Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 278.0    0Xt7.1-TNeu125l21.3.5                      113 PI      72        618     1531                ornithine decarboxylase-2 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 99%

 1012153245 Xt7.1-TGas140c13.3.5 - 1150 ESTs
                                                                       ......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas140c13.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTATAAATGAGAGCGAGTAGCGGCACACCTTCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAACATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCTGGGAGATACTATGTGGCCTCTGCTTTTACACTCGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAGGATGCTGCCAATGACAAGACCCTGATGTACTATGTGAATGATGGCGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCAAAACCAGATGAGAGCTTCTACTCAAGCAGCATTTGGGGACCAACCTGTGATGGACTGGATCGTATTGTGGAAAGGTTCGACCTGCCAGAGCTACAAGTTGGAGACTGGATGTTATTTGAGAACATGGGCGCCTACACTGTTGCTGCATCCTCAACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTAATGTCAAGGCCACACTGGCAACTCATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGAACTGAGCGCACACCGTGTATCCTGTGCCCAGGAGAGTGGCATTGAGCTTGCCCCTACCATCTGTCCTACTGCCAGCATCAACGTATAGGCTTATTAACAAACGCTGTAGTTCAACTGCAACTTTAGTCTTGGGACCATTTATTTAAATTTAACTCATTCTTTTTTTCTAGATTGTATTTGCCAGCATTAATGCAACAAAATGGATGACTGTGAGATGGGGTCACATTATCTGTGTTCCTATGGAAACTTTTTTTTATGTTTTTTGAAGTATATTGGAGATGCAAATTATCACTCAAGCATTTGTAGCTTGTGTATTGCCAGTCAGCATCTTCATTGACCAGTTTTACAAATAAAGTGTTCAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008264813                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGAGAGCGAGTAGCGGCACACCxTxxxxxTxxxxGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAACATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCTGGGAGATACTATGTGGCCTCTGCTTTTACACTCGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAGGATGCTGCCAATGACAAGACCCTGATGTACTATGTGAATGATGGCGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCAAAACCAGATGAGAGCTTCTACTCAAGCAGCATTTGGGGACCAACCTGTGATGGACTGGATCGTATTGTGGAAAGGTTCGACCTGCCAGAGCTACAAGTTGGAGACTGGATGTTATTTGAGAACATGGGCGCCTACACTGTTGCTGCATCCTCAACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTAATGTCAAGGCCACACTGGCAACTCATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGAACTGAGCGCACACCGTGTATCCTGTGCCCAGGAGAGTGGCATTGAGCTTGCCCCTACCATCTGTCCTACTGCCAGCATCAACGTATAGGCTTATTAACAAACGCTGTAGTTCAACTGCAACTTTAGTCTTGGGACCATTTATTTAAATTTAACTCATTCTTTTTTTCTAGATTGTATTTGCCAGCATTAATGCAACAAAATGGATGACTGTGAGATGGGGTCACATTATCTGTGTTCCTATGGAAACTTTTTTTTATGTTTTTTGAAGTATATTGGAGATGCAAATTATCACTCAAGCATTTGTAGCTTGTGTATTGCCAGTCAGCATCTTCATTGACCAGTTTTACAAATAAAGTGTTCAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                4     8     4    13     3    17    13    34    82   123   201   263   219   289   247   320   254   329   304   333   304   333   305   334   307   337   313   339   317   339   323   343   322   346   323   346   331   349   334   351   334   354   337   355   342   357   342   360   344   360   346   362   350   365   351   366   352   367   357   371   361   372   317   375   363   379   365   380   369   382   374   385   375   391   381   396   386   396   386   400   389   400   382   397   379   401   383   402   384   402   377   404   380   403   380   401   363   384   368   388   366   384   358   383   355   382   350   381   349   378   350   377   328   356   294   319   269   289   259   277   262   280   256   273   247   267   251   270   236   263   218   253   223   254   220   252   228   250   220   248   215   240   201   227   181   208   171   204   172   205   170   205   167   197   165   191   164   192   162   191   166   188   160   187   162   189   161   187   162   180   161   179   157   178   162   179   158   176   158   177   160   186   167   192   169   194   173   196   176   199   190   210   206   225   229   257   241   276   243   284   241   285   284   327   297   345   325   364   348   387   371   407   404   446   411   455   414   457   428   466   437   475   437   490   451   499   473   515   480   528   481   524   483   538   499   548   520   561   527   568   534   570   531   563   522   566   528   567   537   568   540   571   541   572   532   572   530   570   540   567   541   566   533   567   538   567   526   568   548   570   542   566   533   566   536   563   539   568   545   569   542   565   545   563   534   564   533   565   542   564   538   565   537   565   534   559   483   558   537   559   531   560   501   560   508   564   512   562   510   561   508   560   509   559   501   557   516   554   290   551   271   550   279   549   265   546   265   535   254   526   229   511   217   500   159   419   109   237    39    52    13    24     9    14     7    12
  5   1   2      ests                                 Xt7.1-CABJ9816.5 CCGGCTTTCTGACACGCGGCAGGATTTAGCGTATGGGGCTTGGGAGTCTCGGCTCGGCCCTTCCATGGCGGCTATCGGGCTGGGGGGCCCCTTTCCCATGGCGGCTGTCGGGCTGGGGGGCTCTTTTCCCATGGCGGCTGTCGGGCTCATAGCTGTTGTGTGTCTGACACAGGCTTGGGCTTTTGCAGCAGCTGCTTGCACCCCCAATGGCACTTGTACTCTGAAATCTGATTTCCTCAGAATTAACCATTTTTGTTTAGAGGGAACTTTTTTCATAATAGCTAGAAATAAAGCTTTGAAGCTTTCAGTGTATATACAGATGACATAATGGCTGTGTATGACCTTCCCTGAGTGCGCAATGGCTGCTGGCTTCTGCTACATTGTGTCAGTGTGAGGGCCAGCAGTGTAAGCTCTGCCAGACAAATGCTGCTCAGTAGGAACAAACACACCCTGTACCAGCCAGTTTCTGTATCTGTAAGCTGGGAATGCTCTGGGCACCTGCCTGGTATATTGGTTGATGAAACCATTGGTGATGAAGGGAAACCCTGTGCTTTCCATGAAGTCCCAATAAGGGCAAACCCTTTCTGTAGCTGGGATGCTATTGGCCATAGCCTTGGCTGTTACCACTTATTGGGTGAGCTTTAGTCTGTTGGATGTTCCATGGAAACTATAGGACTGAAAGGATTCATTCCCGGGAGTCCTTCTGACTCAAGGATCTTCCCAGTAATGCTTTTCACGGATCACTGATTATGTGCAGTTTCTCAGCAGTACCACAAACTAAGTCTGACTGCACCATGCAACACCTTCAAATGTGGCAACTTTTTTTCTTTTTTCCCTTGTGTAAGGGCTGAATGGGTGTTTATATGAGGGGGAGGGGTGCCTGTTGCTTGCTGAAAGGGGAAGCAGAGTGTG
  5   1   2      ests                               Xt7.1-TGas140c13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTATAAATGAGAGCGAGTAGCGGCACACCTTCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAACATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCTGGGAGATACTATGTGGCCTCTGCTTTTACACTCGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAGGATGCTGCCAATGACAAGACCCTGATGTACTATGTGAATGATGGCGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCAAAACCAGATGAGAGCTTCTACTCAAGCAGCATTTGGGGACCAACCTGTGATGGACTGGATCGTATTGTGGAAAGGTTCGACCTGCCAGAGCTACAAGTTGGAGACTGGATGTTATTTGAGAACATGGGCGCCTACACTGTTGCTGCATCCTCAACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTAATGTCAAGGCCACACTGGCAACTCATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGAACTGAGCGCACACCGTGTATCCTGTGCCCAGGAGAGTGGCATTGAGCTTGCCCCTACCATCTGTCCTACTGCCAGCATCAACGTATAGGCTTATTAACAAACGCTGTAGTTCAACTGCAACTTTAGTCTTGGGACCATTTATTTAAATTTAACTCATTCTTTTTTTCTAGATTGTATTTGCCAGCATTAATGCAACAAAATGGATGACTGTGAGATGGGGTCACATTATCTGTGTTCCTATGGAAACTTTTTTTTATGTTTTTTGAAGTATATTGGAGATGCAAATTATCACTCAAGCATTTGTAGCTTGTGTATTGCCAGTCAGCATCTTCATTGACCAGTTTTACAAATAAAGTGTTCAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------T--A--
                                               BLH ATG     359    2590                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH MIN     359     254                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH MPR     218     254                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH OVR     359    1197                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               CDS MIN     359     254                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               EST CLI      43      56                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               ORF LNG     359     166                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Sp ==== 2e-084     XP_001202483.1 PREDICTED: similar to ornithine decarboxylase, partial [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Sc ---- 1e-089     NP_012737.1 Rate limiting step of polyamine biosynthesis pathway; Spe1p [Saccharomycescerevisiae] ------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 4e-090     NP_477052.2 CG8721-PA [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 6e-099     NP_504752.1 Ornithine decarboxylase ODC-1 (46.9 kD) (odc-1) [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Dr ==== 0          NP_571876.1 ornithine decarboxylase 1 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 0          NP_038642.1 ornithine decarboxylase, structural [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 0          NP_002530.1 ornithine decarboxylase 1 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Gg ==== 0          XP_419949.2 PREDICTED: similar to ornithine decarboxylase [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Xl ==== 0          AAH44004.1 Unknown (protein for MGC:52612) [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 0          NP_001080167.1 ornithine decarboxylase 1 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 0          AAH74547.1 Ornithine decarboxylase 1 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas140c13.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGA---------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------TAG---------TGA------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------TAG------TAA---------TAG------------------------------------------------------------------------------TAA---------ATG------------ATG---------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   1           Tbd0 FL                     IMAGE:5335701.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAGCATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCTGGGAGATACTATGTGGCCTCTGCTTTTACACTCGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAGGATGCTGCCAATGACAAGACCCTGATGTACTATGTGAATGATGGCGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCAAAACCAGATGAGAGCTTCTACTCAAGCAGCATTTGGGGACCAACCTGTGATGGACTGGATCGTATTGTGGAAAGGTTCGACCTGCCAGAGCTACAAGTTGGAGACTGGATGTTATTTGAGAACATGGGCGCCTACACTGTTGCTGCATCCTCAACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTAATGTCAAGGCCACACTGGCAACTCATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGAACTGAGCGCACACCGTGTATCCTGTGCCCAGGAGAGTGGCATTGAGCTTGCCCCTACCATCTGTCCTACTGCCAGCATCAACGTATAGGCTTATTAACAAACGCTGTAGTTCAACTGCAACTGTAGTCTTGGGACCATTTATTTAAATTTAACTCATTCTTTTTTTCTAGATTGTATTTGCCAGCATTAATGCAACAAAATGGATGACTGTGAGATGGGGTCACATTATCTGTGTTCCTATGGAAACTTTTTTTTTATGTTTTTTGAAGTATATTGGAGATGCAAATTATCACTCAAGCATTTGTAGCTTGTGTATTGCCAGTCAGCATCTTCATTGACCAGTTTTACAAATAAAGTGTTCAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg063i14.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAGCATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCTGGGAGATACTATGTGGCCTCTGCTTTTACACTCGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAGGATGCTGCCAATGACAAGACCCTGATGTACTATGTGAATGATGGCGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCAAAACCAGATGAGAGCTTCTACTCAAGCAGCATTTGGGGACCAACCTGTGATGGACTGGATCGTATTGTGGAAAGGTTCGACCTGCCAGAGCTACAAGTTGGAGACTGGATGTTATTTGAGAACATGGGCGCCTACACTGTTGCTGCATCCTCAACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTAATGTCAAGGCCACACTGGCAACTCATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGAACTGAGCGCACACCGTGTATCCTGTGCCCAGGAGAGTGGCATTGAGCTTGCCCCTACCATCTGTCCTACTGCCAGCATCAACGTATAGGCTTATTAACAAACGCTGTAGTTCAACTGCAACTGTAGTCTTGGGACCATTTATTTAAATTTAACTCATTCTTTTTTTCTAGATTGTATTTGCCAGCATTAATGCAACAAAATGGATGACTGTGAGATGGGGTCACATTATCTGTGTTCCTATGGAAACTTTTTTTTTTATGTTTTTTGAAGTATATTGGAGATGCAAATTATCACTCAAGCATTTGTAGCTTGTGTATTGCCAGTCAGCATCTTCATTGACCAGTTTTACAAATAAAGTGTTCAAACAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-CABJ9816.5 CCGGCTTTCTGACACGCGGCAGGATTTAGCGTATGGGGCTTGGGAGTCTCGGCTCGGCCCTTCCATGGCGGCTATCGGGCTGGGGGGCCCCTTTCCCATGGCGGCTGTCGGGCTGGGGGGCTCTTTTCCCATGGCGGCTGTCGGGCTCATAGCTGTTGTGTGTCTGACACAGGCTTGGGCTTTTGCAGCAGCTGCTTGCACCCCCAATGGCACTTGTACTCTGAAATCTGATTTCCTCAGAATTAACCATTTTTGTTTAGAGGGAACTTTTTTCATAATAGCTAGAAATAAAGCTTTGAAGCTTTCAGTGTATATACAGATGACATAATGGCTGTGTATGACCTTCCCTGAGTGCGCAATGGCTGCTGGCTTCTGCTACATTGTGTCAGTGTGAGGGCCAGCAGTGTAAGCTCTGCCAGACAAATGCTGCTCAGTAGGAACAAACACACCCTGTACCAGCCAGTTTCTGTATCTGTAAGCTGGGAATGCTCTGGGCACCTGCCTGGTATATTGGTTGATGAAACCATTGGTGATGAAGGGAAACCCTGTGCTTTCCATGAAGTCCCAATAAGGGCAAACCCTTTCTGTAGCTGGGATGCTATTGGCCATAGCCTTGGCTGTTACCACTTATTGGGTGAGCTTTAGTCTGTTGGATGTTCCATGGAAACTATAGGACTGAAAGGATTCATTCCCGGGAGTCCTTCTGACTCAAGGATCTTCCCAGTAATGCTTTTCACGGATCACTGATTATGTGCAGTTTCTCAGCAGTACCACAAACTAAGTCTGACTGCACCATGCAACACCTTCAAATGTGGCAACTTTTTTTCTTTTTTCCCTTGTGTAAGGGCTGAATGGGTGTTTATATGAGGGGGAGGGGTGCCTGTTGCTTGCTGAAAGGGGAAGCAGAGTGTG
                                                  Xt7.1-CHK-1008247875       TTCTGACACGCGGCAGGATTTAGCGTATGGGGCTTGGGAGTCTCGGCTCGGCCCTTCCATGGCGGCTATCGGGCTGGGGGGCCCCTTTCCCATGGCGGCTGTCGGGCTGGGGGGCTCTTTTCCCATGGCGGCTGTCGGGCTCATAGCTGTTGTGTGTCTGACACAGGCTTGGGCTTTTGCAGCAGCTGCTTGCACCCCCAATGGCACTTGTACTCTGAAATCTGATTTCCTCAGAATTAACCATTTTTGTTTAGAGGGxAxTxxTTTCATAATAGCTAGAAATAAAGCTTTGAAGCTTTCAGTGTATATACAGATGACATAATGGCTGTGTATGACCTTCCCTGAGTGCGCAATGGCTGCTGGCTTCTGCTACATTGTGTCAGTGTGAGGGCCAGCAGTGTAAGCTCTGCCAGACAAATGCTGCTCAGTAGGAACAAACACACCCTGTACCAGCCAGTTTCTGTATCTGTAAGCTGGGAATGCTCTGGGCACCTGCCTGGTATATTGGTTGATGAAACCATTGGTGATGAAGGGAAACCCTGTGCTTTCCATGAAGTCCCAATAAGGGCAAACCCTTTCTGTAGCTGGGATGCTATTGGCCATAGCCTTGGCTGTTACCACTTATTGGGTGAGCTTTAGTCTGTTGGATGTTCCATGGAAACTATAGGACTGAAAGGATTCATTCCCGGGAGTCCTTCTGACTCAAGGATCTTCCCAGTAATGCTTTTCACGGATCACTGATTATGTGCAGTTTCTCAGCAGTACCACAAACTAAGTCTGACTGCACCATGCAACACCTTCAAATGTGGCAACTTTTTTTCTTTTTTCCCTTGTGTAAGGGCTGAATGGGTGTTTATATGAGGGGGAGGGGTGCCTGTTGCTTGCTGAAAGGGGAAGCAGAGTGTGACAAGT
  5   1   1       add TpA       in                   TTpA076n21.p1kSP6 CCGGCTTTCTGACACGCGGCAGGATTTAGCGTATGGGGCTTGGGAGTCTCGGCTCGGCCCTTCCATGGCGGCTATCGGGCTGGGGGGCCCCTTTCCCATGGCGGCTGTCGGGCTGGGGGGCTCTTTTCCCATGGCGGCTGTCGGGCTCATAGCTGTTGTGTGTCTGACACAGGCTTGGGCTTTTGCAGCAGCTGCTTGCACCCCCAATGGCACTTGTACTCTGAAATCTGATTTCCTCAGAATTAACCATTTTTGTTTAGAGGGGAATGCAGTCATAATAGCTAGAAATAAAGCTTTGAAGCTTTCAGTGTATATACAGATGACATAATGGCTGTGTATGACCTTCCCTGAGTGCGCAATGGCTGCTGGCTTCTGCTACATTGTGTCAGTGTGAGGGCCAGCAGTGTAAGCTCTGCCAGACAAATGCTGCTCAGTAGGAACAAACACACCCTGTACCAGCCAGTTTCTGTATCTGTAAGCTGGGAATGCTCTGGGCACCTGCCTGGTATATTGGTTGATGAAACCATTGGTGATGAAGGGAAACCCTGTGCTTTCCATGAAGTCCCAATAAGGGCAAACCCTTTCTGTAGCTGGGATGCTATTGGCCATAGCCTTGGCTGTTACCACTTATTGGGTGAGCTTTAGTCTGTTGGATGTTCCATGGAAACTATAGGACTGAAAGGATTCATTCCCGGGAGTCCTTCTGACTCAAGGATCTTCCCAGTAATGCTTTTCACGGATCACTGATTATGTGCAGTTTCTCAGCAGTACCACAAACTAAGTCTGACTGCACCATGCAAACACCTTCAATGTGGCAACTTTTTTTT
  5   1   2      seed HdA       in                   THdA042c09.p1kSP6                       GGGCTTGGGAGTCTCGGCTCGGCCACTTCCATGGCGGCTATCGGGCTGGGGGGCCCCTTTCCCATGGCGGCTGTCGGGCTGGGGGGCTCTTTTCCCATGGCGGCTGTCGGGCTCATAGCTGCTGTGTGTCTGACACAGGCTTGGGCTTTTGCAACAGCTGCTTGCACCCCCAATGGCACTTGTACTCTGAAATCTGATTTCCTCAGAATTAACCATTTTTGTTTAGAGGGGAATGCAGTCAAAACTTTTTTCATAATAGCTAGAAATAAAGCTTTGAAGCTTTCAGTGTATATACAGATGACATAATGGCTGTGTATGACCTTCCCTGAGTGCGCAATGGCTGCTGGCTTCTGCTACATTGTGTCAGTGTGAGGGCCAGCAGTGTAAGCTCTGCCAGACAAATGCTGCTCAGTAGGAACAAACACACCCTGTACCAGCCAGTTTCTGTATCTGTAAGCTGGGAATGCTCTGGGCACCTGCCTGGTATATTGGTTGATGAAACCATTGGTGATGAAGGGAAACCCTGTGCTTTCCATGAAGTCCCAATAAGGGCAAACCCTTTCTGTATCTGGGATGCTATTGGCCATAGCCTTGGCTGTTACCACTTATTGGGTGAGCTTTAGTCTGTTGGATGTTCCATGGAAACTATAGGACTGAAAGGATTCATTCCCGGGAGTCCTTCTGACTCAAGGATCTTCCCAGTAATGCTTTTCACGGATCACTGATTATGTGCAGTTTCTCAGCAGTACCACAAACTAAGTCTGACTGCACCATGCAACACCTTCAAATGTGGCAACTTTTTT
  5   1   2       chi Ski1      in                         CABJ9816.5p                                                                                                                                                                                                                                                    TTAGAGGGGAATGCAGTCAAAACTNTTTTTCATAATAGCTAGAAATAAAGCTTTGAAGCTTTCAGTGTATATACAGATGACATAATGGCTGTGTATGACCTTCCCTGAGTGCGCAATGGCTGCTGGCTTCTGCTACATTGTGTCAGTGTGAGGGCCAGCAGTGTAAGCTCTGCCAGACAAATGCTGCTCAGTAGGAACAAACACACCCTGTACCAGCCAGTTTCTGTATCTGTAAGCTGGGAATGCTCTGGGCACCTGCCTGGTATATTGGTTGATGAAACCATTGGTGATGAAGGGAAACCCTGTGCTTTCCATGAAGTCCCAATAAGGGCAAACCCTTTCTGTAGCTGGGATGCTATTGGCCATAGCCTTGGCTGTTACCACTTATTGGGTGAGCTTTAGTCTGTTGGATGTTCCATGGAAACTATAGGACTGAAAGGATTCATTCCCGGGAGTCCTTCTGACTCAAGGATCTTCCCAGTAATGCTTTTCACGGATCACTGATTATGTGCAGTTTCTCAGCAGTACCACAAACTAAGTCTGACTGCACCATGCAACACCTTCAAATGTGGCAACTTTTTTTCTTTTTTCCCTTGTGTAAGGGCTGAATGGGTGTTTATATGAGGGGGAGGGGTGCCTGTTGCTTGCTGAAAGGGGAAGCAGAGTGTGACAAGTCATTGTGGCCTTTTTCTCCTGTTAGTGGTGTCAGTGGATCAAACTTCAAGTACTTATTACAATGTCTCCTCTTGCAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTNCTACTTGTCC
  5   1   2      ests                               Xt7.1-TGas140c13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTATAAATGAGAGCGAGTAGCGGCACACCTTCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAACATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCTGGGAGATACTATGTGGCCTCTGCTTTTACACTCGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAGGATGCTGCCAATGACAAGACCCTGATGTACTATGTGAATGATGGCGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCAAAACCAGATGAGAGCTTCTACTCAAGCAGCATTTGGGGACCAACCTGTGATGGACTGGATCGTATTGTGGAAAGGTTCGACCTGCCAGAGCTACAAGTTGGAGACTGGATGTTATTTGAGAACATGGGCGCCTACACTGTTGCTGCATCCTCAACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTAATGTCAAGGCCACACTGGCAACTCATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGAACTGAGCGCACACCGTGTATCCTGTGCCCAGGAGAGTGGCATTGAGCTTGCCCCTACCATCTGTCCTACTGCCAGCATCAACGTATAGGCTTATTAACAAACGCTGTAGTTCAACTGCAACTTTAGTCTTGGGACCATTTATTTAAATTTAACTCATTCTTTTTTTCTAGATTGTATTTGCCAGCATTAATGCAACAAAATGGATGACTGTGAGATGGGGTCACATTATCTGTGTTCCTATGGAAACTTTTTTTTATGTTTTTTGAAGTATATTGGAGATGCAAATTATCACTCAAGCATTTGTAGCTTGTGTATTGCCAGTCAGCATCTTCATTGACCAGTTTTACAAATAAAGTGTTCAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008221111                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGAGAGCGAGTAGCGGCACACCxTxxxxxTxxxxGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAACATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCTGGGAGATACTATGTGGCCTCTGCTTTTACACTCGCAGTTAATATCATTGCCAAGAAAGTTATGGTGAATGAGCAAAGTGGATCTGATGATGAAGAGGATGCTGCCAATGACAAGACCCTGATGTACTATGTGAATGATGGCGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCAAAACCAGATGAGAGCTTCTACTCAAGCAGCATTTGGGGACCAACCTGTGATGGACTGGATCGTATTGTGGAAAGGTTCGACCTGCCAGAGCTACAAGTTGGAGACTGGATGTTATTTGAGAACATGGGCGCCTACACTGTTGCTGCATCCTCAACATTCAATGGATTTCAGAGACCAACCCTTTATTATGTAATGTCAAGGCCACACTGGCAACTCATGCATGATATTAAAGAACATGGCATTCTCCCTGAAGTACCAGAACTGAGCGCACACCGTGTATCCTGTGCCCAGGAGAGTGGCATTGAGCTTGCCCCTACCATCTGTCCTACTGCCAGCATCAACGTATAGGCTTATTAACAAACGCTGTAGTTCAACTGCAACTTTAGTCTTGGGACCATTTATTTAAATTTAACTCATTCTTTTTTTCTAGATTGTATTTGCCAGCATTAATGCAACAAAATGGATGACTGTGAGATGGGGTCACATTATCTGTGTTCCTATGGAAACTTTTTTTTATGTTTTTTGAAGTATATTGGAGATGCAAATTATCACTCAAGCATTTGTAGCTTGTGTATTGCCAGTCAGCATCTTCATTGACCAGTTTTACAAATAAAGTGTTCAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Te5       in                         CAAO2977.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGCTCTATACGCGGGAAGCCCTGCGGAAGGAGGAGGGGACTGTGGCAGCCCCGGAGCAAACCGATCAGGGCTGGTTTGAGCTGGCGCGTCTCCATGGCGACGAGGGCGGCACTATAAATGAGAGCGAGTAGCGGCACACCTTCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGANATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTA
  5   1   2   11  bld Lun1 5g3  in                         CABD2557.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCGATTCAATTCGGCCGAGGCGGAAGGAGGAGGGGACTGCCGGCAGCCCCGGAGCAAACCGATCAGGGCTGGTTTGAGCTGGCGCGTCTCCATGGCGACGAGGGCGGCACTATAAATGAGAGCGAGTAGCGGCACACCTTCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCA
  5   1   2       bld 1030 5g                         IMAGE:7092046.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAACGTGGTAGATTGCCTAGTTAGAANNANCNCNCNNGTGTCACTCCCAGGTACAACTGCACCTCNNTTCTNTCCGGNCCCCATACAANCTACTTGTTCTTTTTNCACTCNANTTAATTAATCCCCCCCCCCCCCCCTCATTCACATTAATCTCTCANCTCTTCNATTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATTGTACGTTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCCTCGTGGAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAATAAGACCGAAATCCAACTAGTACGAAGTATTGGAGTGGCATCTGACCGAATTACTTTGCAACCCATGAAACAAGTTCCCCAAT
  5   1   2       chi Tbd0 5x   in                       IMAGE:6976529                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCCCCCCACGCCCACCCCACCCCCCCCCGCGCCGCCGCGACCGCCCCCCCCCCCCCCCCCCCCACGCACGCTGGTCCGGTCCGGAATTCCCGCGGATCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGCAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAAGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGACCAAAAGATCAATGAAGTGCCCTTATCTGATGACAAAGATGCCTTTTATGTTGCCTGATCTTTGGTGACATTGTGAAAAAGCCTGTACCGTTGGGTTTTAAAGCACTCCCCACGTGGTCCCTCCCATTTTTATGCTTGTAAAAATGGCCATGGACAGCAAAGCCCTTCCGTGGAAAGAACTCTCTTCCCCCTCCCCTTTGGGTGCCAGGGCTTTTGAAACTGTTGCCCAATTCAAGAACGGGGAAATTCCCCAACCTTAGTTACAAAAAGTAATTTGGGAAGTGGTCCATTTCTTGCAAGCCGAAATTTAATCCCTAAGCCCCAAATTCCCCTGGGTTAAAAACAAGGTTTCCTCCCCCAAGAATTCCAAAATTTACCGCCACACCCTAGGTCTCGTTGGGGTCGGGTTTTGCGCCCAAACACTCTGCCCCCTTTCTTTGGGCACAACCGTGTGAAAGATTTTGTNAAACCTCTTAAGTGGAAAAAAAACTGCGGGCCCAAAGGGGGAAAAATCTCCCCCCCCCCCAAAAAATGGCCCAAAAAAAGCCCCTGGGGGGATCCCCCGGGGGCCGCCTTTCTTAAGACCACAACTCCTTGCA
  5   1   2   14  bld Te5  5g3  in                        CAAO10032.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGCGTCTCCATGGCGACGAGGGCGGCACTATAAATGAGAGCGAGTAGCGGCACACTCTTCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACT
  5   1   2       bld Te5       in                         CAAO2668.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGACGAGGGCGGCACTATAAATGAGAGCGAGTAGCGGCACACCTTCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGC
  5   1   2   14  bld Te5  5g3  in                         CAAO2100.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGGCACTATAAATGAGAGCGAGTAGCGGCACACTCTTCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCCAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCT
  5   1   2       bld Gas1 5g                            IMAGE:6987712                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGGCGTGGGGTACCGGGGTCCGGGAATTCCCGGGGATGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAGGAATCACCAAATGCAAGCTTGTCTGCGA
  5   1   2       bld Te5       in                         CAAO9332.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATAAATGAGAGCGAGTAGCGGCACACCTTCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGANATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAA
  5   1   2       bld In63 5g                         IMAGE:8961394.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTTTTTTTGTTGTTTTTATTTTCTTTTAAAATCGTCCCGTAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAATTTGTGCCACCTAAACAGCAGCTGCTTCTGGAGCGGGCAAAGAGCTATGTGAATATGTGTAGTTCATGTGCAGTGCTGCACTGATCCTCGACTATGTAAGCTGTCTCAATGCCGATGGCCTTGACTGGGCTGACCTGGATTCATGCATTACTGGATGGGAGATCTGTTCAGAGACATAACTGAAATGGA
  5   1   2       bld Te5       in                         CAAO7079.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGAGAGCGAGTAGCGGCACACCTTCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTG
  5   1   2       bld Te5       in                         CAAO8295.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     NNCGTCCGTAGCGGCACANCCTTCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGNCAGGAATCACCCANATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGT
  5   1   2       bld Gas1 5g                            IMAGE:6987227                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTGGGGTACCCGGGTCCGGAATTCCCGGGGATCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAAACTATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGGTCTGCGCATAGNCACTGATGACTCAAAAGCTGTCTGCCGCT
  5   1   2   12  bld Gas7 5g3  in                         XZG46228.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGTAAGCTCTCAGCTCTGCGAGTGCTGGTTAAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCNAAAGCTGTCTGCCGCCTCAGTGTAA
  5   1   2   10  bld Lun1 5g3  in                         CABD2850.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCACACCTTCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGC
  5   1   2       bld Ski1      in                        CABJ10454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGTAAGTTTGGCATTATGGTGACCTATGTTAAAATGTCAGTGTCGTTATAAAGTGTTAATGAACTGCAATACCTCTTTCTAGGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAG
  3  -1   2       bld Neu       in                    TNeu060d21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGTCGACACTAGTTCTCAAGCTCTCAGCTCTGCGAGTGCTGGTTAAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTATCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCA
  5   1   2       bld BrSp 5g3  in                    EC0CBA001BD12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCA
  5   1   2       bld 1030 5g                         IMAGE:7029406.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAATGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAAGCTTTGACTGTGCCANTAAGACGGGAAATCCAACTAGTTACAAGTATTGGAGTGTCATCTGAGCGAAATTATCTATGCAAATCCATTGGTAAAAAAGTCTCCCAGATCAAATATGGCACCTTACCTGTGGGGGTTGAAAAAAATGGACTTTTGGACCGTGGAAA
  5   1   2       bld 1030 5g                         IMAGE:7030557.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGANATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGGAGTTTGACTAATGAAAGTGGCAAGGGATCCCCCAAAATGCAAAGCTTGGTTCTGGCGCATTACAAACTGATGAACCCCAAAGCTGGTCTGT
  5   1   2       bld 1030 5g                         IMAGE:7092533.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGNTACAAGTATTGGAGTGTCATCTGAGCGAATATCTATGCAAATCATGTAAACAGTC
  5   1   2       bld 1030 5g                         IMAGE:7028809.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCANGCTTTGACTGTGCCAGTAAGACGGANATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGANATATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAAAATGACTTTTTGACAGTGAAGTTGAAACTAATTGAAGGTGGGCAAGGAAATCACCCAAATTGCAAAGCTTGG
  5   1   2       bld 1030 5g                         IMAGE:7028890.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTCATTCACAGTAAGCTATCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATTCCACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAAACAAGTCTCCCAGATCAAATACGCAACTAGCTGTGGTGGTTGAAAAAAAGACTTTTTAACAGTGAAAGTAGAACTAATG
  5   1   2       chi 1030                            IMAGE:7026734.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGAGTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTATGACTAGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAGATTGAACAGCTTCAGCAACGACGACTTTGAATTCATTTTCCTGGAGGAAGGTTTCTGTGCCATGGATATTGTGGAGCTAAAGAATAATGAATTGTTCTTATTTGATGAACTAAGATGGCCTTTTTATGTCTGCATGATGCCTTGGGGGACATATGGCGAAGAAAGCCAGGTGAGTGTTTGGGTTTTAAAACCACTACCCCACGCAGGGGGGGCGCCAAGTTTTTAAGGCATTAGAAAAAATGGGAGATGGGACCATGTAAAAAGTTCCAGTTCCTGAGGGAAGAAAACATCCGCGCTCCACCCGCGCCCTGGTGGGGTAGCACGCGGAGATGTTGTGAGAAATTTGGTGGTGTCCGCATGGTTATAAGGGGAGCGAGGAAACATGTAGTCTCGTAAACATCTATGGCTTTAAATCTTACGAAGGTTGGTTAAGGTTGGTGAAATAAATTTGGGGTTGCCAACCCTCCATATGGAGAAAAAGATGACGAGAAGGAGGCAGATTTAAACCGGCACAGAAGNTGTGGGGACCTAAAGAAATAACCTCCCCCAACTGGTGGCTTTATTCAAAACCGCACGATTGCTATTCTCNNTTCCCACCTATCATATATGAATTTAACACAATCTGTATTTGGGATTGAAACGGCTAATAAGAAAGTCTTGTGTTTGAGGTAGTGAAATTTTTTGGATGGNAGCTATTAAGAGATGGGACTCTNCGTTTTTTTGGGCACCTTATGTGTCCTGTTGGCTTCTTTNGATATCTCTTAAATNCTGGGGGAAGTAAGTCAAAAAACGAAGTGTGTAAATCCTAAAACTGTATCATAAAAAGTAGATCAAAAAAAACGAGGTATAACTATTTCGCCCCTGCATCTTCCCTTATATAGGGAGTAAAACACATTTAAAATAAATCGAAGGATATACAATCNCTTCACCTATTANACATGGTTAATAAAAAATATCGTAGGAGAGTCTCATAGCTTCGATGACGACATACTCTATACTTTTTATTTATACTTGAGGAGGCAAGG
  5   1   2       bld 1030 5g                         IMAGE:7093371.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATAGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTA
  5   1   2   12  bld Gas7 5g3  in                         XZG24924.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCTGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCA
  5   1   2   12  bld Gas7 5g3  in                         XZG53005.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCCACTGATGACTCAAAAGCTGTCT
  5   1   2       bld 1030 5g                         IMAGE:7091470.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTAGGTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCCAGTAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCN
  5   1   2       bld HeRe 5g3  in                     EC2CAA11BH11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTA
  5   1   2       bld HeRe 5g                           EC2CAA3DF02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGT
  5   1   2       bld TbA  5g3  in                   TTbA050h13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGGGCCCGGGGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGANATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCT
  5   1   2       bld Egg  5g                        TEgg094d11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCACAGTAAGCTCTCAGCTCTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACT
  5   1   2       bld Egg  5g3  in                   TEgg073k01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGGCCCGGGGCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2       bld Egg  5g                        TEgg123f09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGGGAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAAGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAA
  3  -1   2       bld Neu       in                    TNeu107k16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTATTTTATTTCTTTACAGTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGA
  5   1   2       bld Gas1 5g3  in                       IMAGE:6989863                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATTCCGGGATCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGGATTATCTATGCAAATCCATGGTAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGGACTAATGAAGTGGGCAGGATCCCCCAATGCAAGCTTGTTCTGCCATAGCACTATGACCCAAAGCGTCTGCGCCCCGGGTAAN
  5   1   2       bld TbA  5x   in                   TTbA058n08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCTTCGCGAGTGGTGAATACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTAAAGACTTCGTAAATGTTTTTTAAGAATTAAAACAGCAGAAACAGCGCCAGAGCGGCTCCATTGAGAGCCGTAGGAATTGTCCTCTACTTACAGGCTTCTATTTACCGGCGAGCCCTTCTTGGGAGTGAAACTGAAGCCTTTCTTTATAGTTATTCCCCCATCCTCCTTAACTTGTCCATTTTTGTTGCATAGTTTGCCTCTTGAAACCAAAATAACCTGCAAAAATGAACAGCTTCAGTAACCACCACTTTGACTTCAGTTTCCTGGAAGAAGGTTTCCTGTGCCAGGGATATTGTGGAACAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATG
  5   1   2   14  bld Te5  5g3  in                         CAAO1443.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCACGCGTCCGCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCA
  5   1   2       bld Gas1 5g3  in                       IMAGE:6990810                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTCCAGGATCTCNGCTCTGCGAGTGCTGTTTCCGGATAGTGGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCACATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGAACGTGAAGTTGAACTAATGAAAGTGGCAAGGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTTGATGACTCAAAAGCTGTCTGGCCGCCTCAGTGGTAAAATTTGGGTGCCCCCCTTAAAACAAGCAGGCTGCTTTCTGGAACCGGGCAAAAGAACTTAAAGTGGGAAATAATTGGGTGTAAAGTTTCCCG
  5   1   2       bld Neu0 5g                            IMAGE:6995825                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGGCAGGAAATCACCANATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAAGCTGCTTTCTGGAGCGGGCAAAAGAGCTTAATGGGGGAAATAAATTGGNTGTTAGGTTTCCATGGTTGGGCAGTGG
  5   1   2       bld AbdN 5g                            IMAGE:7022776                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCANGCTTTGACTGTGCCCAGTAGACGGAAATCCAACTAGTACAAAGTATTGGNAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACCAGTCTCCCAAATCAAATATGCAGCTAGCTGTGGGTGTTGAGAAGATGACTTTTGACAGTGGAAGTTGACCTATTGAAAAGTGGCAAGGAATCCCCCCAAATGCCAAAGCTTGTTCTGGCGCATAGCCACCTGAATGACTTCAAAAAGCTTGTCTGCCCGCCCCCCAGTGTAAAAAATTT
  5   1   2       bld Egg  5g                        TEgg133n19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTAAGCTCTCAGCTCTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2       bld Gas  5g                        TGas100a05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2   12  bld Gas7 5g3  in                         XZG31099.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAAGCTCTCAGCTCTGCGAGTGCTGGTTAAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTG
  5   1   2   12  bld Tad5 5g3  in                         XZT25184.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGGAAGG
  5   1   2       bld Egg  5g3  in                   TEgg030l05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGCCGGTTTAAAG
  5   1   2       bld Neu  5g3  in                   TNeu079p03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2       bld Tbd0 5g3  in                       IMAGE:6976355                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAAGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCCGCCTCAGTGTAAAAATTTGGTGCCACCCTTTAAAACAAGCAAGGCTGCTTTCTGGAGCGGGGCAA
  5   1   2       bld Gas1 5g3  in                       IMAGE:6989308                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACNNTATGAAGTGGGCAGGAAATCACCANATGCNAAGCTTGGTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAATTTGGGTGCACCNTAAA
  5   1   2       bld Gas1 5g3  in                     NISC_mq11g03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAAT
  5   1   2   12  bld Gas7 5g3  in                         XZG14897.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTG
  5   1   2   12  bld Gas7 5g3  in                         XZG23239.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCT
  5   1   2   12  bld Gas7 5g3  in                         XZG28980.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGTTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTG
  5   1   2   12  bld Gas7 5g3  in                         XZG51175.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAAGCTCTCAGCTCTGCGAGTGCTGGTTAAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGGCAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCT
  5   1   2   12  bld Tad5 5g3  in                         XZT60334.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCT
  5   1   2       bld Gas8 5g3  in                          st74d24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCANAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGT
  5   1   2       bld Tbd1      out                        CBXT1414.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGAC
  5   1   2       bld Egg  5g3  in                   TEgg005e03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATG
  5   1   2       bld Egg  5g3  in                   TEgg032j15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATC
  5   1   2       bld Egg  5g3  in                   TEgg040k04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCA
  5   1   2       bld Egg  5g3  in                   TEgg042f12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATG
  5   1   2       bld Egg  5g                        TEgg084n01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGGCTCAGCTCTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTA
  5   1   2       bld Egg  5g                        TEgg088d16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGGGCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATG
  5   1   2       bld Egg  5g                        TEgg103l15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCT
  5   1   2       bld Egg  5g                        TEgg140c19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGT
  5   1   2       bld Gas  5g3  in                   TGas108o19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2       bld Neu  5g3  in                   TNeu104j14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTAAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAA
  5   1   2       bld Egg0 5g3  in                         dad73h11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGGCTGCAGCTCTGCGATTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTTTTGAAACAAAATACTGCAAAAATGAACAGCTTCAACAATGACGACTTTGACTTCAATTTTCTGGAAGAAAGGTTTTGTGCCAAGGATATTGTGGAGCAAAAGATC
  5   1   2       bld Gas1 5g                            IMAGE:6988803                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGNCAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGNAAGTGGCAGGAATCACCAAATGCAAGCTTGTCTGCGCATAGCACTGATGATC
  5   1   2       bld Neu0 5g                            IMAGE:6993368                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGGAATCACCCAAATGCAAAAGCTTGGTTCTGCCGCATAGCAACTGGATGACCTCAAAAAAGCTGTCTTGGCCGCCCTCCAGTGGTAAAAAATTTTGGGTGGCCACCCCCTTATAAAACAAAGGCAAGGGCTTGGCTTTTCCTGGGGAGGCGGGGGGCCAAAAAAC
  5   1   2       bld Gas1 5g3  in                     NISC_mq05h04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCG
  5   1   2       bld Gas1 5g3  in                     NISC_mq15d04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGATCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCCACT
  5   1   2       bld Neu  5g                        TNeu045c24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTG
  5   1   2       bld TbA  5g3  in                  TTbA006f01.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGC
  5   1   2       bld TbA  5g3  in                   TTbA012i04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGGGTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTC
  5   1   2       bld TbA  5g3  in                   TTbA067a09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAAGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATAC
  5   1   2   12  bld Gas7 5g3  in                         XZG20637.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAG
  5   1   2       bld Egg  5g3  in                   TEgg001i07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATC
  5   1   2       bld Egg  5g3  in                   TEgg009p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCAT
  5   1   2       bld Egg  5g3  in                   TEgg039l03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATT
  5   1   2       bld Egg  5g                        TEgg097g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGGGCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTA
  5   1   2       bld Gas  5g3  in                  TGas096m18.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAA
  5   1   2       bld TpA  5g3  in                   TTpA002j02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTNTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAGCACTCCCACGTGTCACTCCCATTTATGCTGTAAAATGCAATGAC
  5   1   2       bld Egg0 5g3  in                         dad76e02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACG
  5   1   2       chi Tbd0 5x3  in                       IMAGE:6977105                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGAAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCTGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGGTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGATTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAGTGAAGTGTCCTTATCTGATGACAAGGATGCCTTTTATAGCGCTGATCTAGGTGACACTGTGGGAGTGGCTGTCCTAAGATTTGGGAACTCCCCCGTGTCTGTCCCCGGGTGACGTTCCATGCCGCTGCCGCTCAGGGGGTCATTGTACCTCTCTCCCGCCGTGGCGCCGGAGTCATGGTCCCGCATCCAAGCACGATCGCTCCTACCCTGGTCCGCTGCTCTGCCTCATTCCGCGCCCATCAACGAAAACCAGGCCACGCACTGGCGCTCACCCCCCCCATCGCCCGCTGATCCGTTGTCACCACCTCGACCTCCGCGATCCCCCCACGCCCCTCTCCCCC
  5   1   2       bld Tbd0 5g                            IMAGE:6978738                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGATCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCANATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGGAAGTGGGNCAGGATCACCNCAATGCA
  5   1   2       bld Gas  5g                        TGas038h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGT
  5   1   2       bld TbA  5g3  in                   TTbA045k01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGANAGTGGCAAGGAATCACCCANATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCT
  5   1   2       bld TbA  5g                        TTbA048f09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCACATGCAAAGCTTGTTCTGCGCATAGCAACTGAT
  5   1   2       bld HdA  5g3  in                   THdA050b20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTNAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGT
  5   1   2       bld Egg  5g3  in                  TEgg049h15.p1kSP6w                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCA
  5   1   2       bld Egg  5g                        TEgg122h12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTCTGCTCTGCGAGTGCTGGTTACAGATAGCTGAACTGGCGTTTGTCCCACGTGTGTCTTTTTTTTCCTGCCTGGTTATTTGGGGCCTCCATGGGTACAGACTTCTTAAATGCTTTTTAACAATACAAACAGCACAACAGCGCATATCGGCTCCATCTCACACGTATGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCTGGCTAGCCTCCTTGGGAGTGAAACTGAATCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATACCTTGCCTCTTGAAACAACATAACTGCATAAAATGAACAGCTTCATCAATGACCACTTTGACTTCAGTTTCCTGGAAGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCACTGAAGTGTCCTTATCTGATGACAAACATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACTTTGGTTTAAAGCACTCCCACCTGTCACTCCATTTTATGCTGAAAAATGCAATGACAGCAAAGCCATCGTGAACACTCTCTCCCTCCTTGGTGCGAGCTTTCACTGTGCCACTAAGACGGAAATCCAACTATTA
  5   1   2       bld Gas  5g3  in                   TGas115h15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGT
  5   1   2       bld Neu  5g3  in                   TNeu058f12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2       bld Neu  5g                        TNeu075p06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGAC
  3  -1   2       bld Egg       in                    TEgg038a01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTCCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGGTGGCAGTGGCTGCACTGATCCTCAGACTTATGTANCAGCTGTCTCAGATGCACGATGTGTCTT
  5   1   2       bld Gas0 5g3  in                         dad19b12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACCAAACAGCAGAACNAGCGCAGAGCGGCTCCATCGAGAGCGTAGGANCTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTTACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGAAGGAAATCCAACTAGTACAAAGGTATGGAGTGGTATCTGAG
  5   1   2       bld Gas1 5g   ?                      NISC_mq20h06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACT
  5   1   2   20  bld Te1  5g                             CBWN11847.b1 .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAG
  5   1   2       bld Egg  5g3  in                   TEgg021p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGGGGAGCTCTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGC
  5   1   2       bld Egg  5g                        TEgg121e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGA
  5   1   2   12  bld Gas7 5g3  in                         XZG41598.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGC
  5   1   2   12  bld Gas7 5g3  in                         XZG51392.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGNCACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTT
  5   1   2   22  bld Tad5 5g                              XZT26291.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGNCAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAACAAGCAGGCTGCTTCTGGAGCGGGCAAA
  5   1   2       bld Egg  5g3  in                   TEgg067i02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCC
  5   1   2       bld TpA  5g3  in                   TTpA005a12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTT
  5   1   2       bld Gas1 5g3  in                     NISC_mq03f03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGGGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCGCTCCATTTTATGCTGTAA
  5   1   2       bld Gas  5g                        TGas015f19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATC
  5   1   2       bld Gas  5g                        TGas015i03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAAT
  5   1   2       bld Neu  5g                        TNeu050g16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTTTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTNTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCC
  5   1   2   22  bld Gas7 5g                              XZG15480.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTCAGCTCTGCGAGTGCTGGTTAAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGT
  5   1   2   12  bld Gas7 5g3  in                         XZG24445.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGA
  5   1   2   12  bld Gas7 5g3  in                         XZG44810.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGC
  5   1   2       bld Egg  5g3  in                   TEgg001g22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGA
  5   1   2       bld Egg  5g3  in                   TEgg003k22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTA
  5   1   2       bld Egg  5g                        TEgg011n12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCG
  5   1   2       bld Tbd0 FL   in                    IMAGE:5335701.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCAT
  5   1   2       bld TpA  5g3  in                   TTpA033o08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGGAAGTGGGCAGGAATCACCNNCAATGCAAGCTTGGTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGC
  5   1   2       bld TbA  5g                        TTbA056l15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGCTCTGCGAGTGCTGGTTACCGATAACTGAAGTGCCTTTTGTCCGAGGTGGTCGTTTTTTTCCTGCCTGGTTATTTGTGGCCCTCTATGGGTACACACTTCGTATATGCTTTTTAAGAATACTGACAGCACAACAGCGCACAACGGCTCCATTGATAGCGTAAGACTTGTCCTCTACTTACCAGGCTTCTAGTTCACCGGCGAGCCTCCTTGGCAGTGAAACTGAAGCTTTCTTGTATAGTTATCCCCCATCTCCTACTTGTCCATTTTGGTGCATAATTTGCCTCTTGAAACAAAGTACCTGCAAAAATGAACAGCTTCCGCAACAACGCACTTTGACTTCTGTTCCTGGATGAAGGTTTCTGTGCCAGGGATATTGTGGAGCCTAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTAAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTACCATGCACTGACAGCATAGCCATCGGGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTG
  5   1   2   12  bld Gas7 5g3  in                         XZG23227.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTTCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCCTGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGCCAAGGAATCACCCAAATGCCAAGC
  5   1   2   12  bld Gas7 5g3  in                         XZG44385.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCGTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCCAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTTGTAA
  5   1   2   20  bld Te1  5g                               CBWN850.b1 ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAA
  5   1   2       bld Egg  5g3  in                   TEgg002d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAG
  5   1   2       bld Gas  5g                        TGas069d22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCAATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGTAACAGCGCAGATCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTGTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGCGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCGATGACAGCAAATCCAT
  5   1   2       bld Gas  5g                        TGas072d08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGC
  5   1   2       bld Neu  5g                        TNeu133c12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGGGCTCTGCGATTGCTGGTTACGGATAGCTGAAGTGCCCTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTGAGCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCGAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTGTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTGCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGT
  3  -1   2       bld Gas       in                    TGas061p10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTC
  5   1   2       bld Gas1 5g                            IMAGE:6988593                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCCNAAAGCTTGTCTGCCGCCCTCAATTGTAAAAATTTTGGGTGCCCACCCTTTTAAAACAAGCCAAGGGCTGCCTTTCTTGGGAA
  5   1   2       bld Gas1 5g                            IMAGE:6988989                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAGGAAATCCCCAAATGCAAAGCTTG
  5   1   2       bld Neu0 5g                            IMAGE:6992474                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTTCAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAAGCTGGCTTCTGGAGCGGGGCAAAAGAGCTTATGGTGGAAAATAATTGGGTGGTAAGGTTTTCCATGGTGGG
  5   1   2       bld Gas  5g                        TGas021k16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGT
  5   1   2       bld Gas  5g                        TGas028n14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGA
  5   1   2       bld Gas  5g                        TGas045i11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCC
  5   1   2       bld Gas  5g                        TGas049k22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTG
  5   1   2       bld Neu  5g                        TNeu047o07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTTTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGT
  5   1   2       bld TpA  5g3  in                   TTpA072h18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTC
  5   1   2       bld TbA  5g                        TTbA026l01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGC
  5   1   2       bld Te5       in                         CAAO4924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTG
  5   1   2   22  bld Gas7 5g                              XZG23922.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCCAATCCATGTAAACAAGTCT
  5   1   2   12  bld Gas7 5g3  in                         XZG46132.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGCTCTGCGAGTGCTGGTTAAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAA
  5   1   2   12  bld Gas7 5g3  in                         XZG50814.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCTTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTT
  5   1   2   12  bld Gas7 5g3  in                         XZG53113.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGT
  5   1   2   22  bld Gas7 5g                              XZG53345.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTG
  5   1   2   12  bld Gas7 5g3  in                         XZG57953.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGGATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTG
  5   1   2   12  bld Gas7 5g3  in                         XZG64465.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGCTCTGCGAGTGCTGGTTAAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCA
  5   1   2       bld Egg  5g3  in                   TEgg005m12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAA
  5   1   2       bld Egg  5g3  in                   TEgg006j20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCGGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATG
  5   1   2       bld Egg  5g3  in                   TEgg011j17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAAT
  5   1   2       bld Egg  5g3  in                   TEgg012h02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTAGCAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAAC
  5   1   2       bld Egg  5g3  in                   TEgg025f18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCA
  5   1   2       bld Egg       in                   TEgg028a11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCT
  5   1   2       bld Egg  5g3  in                   TEgg040p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2       bld Egg  5g3  in                   TEgg043a02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCA
  5   1   2       bld Egg  5g   ?                    TEgg055j02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAA
  5   1   2       bld Egg  5g3  in                   TEgg061e18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2       bld Egg  5g3  in                   TEgg067l04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAAT
  5   1   2       bld Egg  5g3  in                   TEgg068a08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAGAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCG
  5   1   2       bld Egg  5g3  in                   TEgg071c21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCT
  5   1   2       bld Egg  5g                        TEgg090l03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTATACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCC
  5   1   2       bld Egg  5g                        TEgg099g16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATC
  5   1   2       bld Egg  5g                        TEgg100j12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGC
  5   1   2       bld Egg  5g                        TEgg114m20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATC
  5   1   2       bld Egg  5g                        TEgg124n07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAA
  5   1   2       bld Egg  5g                        TEgg125e21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATC
  5   1   2       bld Egg  5g                        TEgg127k04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2       bld Egg  5g                        TEgg131c12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTC
  5   1   2       bld Egg  5g                        TEgg133k02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGTTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2       bld Egg  5g                        TEgg136d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTC
  5   1   2       bld Egg  5g                        TEgg139c09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGC
  5   1   2       bld Gas  5g3  in                   TGas086g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGCGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATG
  5   1   2       bld Gas  5g                        TGas105m18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATA
  5   1   2       bld Gas  5g3  in                   TGas113h02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGTAAGTTTGGCATTATGGTGACCTCTGTTAAAATGTCAGTGTCGTTATAAAGTGTTAATGAACTGTAATACCTCTTTCTAGGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCT
  5   1   2       bld Gas  5g3  in                   TGas114b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTAT
  5   1   2       bld Neu  5g3  in                   TNeu056e23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCT
  5   1   2       bld Neu  5g                        TNeu096l03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTGTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCGAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTGTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTGCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTG
  5   1   2       bld Gas1 5g3  in                       IMAGE:6990555                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCAATGCAAGCTTGTCTGCGCATACACTGATGATCAAAGCTTCTGCGCCTCGTGTAATTNGGTGCACCN
  5   1   2   22  bld Gas7 5g                              XZG12965.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGC
  5   1   2   22  bld Gas7 5g                              XZG20751.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTTACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATTGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACTGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCCTGT
  5   1   2       bld Gas8 5g3  in                          st88i07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCANAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTG
  5   1   2       bld Egg  5g3  in                   TEgg063i03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCTCTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTAT
  5   1   2       bld Egg  5g                        TEgg094o11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTA
  5   1   2       bld Egg  5g                        TEgg102i06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAGTTATCTATGCAAATCCATGTAAACAAGTCTC
  5   1   2       bld Gas  5g3  in                   TGas104e10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGGGTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAAGCTTCTATTGGGGCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTGCATTTTGTTGCGTAGTTTGCCTCTTGAAACAAAATAACTGCGAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTGTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTGCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATG
  5   1   2       bld Gas  5g3  in                   TGas130b13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATG
  5   1   2       bld Neu  5g                        TNeu111m14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGCTCTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2       bld Neu  5g                        TNeu141h20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGCTTCTATTTGACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCGAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTGTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTGCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTGACTCCATTTTATGCTGTAAAATGCAATGACAGCAAA
  5   1   2       bld Neu  5g                        TNeu143f13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGCTCTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCATAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCATGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTGCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTGACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAAGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCG
  5   1   2       bld Gas1 5g3  in                       IMAGE:6989404                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACNNTATGAAGTGGNCAGGAATCACCCNNAATGCAAGCTTGGTCTGCGCATAGCAACTGATGACTCAAAGCTGTCTGCCGCTCAGTGTAAATTNNGTGCACCNTAAA
  5   1   2   12  bld Gas7 5g3  in                         XZG32301.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTCTGCGAGTGCTGGTTAAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGANATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGGTG
  5   1   2   12  bld Gas7 5g3  in                         XZG59922.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAA
  5   1   2   10  bld Te1  5g3  in                         CBWN9674.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGA
  5   1   2       bld Egg  5g                        TEgg052n16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGAGGACTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGGACCGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCC
  5   1   2       bld Gas  5g3  in                   TGas070p03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATCCCCGGGGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAG
  5   1   2       bld Neu  5g3  in                   TNeu125m16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTCTGCGAGTGCTGTTTGCGGATAGCTGAAGTGCCGATTGCCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACGCGGGGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTGTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTGCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAA
  5   1   2   12  bld Gas7 5g3  in                         XZG37457.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGAGC
  5   1   2   12  bld Tad5 5g3  in                         XZT49687.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGC
  5   1   2   10  bld Eye  5g3  in                         CCAX6507.b1 ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGT
  5   1   2       bld Egg  5g3  in                   TEgg061b19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCTGCAAGGGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCAAGGGGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCAATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAAAACAGCGCAAAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTGCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAACCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTA
  5   1   2       bld Gas  5g                        TGas099d15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTGCTACCAGTGTACTGCGCATACCTCGCAAGTGATGCTGGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATATTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGCAAAATGCAATG
  5   1   2   12  bld Gas7 5g3  in                         XZG27021.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCCAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGGTG
  5   1   2   12  bld Gas7 5g3  in                         XZG45979.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGC
  5   1   2       bld Egg  5g3  in                   TEgg051b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCCCCGGGCCCGGGGCCCGGGGAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2       chi Egg  5x                        TEgg087m08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTGCGAGTGCTGGTTACTGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCTATGGGTACAGACTTCGTAAATGCTTTTTATGAATACTAACAACAAAACAGCGCAGAGCGGCTCCATTGATAGCGTAGGACTTGTCCTCTACTTACCAGACTTCTATTGTCTCCGGCGAGCCTCCTTGGGAGTGAAACTGAAACTTTCTTTATATTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATATTTTGCCTCTTGAAACAAGATAACTGCGAAAATGAACAGCTTGATCTACTACGACTTTGACTTCTTTTTCCTGGAGGAACGTTTCTGTGCCAGAGATATTGTGGAGCAATAGATCCATGAAGTGTCCTTATCTGATGACTTTTGACAGTGAATGTGAACTAATGAAAGTGGCAAGGAATCACCCCAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTATAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCAC
  5   1   2       bld Gas  5g3  in                   TGas120d22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTGCGAGTGCTGGCTACTGATAGCTGAAGTGCCGTTTGACCGAGGCGGTCTTTTTATTCCTGCCTGGATATTAGTGGCCTCGATGGGTACACACTTCGGAGATGCTTTTTATTAATACTAACAGGATAACGGCGCGCAGCGGCTCCTTTGATAGCGTAGGACTTGGCCTCTACTTACGATGCTTCTATTTCACCGCGCGAGCCTCCTTGGGAGTGAAACTGAAACTTTCTTTATAGGTATCCCCCATCTCTTACTTGTCCATTTTGGTGCATACTTTGCCTCTTGAGACAAGATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAACGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAGAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTACAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACT
  5   1   2       bld Gas1 5g                            IMAGE:6989094                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGNCAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAGTGGCAAGGATCACCCAATGCAAAGCTTGTCTGCGCTAGCACTGATGATCAAAGCTGTCTGCGCCTCAGTGAAATTTG
  5   1   2       bld Gas  5g                        TGas010j09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATTTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCC
  5   1   2       bld Gas  5g                        TGas050f09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTG
  5   1   2       bld Neu  5g                        TNeu003p16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTG
  5   1   2       bld Neu  5g                        TNeu035l08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTG
  5   1   2       bld TpA  5g                        TTpA031m24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGNGCAAAGAGCTTAATGT
  5   1   2       bld TpA  5g                        TTpA056f02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGT
  5   1   2       bld TbA  5g                        TTbA070h08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCT
  5   1   2       bld TbA  5g3  in                   TTbA073n02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGAGGTCTTTTTTTTCCCGCCAGGTTATTCGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTCGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTAGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGC
  5   1   2   14  bld Te5  5g3  in                          CAAO561.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAAATATCTATGCAAATCCCATGTAAACAGTCTCCCAGATCAAATACGCAGCTAGCT
  5   1   2   12  bld Gas7 5g3  in                         XZG25307.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGTTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTTACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGC
  5   1   2   22  bld Gas7 5g                              XZG49990.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTG
  5   1   2   12  bld Gas7 5g3  in                         XZG62684.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGTAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAA
  5   1   2       bld Egg  5g3  in                   TEgg018h15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCATTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACA
  5   1   2       bld Egg  5g3  in                   TEgg039e15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCATTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTAT
  5   1   2       bld Egg  5g                        TEgg097m11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCG
  5   1   2       bld Gas       in                   TGas055c15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCAT
  5   1   2       bld Gas  5g3  in                   TGas079c10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTG
  5   1   2       bld Gas  5g                        TGas099d09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTG
  5   1   2       bld Gas  5g3  in                   TGas117n12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGC
  5   1   2       bld Neu0 5g3  in                     NISC_ng06b09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAAT
  5   1   2       bld Neu  5g                        TNeu018d12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCA
  5   1   2       bld Egg       ?                    TEgg019o21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGAGGACTTTTTTTTTCCTGCCTGGATATTTGTGGCCTCGATGGGTACAAACTTCGTAAATGCTTTTTAAGAATACAAACAGCATAACAGCGCATAGCGGCTCCATTGAGAGCGGAGGACTTGTCCTCTGACTTACCAGGCTTCTATTTCAGCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAATTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCGTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAAGGATATTGTGGAGCAAAAAATAAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTATAACACTCCCACGTGTCACTCCATTTTATGCTGTAAAGTGCAATGACAGCTAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAAGCTTTGACTGTGCCGGTAAGACGGAAATCCCACTAGCACCAAGTATTGGAGTGTCATCTGAGCGAATTAT
  5   1   2       bld Egg  5g                        TEgg121e13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGCGAGTGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTA
  5   1   2       bld Gas  5g                        TGas141h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCGAGTGCTTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCATTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTG
  5   1   2       bld Neu0 5g                            IMAGE:6993457                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGGTAAGTTTCCATGTTGGNCAGTGGNCTGCACTGATCCNTCAGAACTTATGGTACAGGCTGTCTCAGA
  5   1   2       bld AbdN 5g                            IMAGE:7021071                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTGCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCTATGGGTACAGACTTTGTAAATGCTTTTTAAGAATACAAATAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTGGAAACAAAATAACTGCAAAAATGAACACCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCCGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGGAAACAAGTCTCCCAGAATAAATTAGCAGCTAGCTGTGGGGGTGGAAAAGAGGACTTTTTGCAGTGGAAGTTGAACCTAATGAAATTGGGAAGGGAATTCCCCCAAAATGCAAAGCTTTGTTTCTGGGGCCTAAGCAATCTGATTGACTCTAAAAAGTTGGTCTTGCCCGGCTCTTCAGGGGTGAAAAAATTGGGGTGGGCCCCCCCTTTAAAAAAACAAGCCAAGGGCTGGCTTTCCTGGGGAAGGCT
  5   1   2       bld AbdN                               IMAGE:7022613                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAAGCTTCNTTATAACTGCACGN
  5   1   2       bld Egg  5g3  in                   TEgg035g15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAA
  5   1   2       bld Egg  5x3  out                  TEgg038m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGC
  5   1   2       bld Egg  5g3  in                   TEgg052m08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATG
  5   1   2       bld Gas  5g3  in                   TGas114l02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGC
  5   1   2       bld Gas1 5g3  in                       IMAGE:6990709                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGATCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGGAAGTGGCAAGGAATCACNNCAATGCNAAGCTTGGTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAATTTGGGTGCACCNTNANACAGCAGCTGCTCN
  5   1   2       bld Egg  5g3  in                   TEgg002f07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCA
  5   1   2       bld Egg  5g                        TEgg093i05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCA
  5   1   2       bld Egg  5g                        TEgg144k02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAGCTGTCTGCCGCCTCAGTG
  5   1   2       bld Neu  5g3  in                   TNeu124h22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTC
  5   1   2       bld Gas1 5g                            IMAGE:6987774                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGGCAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGGCCCCCCTTAAAACAAGGCAGGCTGCCTTCTGGAAGCGGGCCAAAAGAGCTTAAAGGGGGATAATAATTTGGGTGTAAGTTTTCCCATGGTTGGGCCGGGGGCCTGCCCCTGATACCCCTAAGAACTTTATGTTTACAAGGCTGGGCTTCAAAATGGCCCCGAAAAGTGGTCTCTTTTTGAAAATGGGGGGGGC
  5   1   2       bld Gas  5g                        TGas026i20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAA
  5   1   2   12  bld Gas7 5g3  in                         XZG27992.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAG
  5   1   2   12  bld Gas7 5g3  in                         XZG52848.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTCCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGT
  5   1   2       bld Egg  5g3  in                   TEgg046m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACG
  5   1   2       bld Egg  5g                        TEgg142b09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAA
  5   1   2       bld Gas  5g3  in                   TGas053f07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAG
  5   1   2       bld Gas  5g3  in                   TGas070f15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCA
  5   1   2       bld Neu  5g3  in                   TNeu095k04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAA
  5   1   2       bld Neu  5g3  in                   TNeu123a05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCGAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTGCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTGAAATGCAATGACAGCAAAGCCAT
  5   1   2       bld Gas1 5g3  in                       IMAGE:6991002                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAAATGGGTGTAAGTTTCCATGGT
  5   1   2       bld Gas  5g                        TGas024g17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAATAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGT
  5   1   2       bld Gas  5g                        TGas028o18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTNTTGACAGTGAAGT
  5   1   2       bld Gas  5g                        TGas035e03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTC
  5   1   2       bld Neu  5g                        TNeu008h14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGT
  5   1   2       bld Neu  5g                        TNeu033c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATG
  5   1   2       bld Te5       in                         CAAO8524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAACAAGCAGGCTGCTTCTGGAGCGNNGCAAAGAGCTTAATGTGG
  5   1   2   22  bld Gas7 5g                              XZG13193.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGTGCTGGTTAAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGNCAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGC
  5   1   2   12  bld Gas7 5g3  in                          XZG7198.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGGCGCATAGCAACTGATGAACTCAAAA
  5   1   2       bld Egg  5g3  in                   TEgg004c22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATG
  5   1   2       bld Egg  5g                        TEgg141l13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGGGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAG
  5   1   2       bld Neu  5g                        TNeu020b22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGGGGGAATCCCCGGGGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTC
  5   1   2   22  bld Gas7 5g                              XZG12424.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAAT
  5   1   2       bld Egg  5g                        TEgg089m14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGAATCCCCGGGGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAAAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTG
  5   1   2       bld Neu  5g                        TNeu139j13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGGGGAATCCCCTGGCTGAAGTGCCGTTTGTCCGAGGTGGGCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCGTGCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCGAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTGTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTGCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTGACTCCATTTTATGCTGTGAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTGATCTGAGCGAATTA
  5   1   2       bld TbA  5g3  in                   TTbA071c03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGGAATCCCGGGGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGA
  5   1   2       bld Egg  5g3  in                   TEgg011g15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAATAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCAT
  5   1   2       bld Egg  5g3  in                   TEgg036d02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTGATTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATTTATGTAAA
  5   1   2   22  bld Gas7 5g                               XZG7742.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAA
  5   1   2       bld Egg  5g                        TEgg119o20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCAT
  5   1   2       bld Neu0 5g3  in                     NISC_ng23a06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGATGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCAT
  5   1   2   22  bld Gas7 5g                              XZG33695.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTGGTTAAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGGAAGTGGCAAGGAATCA
  5   1   2       bld Egg  5g3  in                   TEgg031p17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGTGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATACTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCACCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGGCAGGGATATTGTGGAGCAAAACATCCATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTT
  5   1   2       bld Gas  5g                        TGas032p24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCTTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATG
  5   1   2       bld Abd0 5g                            IMAGE:7017275                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAAAACTATGAAGTGGNCAGGATCACCCAAT
  5   1   2       chi Egg  5x                        TEgg080c05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCTTTGGGCGGCAGGAAGGGGCCGAGGTCGCCATCTTGTTGGTTGGAGTGAGCCTGGAGGAGGGGAAACCGAACTGCGGCCGGAGGTGGAGGAGGGGGACCAAGGCACGGCGGTTTATCCCCGGTTTTTAAAGAGAGAGAAAAATGTTTTACGCTCACTTTGTCCTCAGTAAGCGTGGGCCCGGGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACCGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTT
  5   1   2   14  bld Te5  5g3  in                         CAAO1405.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAA
  5   1   2       bld Egg       in                   TEgg036g07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGAAGTGCCGTTTGTCCGAAGTGGTCTTTTTTTTCCTGACTGGTGTATTTGGGGCATCCATGGGTACAGACTTCGTAAGTGCTTGTTAAGACTACAAAGCGCACATGCCCGGCTAGCGGCTCCATCTGACAGCGTAAGACTTGACCTCTACTTACCAAGCGTCGATTTCCCCGGCGAGCCTCCTTGGGAGTGACCACTGAGGCTTACTTGATAGGTATCCCCCGTGCTCTTACTTGTCCATTGTGTTGCATAATGTGCCATCTTGAATCAAATTAAGTGCAAAAAGGAAAAGCTTCTGCGGTAGTACGACTTTGACTTCGATTTCCTGAAGGATGGTTTCTGCGCGAGAGATATTGTGGAGCAATACTATCTATGAATCGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGCGAAAAATCCTGTACGTGTGGTTTAGAGCACTCCCGAGATGTCACTCCATTTTATGCTGTACAATGCAATGACAACAAAGCCCTCGTGAAGACTCTCTCCCTCCTTGGTGCAAGCTTTGACTGTGCCAGTACGACGGAAATCCAACTAGTACTAAGTATTGGAGTGTCATCTGAGCGAATTATCTA
  5   1   2   22  bld Gas7 5g                              XZG12665.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTAAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGT
  5   1   2       bld Gas  5g                        TGas109p17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGGGATTCCCCGGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGC
  5   1   2   22  bld Gas7 5g                               XZG5841.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTCGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCA
  5   1   2       bld Te5       in                         CAAO8675.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGC
  5   1   2   10  bld Ovi1 5g3  in                         CABI1055.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCCATCGATTCGGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTGGTGC
  5   1   2   22  bld Gas7 5g                              XZG13763.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTA
  5   1   2       bld Egg  5g3  in                   TEgg001e11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGGGGGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGC
  5   1   2       bld Egg  5g                        TEgg116l14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCT
  5   1   2       bld Gas1 5g                          NISC_mq28a06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTC
  5   1   2       bld Te5       in                         CAAO3767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGC
  5   1   2   22  bld Gas7 5g                              XZG10657.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTT
  5   1   2       bld Egg  5g                        TEgg031b09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGG
  5   1   2       bld Neu  5g3  in                   TNeu124l01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTG
  5   1   2   12  bld Gas7 5g3  in                         XZG59636.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCT
  5   1   2   12  bld Gas7 5g3  in                         XZG64030.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACC
  5   1   2       bld Egg  5x3  in                   TEgg020d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTCTGCACTCTTGAAACAAAATAGCTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGATGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGACATCTGAGCGAATTATCTATGCAAATCCATGTAAA
  5   1   2       bld TbA  5g3  in                   TTbA041b19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTCGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTCGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTCGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTANAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCATGTTGGCAGTGGCTGCACTGATC
  5   1   2   14  bld Te5  5g3  in                         CAAO9602.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGAGATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGC
  5   1   2   10  bld Te1  5g3  in                        CBWN10671.b1 .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCANATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAG
  5   1   2       bld Te5       in                         CAAO4763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACC
  5   1   2       chi Gas7 5x3  in                         XZG19252.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCATTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAGATCAATGAAGTGTCCTTATCTGATGATGAAGAGGATGCTGCCAATGACAAGACCCTGATGTACTATGTGAATGATGGCGTGTATGGATCTTTCAACTGCATCTTGTTTGATCATGCACATGTCAAGCCAGTTCTAACAAAGAAACCAAAACCAGATGAGAGCTTCTACTCAAGCAGCATTTGGGGACCAACCTGTGATGGACTGGATCGTATTGTGGAAAGGTTCGACCTGCCAGAGCTACAAGTTGGAGACTGGATGTTATTTGAGAACATGGGCGCCTACACTGTTGCTGCATCCTCAACATTCAATGGATTCAAAGACCAACCCTTTATTATGT
  5   1   2   12  bld Gas7 5g3  in                         XZG34710.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGTAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAGAGCTTA
  5   1   2       bld Neu  5g3  in                   TNeu059o10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTG
  5   1   2       bld Egg  5x3  ?                    TEgg004d12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATC
  5   1   2       bld Gas  5g3  in                   TGas064m11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTA
  5   1   2       bld Gas  5g3  in                   TGas107i13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGC
  5   1   2       bld Gas  5g                        TGas019n22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGC
  5   1   2       bld TpA  5g3  in                   TTpA017o16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCTTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGC
  5   1   2       bld TpA  5g3  in                   TTpA028k23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTTATGTACAGCTGTCTC
  5   1   2       bld TpA  5g                        TTpA032n18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATT
  5   1   2       bld TbA  5g3  in                   TTbA053k21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGG
  5   1   2       bld TpA  5g3  in                   TTpA077d21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAGAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAGACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCTAAGCTTGTTCTGCGCATAGCAACTGATGACTCATAAGCTGTCTGCCGCCTCA
  5   1   2       bld In63 5g                         IMAGE:8958860.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTTGCCACCCTTAAAAACAGGCAGCCTGCTTCTGGAAGCGGGCAAAAGAGCTATGTGAAATAATTGGTGTAAGTTTCATGTGGCAGTGCCTGCACTGATCTCGACTATGTTACAGCTTGTCTCAGATGGCACCGAATGTGTCCTTTTGAACAATGGGGGCCCT
  5   1   2       bld Egg  5g3  in                   TEgg044e01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGTAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCCAATATGCAGCTAG
  5   1   2       bld HdA  5g3  in                   THdA043j04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGTGCCGTTTGTCCGAGGTGGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAAT
  5   1   2       bld Ovi1 5x3  in                        CABI11373.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCGAGGCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGGACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGTAAGTTTGGCATTATGGTGACCTATGTTAAAATGTCAGTGTCGTTATAAAGTGTTAATGAACTGCAATACCTCTTTCTAGGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGGTAGGCATTTTTTTGGTCGCTGTGCTCTTGAACAGGGCTTTTAGTGGAATTTGTTAGATATGTAGATATAATATATACATTTTCCCCTTTAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTG
  5   1   2       bld Gas  5g                        TGas100p04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATC
  5   1   2   10  bld Ova1 5g3  in                         CABE8423.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAAACAGCAGGCTGCTTCTGGAGCGGGCAAAGAGCTTATGTGGATATAATGGTGTAAGTTTCCCATGTGGCAGTGGCTGCACTGA
  5   1   2       bld Gas  5g                        TGas012p14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAATGCCGTTTGTCCGAGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCACGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACCGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGC
  5   1   2       bld HdA  5g3  in                   THdA034o10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGCCGTTTGTCCGAGGTGGTCCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAAGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGT
  5   1   2       bld Gas1 5g3  in                     NISC_mq07e03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGC
  5   1   2   10  bld Ova1 5g3  in                        CABE10262.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGGTGTAAGTTT
  5   1   2       bld Egg  5g                        TEgg136b17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGAAGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCT
  5   1   2       bld Gas  5x3  out                  TGas138n15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGTTTGTCCAAGGGGGCCTTTTTTTTCCTGCCTGGTTATTTGGGGCCTCAATGGGTACAAACTTCGTAAATGCTTTTTAAAAATACAAACAGCAAAACAGCGCAAAGCGGCTCCATCGAAAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCACCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAAATGCCTTTTATGTTGCTGATCTTGGGGACATTGTGAAAAAGCATGTACGTTGG
  5   1   2       bld Egg0 5g3  in                         dad72b05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGGGGGCGTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGGGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGAGTGCCTTTATGTTGCTGATCTTGGTGACATTGCGAAAAAGCATGTACGTTGG
  5   1   2       bld Gas1 5g3  in                     NISC_mq01e09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGT
  5   1   2       bld Gas  5g                        TGas004c14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCGTTTGTCCGAGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCTGTACGTTGGTTTAA
  5   1   2   10  bld Ovi1 5g3  in                         CABI1011.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAGCAGGCTGCTTCTGGAGCNGGC
  5   1   2   10  bld Ovi1 5g3  in                        CABI10216.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAGCAGGCTGCTTCTGGAGCGNGCAAAAGAGCTTAATGTGG
  5   1   2       chi Egg  5x3  ?                    TEgg024f23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAGTCCCCTGAAAGCTGGGACAGTGTTTCCCCCGCCCTCCCGAGGTTGTTGCTTTATTTTACGATTTGCCTTTGTAACGTCTTGTATTTTTATATGCCATTTGCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCT
  5   1   2   22  bld Gas7 5g                              XZG13348.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGGTGGTCTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTTAAACAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTG
  5   1   2   14  bld Te5  5g3  in                        CAAO11482.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAACAAGCAGGCTGCCTCTGGAGCCGGCAAAAGAGCTTA
  5   1   2       bld TbA  5g3  in                   TTbA033h19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTACGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAGAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCACAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGGGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGATCTCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAGAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGG
  5   1   2       bld Gas  5g3  in                   TGas097b04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAGGGATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGAC
  5   1   2   22  bld Gas7 5g                              XZG12808.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCCTCGATGGGTACAGACTTCGTAATGCTTTTTAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAATTTGGTGCCACCCTTAAACAAGCAGGCTGCTTCTGGAGCNGGGCAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCCATGTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTG
  5   1   2       chi Gas7 5g3  in                         XZG54160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTAAGCTCTCAGCTCTGCGAGTGCTGGTTACGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGC
  5   1   2       bld Gas  5g3  in                   TGas139o21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGATGGGTACAGACTTCGTAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAG
  5   1   2   12  bld Gas7 5g3  in                         XZG31782.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGACTTCGTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGC
  5   1   2       bld Egg  5g                        TEgg026d24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTAAATGCTTTTTAAGAATACAAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAAT
  5   1   2   12  bld Gas7 5g3  in                         XZG28892.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTG
  5   1   2   12  bld Gas7 5g3  in                          XZG6664.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACAGCAGAACAGCGCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCCCTGATCCTC
  5   1   2       bld Gas8 5g3  in                         st106c21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACAGCAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCA
  5   1   2       bld TbA  5g3  in                   TTbA045a03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAACAGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTT
  5   1   2       bld Te5  5g3  in                        CAAO12706.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCGCAGAGCGGCTCCATTGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGNGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCCATGTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGAC
  5   1   2       bld Egg  5g3  in                   TEgg005l11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTG
  5   1   2       bld Egg  5g3  in                   TEgg005l13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGAGCGGCTCCATCGAGAGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTG
  5   1   2       bld Egg  5g3  in                   TEgg017j11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGAGCGTAAGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAAGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGAC
  5   1   2       bld Neu  5g                        TNeu029a05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCGTAGGACTTGTCCTCTACTTACCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTNTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTG
  5   1   2       bld TpA  5g3  in                   TTpA066j01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTTGTCCTCTACTTACCAGGCTTCTATTTCAGCGGGGAGCCTCCTTGGGAGTGAAACTGAAGATTTCTTTGTAGTTATCCCCCATCTCTTACTTGTGCATTTTGTTGCATAGTTTGCCTCTTGAACCGAATTATCTGCAAAAATG
  5   1   2       bld TbA  5g3  in                   TTbA036d07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGTCCTCTACTTACCAGGCTTCTATTTCACCGACAAGCCTCCTTGGGAGAGAAACTGAAGCTTTCATTATACTTATCCCCCAACTCTTACTTGTCCATTTTGTTGCATAGATTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCACCAACTACGACTTTGACTTCACTTTCCTGGACGAAGGTTTCTGTGCCAAGGATATTGTGGAGCAAAACATCAATGACGTGTCCTTATCTGATGACAAACATGCCTTTTATGTTGCTGATCTGT
  5   1   2   22  bld Gas7 5g                               XZG9315.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGATAGCTGAAGTGCCGTTTGTCCGAGGTGGTCTTTTTTTTCCTGCCTGGTTATTTGTGGCCTCGATGGGTACAGACTTCGTAAATGCTTTTTAAGTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCANAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTT
  5   1   2       bld Neu  5g3  in                   TNeu116a13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCCAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCA
  3  -1   2       chi Neu       ?                     TNeu107j16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTAAAAATATCCCGGGGGTCTTACTTGACCGGTTTATTTTATTTCTTTACAGTTTGTTGCATAGCCCGCCTCTTGAGGGGGGGTAACAGCAAAAATGAACGGGTGGGGCGACGACGACTTTGACTTCGGGGTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAACCATCGGTGAAATGTCCTTATCTGATGACCCCACCCCTTTTGTGTTGCTGATCTTGGCGACATTGTTGTTATAAGCATGAACAATGGTTTAAAGCACTCCCACGTGACACTCCATTTTATGCTGGGGAACGCCCCGACAGCGAAGCCTTCTTGAAGACTCTCTCCCCCCCTGGTGCATGCTTTGACTGTGCCGGTTTGACGGAAATCCAACAAATACAAAGTATTGGAGTGCCCCCCCAGCGAATTATCTATGCAAATCCATGTAA
  5   1   2       bld Egg0 5g3  in                         dad58e10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGCTTCTATTTCACCGGCGAGCCTCCTTGGGAGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTNTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGT
  5   1   2       bld HdA  5g3  in                  THdA002g11.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCCTCCTTGGGAGAGAAAGTGAAGCTTATCGTTATAGTTATCCCTGACTCTCGGTACTTGTCCATTTGTGTTGCTCTGTGTGCCTCTTGAAACAGTATGACTGCTCAAATGAAATGCTTCTGCAACTACAACTTTGACTTCACTTTCCTGGAGGAAAGTTTCTGTGCCACGGATATTGTGGAGCACAAGATCACTGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGATGTTGTGAATGAGCGTGTACCTTGGTTTAAAGCACTCCCACGTGTCGCACCATTTCATGCAGTAAAGCGCGCTGACATCCAAGCCTACGTGAAGACTCTCTGCCTCCTTGGTGCAAGATTTGACTGTGCCAGTAAAAATGAAATCCGGCTAGATCCAAGTGATTGGAGTGTCATCTGAGCGAATTATCTATGCACATCCATGTAAATAACTCTCCCACATCGCATACGCAGCTAGCTGTGGTGTCGATAAGATGACTTTTGACA
  5   1   2       bld In63 5g                         IMAGE:8961903.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACGATTTTTTTTTGAAGAACTTAATTATTTAAATTCGCCGGCCGCCCTTTTTTTTTTTTTTTTTTTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGTAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAACATGCATTTACTTGAACATTGTGGAGATCCCTGCTCAAAGGACGTAAACTGAGTTTGAAAAGAATACATCTGTGATAACCAGCCCTGGATAAAGTACTTCCAAGAGAATTCTGGGAGTGAC
  5   1   2       bld TpA  5g                        TTpA048d02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGGGGCCCGGGCCCCGGGAGCTTTCTTTTAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAACATGCATTTACTTGACATTGGTGGAGGATTCC
  5  -1   2       bld Neu       in                   TNeu060d21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCACACCCATCGTGAAGACTATCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGAAAAGAGAAGATGACACTCCAATACGTTCCCCGGGCCCGGG
  5   1   2       bld Egg  5g                        TEgg084l17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAAACTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTATAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCT
  5   1   2   12  bld Gas7 5g3  in                         XZG54306.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAAGCTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAGCATGCATTTACTTGACAT
  5   1   2       bld Egg  5g                        TEgg089a20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTCTTTATAGTTATCCCCCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAG
  5   1   2       bld Egg  5x                        TEgg069m20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCCCCATCTCTTACTTGTCCATTATGTTGCATAGTTTGCCTCTTGACACTGATAACTGCGACAATGAACAGCTTCAACAATGACTACTTTGACTTCAGGTTCCTGGAAGAAAGTTTCTGTGCCAGGGATATTGTGGAGCACAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATGCTTGGTGACATTGTGACAAAGCATGTACGTTGGTTTACAGCACTCCCACGTGTCACTCCATTTTATGCTGTACAATGCAATGA
  5   1   2   12  bld Gas7 5g3  in                         XZG20635.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATCTCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCCGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTT
  5   1   2       bld Egg  5g3  in                   TEgg048n08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATA
  5   1   2   14  bld Te5  5g3  in                        CAAO11552.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAACATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAAACTGAAGTTTGAAGAGATTACATCTGTGATAA
  5   1   2   14  bld Te5  5g3  in                         CAAO6739.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTACTTGTCCATTTTGTTGCATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGATGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGNGGGCTGAGCTTGGATTCACATGCATTTACTTGACATTGGTGGAGGATTCCCTGGGTCAGAGGACGTTAAACTGAAGTTTGA
  5   1   2       chi Neu0 5x   in                       IMAGE:6991772                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGGTACCGGGTCCGGGAATTCCCTGGGATAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTANAAATGCATGACAGCAAAGCCATCGTGAAACCGGTNNTAGNNNNNCGGGAGAANNNNNNNNCAAAAAANNNNACATCTGNCCNNNCNATCAGTGAGTTCGGGTTTTCCCCNNGATTTTTCGGNNNTGNNACTAAAAAAAACAAANNNNAAAAATAGTTGGGAGGGGGGGTGTNNNNNNNNNNNNNNNNNGGATTTTTTTCCCGGGGATTTAAAAAAAAGGAAGGGGGGGGGGGAAGCCCCCCCCAAAAAAAAAAATTTGTTTTTCCCCAAAAAAAGGGTTGTAAAAAACGNNNNCCTCCCCCCCCCCCCNAAAAAACGTACACCAAGGGGGTGNNNNNNNNNNNNNNNNNNNNNNNNNANNCGGGGAAAATAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTTTTGTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTAAATATTGGGGGGGGGGGGGNNNNNTTTTTTTTTTAAANNANNNNNNTTTTTTTTTTTTTTTTTTGGGGGGGGGGGGGGGGAGAGGAGTTTTTTTTTTGTTTAATTTTTTNNANNNNNNNNNTNTATAAAAAGGGGTGGTGTGTAAAAAAAAAAAAAATTTTTTTGTGTGGGTGGTTTTATANNNANNNNGGGGGGGGGGGGAGAAAAAAAAAANNNTTNNNNNNNNNNTGTGGTGTGGTGGGGGGGGGGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
  5   1   2   12  bld Gas7 5g3  in                         XZG47719.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCACGCCGTCCGCCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAGCATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCCTG
  5   1   2   12  bld Gas7 5g3  in                         XZG44759.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATAGTTTGCCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGNGGGCTGAGCTTGGATTCAACATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGA
  5   1   2   10  bld Ova1 5g3  in                          CABE615.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCTTGAAACAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAACATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCCT
  5   1   2       bld Neu  5g                        TNeu021e02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTGAACAAATAACTGCAAAAATGAACAGCTTCAACAACCACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTG
  5   1   2       bld Gas  5g                        TGas027j10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAACAAAATAACTGCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTC
  5   1   2       bld HdA  5g3  in                  THdA015j06.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAATAACTGCAAAAATGAACAGCTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAACATGCATTTACTTGACAT
  5   1   2       bld Gas0 5g3  in                         dad35c04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGGGGGCAAAAATGAACTTTTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCAT
  5   1   2   12  bld Tad5 5g3  in                         XZT15005.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAGCATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCTGGGAGATACTATGT
  5   1   2       bld Egg  FL   in                   TEgg063i14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAAATGAACAGCTTCAGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACT
  5   1   2       bld Gas7                                 XZG10430.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCTTCGCAATGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGNGGGCTGAGCTTGGATTCAGCATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGANTAACCCAGCCC
  5   1   2       bld Egg       in                   TEgg003n18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACG
  5   1   2       bld Egg       in                   TEgg043k04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCAGCAACGACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTAC
  5   1   2       bld Gas7      in                         XZG56113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGAAACTGAAGTCAAAGTCGTCATTGCTGAAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAGTGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAGCATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCC
  5   1   2       bld Gas7      ?                          XZG43847.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACGACTTTCGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGTAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAGCATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCTGGGAGTACTATGTGGCCTCTGCTTTTACACT
  5   1   2       bld Eye                                  CCAX9074.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACGACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATATGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAACATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGA
  5   1   2       bld Egg       in                   TEgg006k17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATG
  5   1   2       bld Egg                            TEgg137c23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACAT
  5   1   2       bld TpA                            TTpA054n17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTTGACTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGTATCAAAAGATCAATGAACTGTCCTTATCTGATGACAAACATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGATATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATACAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGA
  5   1   2       bld Gas7      in                         XZG63951.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTCAGTTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAGCATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATAAACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCTGG
  5   1   2       bld Gas7      in                         XZG56824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTCCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGGATCCTCAGACTTATGTACAAGGCTGGTCTCAGAATGCA
  5   1   2       bld Gas7      in                         XZG60102.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTGGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTTGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGATATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATGGGGGCTGAGCTTGGATTCAACATGCATTTACTTGACATTGGTGGAGGATTCCCTGGTTCAGAGGACGTTAAACTGAAGTTTGAAGAGATTACATCTGTGATANACCCAGCCCTGGATAAGTACTTCCCAGTAGATTCTGGAGTGACCATCATTGCTGAGCCTGGGAGATACTATGTGGGCTCTGCTTTTACACTCGCA
  5   1   2       bld Spl2      in                        CBSS4094.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGGAAGGTTTCTGTGCCAGGGATATTGTGGAGCAAAAGATCAATGAAGTGTCCTTATCTGATGACAAAGATGCCTTTTATGTTGCTGATCTTGGTGACATTGTGAAAAAGCATGTACGTTGGTTTAAAGCACTCCCACGTGTCACTCCATTTTATGCTGTAAAATGCAATGACAGCAAAGCCATCGTGAAGACTCTCTCCCTCCTTGGTGCAGGCTTTGACTGTGCCAGTAAGACGGAAATCCAACTAGTACAAAGTATTGGAGTGTCATCTGAGCGAATTATCTATGCAAATCCATGTAAACAAGTCTCCCAGATCAAATACGCAGCTAGCTGTGGTGTTGAGAAGATGACTTTTGACAGTGAAGTAGAACTAATGAAAGTGGCAAGGAATCACCCAAATGCAAAGCTTGTTCTGCGCATAGCAACTGATGACTCAAAAGCTGTCTGCCGCCTCAGTGTAAAATTTGGTGCCACCCTTAAAACAAGCAGGCTGCTTCTGGAGCGGGCAAAAGAGCTTAATGTGGAAATAATTGGTGTAAGTTTCCATGTTGGCAGTGGCTGCACTGATCCTCAGACTTATGTACAAGCTGTCTCAGATGCACGATGTGTCTTTGACATG