAGCCGTTT
  5   1   1         - TbA                            TTbA005g12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCAAACCACCAGAGTCACCTACCGCACCATCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGC
  5   1   1         - Gas6      in                         ANBT2541.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTGCCAACCAGAGCCGTTTAGAAGTCGAGAGCATGTATCAAGTTAAGTA
  5   1   1         - Neu5      in                         ANHP1884.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGC
  3  -1   1         - Lun1      in                         CABD3698.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTGCCAACAAGAGCCGTTTAGAAGTCGAGAGCATGTATCAAGTTAAGTACCAAGAACTGCAGGCATCAGCTGGTCGCCATGGTGATGACCTGA
  5   1   1         - Tbd0      in                       IMAGE:6976323                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGNACGCCATGTTTGAGGCCTACATCGGCAACCTGGAAGCGCCAGCTGGATGGCCCTGGGGCCAAGAACAAGATGCGCCCTGGGAGTCTGAAGCTGGGGAAATATGCAGGGCCCCTGGGTAGAGGGACTTTTAAGAAACAAATTATTGAAGATGAAAAATCAACCAAGGCCCCACAGAAGGCTGGGAAAAATGGAATTTGGTCCCTGGCTGGAAAAAAAGGGATGGTTGGGATGAAAGGCCCTTATAATGAAAACCAAGGGTAACAAGCCTTAGAGGGCACCGCCCTTTGGGAAGGGCCCCCTGGAACAGGAAATGGAAAAAATTTAACCTTTCCCCTGGGCGGTCC
  5   1   1         - Gas8      in                          st41e12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCACCAGAGTTCACCTTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACA
  5   1   1         - Gas8      in                          st60c10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACCAGTAGTCACCTACCGCANCAGCAGCGCANCCCCCCGCGTCCGGNGGCTTCAGCAGCTACTCGTACTGCGGGGCCCCCGTNAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGNGGCTCCAGNATTGGGGGCTCNAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACANCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTANAACAGCANAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAANAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTT
  5   1   1         - In63                            IMAGE:8959974.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGATGTGGATGAGGCCTATATGAACAAGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAGAGGAGCTGCGCGAGCTGCATCCCAGATTTCGACACTTCGTCGTGCTGTCTATGGACACACCGCAGCTGACCTCGATGCATCATCGCGAGTCGAGCCAGTATGAGATTTGCAACAGAAGCGCTTAGAAGTCGAAAAGACATG
  5   1   1         - Gas0                                 dad26e04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCACCAGAGGGACCNACCGCACCAGCAGCGCAGCCCCCCGCNCCGGCGGCNNCAGCAGGNACNCGNACAGGGGGGCCCCCGCAGCCAGCAGAGCCAGCACGGCCNNCNNCAGCCGGGGANCCAGCTAGGGGGGGGGCAGCANNGGGGGCNCCAGGNNCGGGAGGGGCNACAGGAGCGGGNNGGGGGGNGCAGGNGNGGGCNCGGGAGGGANCACAGNGGNCAGGGNCAANCAGAGCCGGNGGGGACCCCNNAACCGGGAGAACGACCCCACCAGCCAGCAGGGCAGGACCCGGGAGAAGGAACAGANCAAGACGCNNAACAACAGGNNCGNCNCNNNCAAGGACAAGGGGCGNNNCCCAGAACAGCCGAACAAGANGCNGGAAACCAAGGGGAGGCNCCCGCAGAACCGGAAGGCCACACGCAGCAACAGGGGCGGC
  5   1   1         - Neu0                               IMAGE:6995863                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCANGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAAGAGCTGCGCGAGCTGCAATCCCAGATTTCCGAACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCCTGACCTCGATGGCATCATCCCAGAAGTCCCGAGCACAGTATGAAGATATTGCCAAACAAGAGCCCGTTTAGAAGTCCGAAAGCATGTTACCAAGTTAAAGTAACAAGGAACTGCCAGGCTTTCAGCTTGGTCCCCCCTGGTTGAATGACCTGAAAAAAAATAC
  5   1   1         - Lun1      in                         CABD8064.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATC
  5   1   1         - Gas8      in                          st33a17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCACCAGAAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGAC
  5   1   1         - Gas8      in                          st61n06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCACCAGAAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAANAAGNATGTGGATGANGCCTATATGAACAAGGTACAGCTANAGGCACGCTT
  5   1   1         - Gas8      in                          st98m19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACCAGAAGTTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAG
  5   1   1         - Gas8      out                         st99h17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCACCAGAAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCCCCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGAGTGTCCCTGGCACAGGGAGTGGCACCGACCCCTGGCACTGGCACAGGGAGTGGCACCGACCCCTGGCACTTTGTGCTGACGCACCTTTATTCTGCCTCTCTAGTTTGTGCCTGTAAATATGGCCGAAACGTTGCGCTAAAAGTGATTTACTGATTTCCATACAGATACAGTATCTGTAGCCCACTCTTTATTAGCTGCTACAGTCGCAGGACTTTTGCATCAAGTTGTACTGAAGTAATCTGCCAGCTTTGTGCAGA
  5   1   1         - Gas1      in                     NISC_mq01h05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGA
  5   1   1         - Gas8      in                          st42e12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGA
  5   1   1         - Gas8      in                           st4o15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACCAGAGTTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAG
  5   1   1         - Gas8      in                          st56b19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACCAGAGTTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGA
  5   1   1         - Gas8      in                          st95f02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGAC
  5   1   1         - Gas0      in                         dad19f12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGTTGTTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGTGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAG
  5   1   1         - Lun1                                CABD14846.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCAGAGTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACCGCAGCCTTGACCTCGATGGCATCATCGCAGAGGTCCGAGCACAGTATGAAGATATTGCCAACAGAGCCGTT
  5   1   1         - In63                            IMAGE:8959108.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTTTCAACCCTACCGCAACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGATGTGGATGAGCCTATATGACAAGTACAGCTAGAGGCACGCTTGAGGCCTGACAGATGAGATAACTTCCTGCGTCAGCTGTATGAGAGGAGCTGCGCGAGCTGCATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACACACGCAGCTTGACTCGATGGCATCATCGCAGAGGTCCGAGCACAGATGAGATATGCAACAGAGCGTTAGAAGTCGAGAGCTGTATCAGTAGTACAAGACTGCAGCATCACTGTCGCATGGGAGACTGAAATACAGCGAAATATGACTGACCGCTACCCAAGGTCGCATTGAATTGAGGCTCAGCCACGTTCACCTGAG
  5   1   1         - Gas8                                   st1e12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCACCTACCGGCACCAGCAGCGCAGCCCCCCGCTTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATGAANAGGAGCTGCGCGAGC
  5   1   1         - Neu0      in                     NISC_ng06c04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGG
  5   1   1         - Gas8      in                          st23d22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCACCTTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCAGCTGTATG
  5   1   1         - Gas8      in                          st31p09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCACCTACCGCACCAGCAGCGCAGCCCCCCGCTTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACA
  5   1   1         - Gas8      in                          st34i05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCACCTACCGCACCAGCCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGANGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAG
  5   1   1         - Gas8      in                          st67c19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCACCTACCGCACCAGCAGCGCAGNCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAAAGCCANCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACNGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGNTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGANATCGACCCCACCATCCGTCAGGTCAGGACCGAGGANAAGGAACAGATCAAGACTCTCANCAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAG
  5   1   1         - Gas8      in                          st83g21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTAACTTCCTGCGTCA
  5   1   1         - In63                            IMAGE:8959459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCACCTACCGCACCAGCAGCGCAGCCCCCCGCTCCGGCGGCTTCAGCAGCTACTCGTACAGCGGGGCCCCCGCAGCCAGCAGAGCCAGCACTGCCTCCTTCAGCCTGGGATCCAGCTATGGGGGCTCCAGCATTGGGGGCTCCAGGTTCGGGAGTGGCTACAGGAGCGGGTTTGGGGGTGCAGGTGTGGGCTCTGCAGGGATCACAGCGGTCAGTGTCAATCAGAGCCTGCTGGCACCCCTCAACCTGGAGATCGACCCCACCATCCAGCAGGTCAGGACCGAGGAGAAGGAACAGATCAAGACTCTCAACAACAAGTTCGCCTCTTTCATTGACAAGGTGCGTTTCCTAGAACAGCAGAACAAGATGCTAGAAACCAAGTGGAGTCTCCTGCAGAACCAGAAGGCCACACGCAGCAACATGGACGCCATGTTTGAGGCCTACATCGGCAACCTGAGGCGCCAGCTGGATGGCCTGGGCCAAGACAAGATGCGCCTGGAGTCTGAGCTGGGAAATATGCAGGGCCTGGTAGAGGACTTTAAGAACAAATATGAAGATGAAATCAACAAGCGCACAGAGCTGGAGAATGAATTTGTCCTGCTGAAGAAGGATGTGGATGAGGCCTATATGAACAAGTACAGCTAGAGGCACGCTTGGAGGCCCTGACAGATGAGATTACTTCCTGCGTCAGCTGTATGAGAGGAGCTGCGCGAGCTGCAATCCCAGATTTCCGACACTTCCGTCGTGCTGTCTATGGACAACAACTGCAGCTTGACCTCGATGCATCATCGCAGAGTTCGAGCACAGTATTGAGGATTGCTACAAGAGTCGTTTAGAGTCGAGAGCATGTATTCAGTAGTACCAGGACTGCAGGCCATCACCTGC
  5   1   1         - Gas8      in                          st11e18.5p