Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 524.0    0Xt7.1-XZT49967.3                          103 PI      71       3926     5757                Myosin heavy chain [Xenopus tropicalis]
     2 507.0    0Xt7.1-CBSW11309.5                          15 PI      80        235      863                LOC496543 protein [Xenopus tropicalis]
     3 815.0    0Xt7.1-CABH11557.5                          12 PI      78        247     1460                Myosin, heavy polypeptide 2, skeletal muscle, adult [Xenopus tropicalis]
     4 621.0    0Xt7.1-CAAQ10465.5.5                        10 PI      73       3937     5447                Myosin, heavy polypeptide 2, skeletal muscle, adult [Xenopus tropicalis]
     5 278.0    0Xt7.1-CAAJ13278.5                           5 PI      77        244      722                Myosin, heavy polypeptide 13, skeletal muscle [Xenopus tropicalis]
     6 598.0    0Xt7.1-CBSW11232.5                           3 PI      76        244     1316                Myosin, heavy polypeptide 13, skeletal muscle [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     7   1.0    0(repeat)                                    0 REP     77       2435     3076                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012153294 Xt7.1-CAAQ8283.3.5 - 191 ESTs
                                                                       ...-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470......5480......5490......5500......5510......5520......5530......5540......5550......5560......5570......5580......5590......5600......5610......5620......5630......5640......5650......5660......5670......5680......5690......5700......5710......5720......5730......5740......5750......5760......5770......5780......5790......5800......5810......5820......5830......5840......5850......5860......5870......5880......5890......5900......5910......5920......5930......5940......5950......5960......5970......5980......5990......6000......6010......6020......6030......6040......6050......6060......6070......6080......6090......6100......6110......6120......6130....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAQ8283.3.5                                                      ATGGGTGATGCCCTGATGGCAGACTTTGGGGCTGCAGCCCCCTTCCTCAGAAAATCAGACAAAGAACGTCTGGAGGCTCAGACCCGGGTTTTTGATATCAAGACTGAGTGCTTTGTGCCTGAACCCCAACAAGAATATGTGAAAGCAAAAATTATTAGTCGTGAAGGGGGCAAAGTGACAGCTGAAACTCAAGATGGCAAGACAATCACAGTTAAAGACTCTGATGTTCACCAGCAAAATCCTCCCAAGTTCGATAAGATTGAGGACATGGCGATGTTGACCTTTCTGCACGAGCCAGCTGTACTGTACAACCTCAAAGAGCGTTATGCAGCCTGGATGATCTACACATATTCTGGTCTCTTCTGTGTGACCGTAAATCCCTACAAGTGGCTTCCTGTGTATAATTCAGAGGTTGTGACTGCTTACCGTGGGAAGAAAAGGAGTGAAGCCCCACCACACATCTTCTCTATCTCTGATAATGCATATCAGTACATGCTGACAGATCGTGAGAATCAGTCCATTCTTATCACTGGAGAATCTGGTGCTGGGAAGACTGTGAACACAAAGCGTGTCATCCAGTACTTTGCAAGTATTGCATCTGTTGGAGGCAAAAAAGAACAAGCAAATGCCAACAAGGGAACTCTGGAAGATCAAATCATCCAGGCCAACCCTGCTCTGGAGGCTTTTGGTAATGCCAAGACTGTCAGGAATGACAACTCCTCACGTTTTGGTAAATTTATCAGAATTCACTTTGGTGCCTCTGGGAAGTTGGCATCTGCTGATATAGAAACCTATCTCCTGGAAAAATCCAGAGTTATCTTCCAGCTGAAGTCTGAGAGAGACTATCACATCTTCTATCAGATTCTATCCAATAAAAAGCCAGAGCTTTTGGACATGTTGCTAGTGACCAACAATCCCTATGACTATTCCTACATCTCCCAAGGAGAAGTCACAGTCGCCTCCATTGATGATTCTGATGAACTGATGGCAACAGATAATGCATTTGATGTGCTGGGTTTCACTGCTGATGAGAAAGTTGGAGTGTACAAACTGACTGGAGCCATCATGCACTCTGGAAACATGAGGTTCAAGCAGAAGCAGCGTGAGGAGCAAGCTGAACCCGATGGCACTGAAGAGGCTGACAAAGCTGCCTATTTAATGGGATTGAACTCTGCTGACTTGCTTAAGGGCTTGTGCCACCCACGCGTCAAGGTTGGAAATGAGTATGTGACCAAGGGACAAAATGTCCAGCAGGTCAATTACTCTATTGGTGCACTGGCCAAGTCAGTGTATGAGAAGATGTTCTTGTGGATGGTTGTGAGAATCAACGCCACTCTAGAGACCAAGCAGCCCAGACAGTACTTCATAGGAGTACTGGATATTGCAGGCTTCGAGATCTTTGATTTTAACAGCTTTGAGCAGCTCTGTATTAATTTCACCAACGAGAAACTGCAGCAGTTCTTCAATCATCACATGTTCGTGCTGGAGCAGGAAGAGTACAAGAAAGAAGGAATTGAATGGGAGTTCATAGACTTTGGGATGGACTTGCAGGCCTGCATTGATCTTATAGAAAAGCCTATGGGCATCATGTCCATCCTGGAAGAAGAGTGCATGTTTCCCAAAGCCAGTGATACGACCTTCAAGGCTAAACTATATGACAATCATCTGGGCAAGTCAAACAACTTCCAAAAGCCCAGAAACATCAAGGGGAAGCCTGAGGCTCACTTTGCTCTTGTACACTATGCTGGCACCGTGGACTATAACATCTCTGGCTGGCTGGAGAAGAACAAGGATCCCCTGAATGAGACAGTTGTTGGGCTGTACCAGAAGTCCTCCCTCAAGCTCTTGGCAGTTCTGTTTGCTAACTATGCTGGTGCTGATTCAGATACTGGTGGAAAAGGCAAAGGAGCAAAGAAAAAGGGTTCTTCTTTCCAGACAGTATCTGCTCTACACAGGGAGAATCTTAACAAGCTAATGACAAATCTGAGAACCACCCACCCACACTTTGTGCGTTGTATCATCCCCAATGAACGCAAGGCTCCAGGAGAGATGGACAATCCTCTAGTGATGCACCAGTTGCGTTGTAATGGTGTCCTGGAAGGTATTAGAATCTGCAGAAAGGGATTTCCCAACCGTATCCTGTATGGAGACTTCAGGCAGAGATACCGAATACTGAACCCTGCAGCCATCCCTGAAGGGCAGTTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCAACAAGTGGATGATTTAGAAGGATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAAA
                                                  Xt7.1-CHK-1008264824                                                            GATGCCCTGATGGCAGACTTTGGGGCTGCAGCCCCCTTCCTCAGAAAATCAGACAAAGAACGTCTGGAGGCTCAGACCCGGGTTTTTGATATCAAGACTGAGTGCTTTGTGCCTGAACCCCAACAAGAATATGTGAAAGCAAAAATTATTAGTCGTGAAGGGGGCAAAGTGACAGCTGAAACTCAAGATGGCAAGACAATCACAGTTAAAGACTCTGATGTTCACCAGCAAAATCCTCCCAAGTTCGATAAGATTGAGGACATGGCGATGTTGACCTTTCTGCACGAGCCAGCTGTACTGTACAACCTCAAAGAGCGTTATGCAGCCTGGATGATCTACACATATTCTGGTCTCTTCTGTGTGACCGTAAATCCCTACAAGTGGCTTCCTGTGTATAATTCAGAGGTTGTGACTGCTTACCGTGGGAAGAAAAGGAGTGAAGCCCCACCACACATCTTCTCTATCTCTGATAATGCATATCAGTACATGCTGACAGATCGTGAGAATCAGTCCATTCTTATCACTGGAGAATCTGGTGCTGGGAAGACTGTGAACACAAAGCGTGTCATCCAGTACTTTGCAAGTATTGCATCTGTTGGAGGCAAAAAAGAACAAGCAAATGCCAACAAGGGAACTCTGGAAGATCAAATCATCCAGGCCAACCCTGCTCTGGAGGCTTTTGGTAATGCCAAGACTGTCAGGAATGACAACTCCTCACGTTTTGGTAAATTTATCAGAATTCACTTTGGTGCCTCTGGGAAGTTGGCATCTGCTGATATAGAAACCTATCTCCTGGAAAAATCCAGAGTTATCTTCCAGCTGAAGTCTGAGAGAGACTATCACATCTTCTATCAGATTCTATCCAATAAAAAGCCAGAGCTTTTGGACATGTTGCTAGTGACCAACAATCCCTATGACTATTCCTACATCTCCCAAGGAGAAGTCACAGTCGCCTCCATTGATGATTCTGATGAACTGATGGCAACAGATAATGCATTTGATGTGCTGGGTTTCACTGCTGATGAGAAAGTTGGAGTGTACAAACTGACTGGAGCCATCATGCACTCTGGAAACATGAGGTTCAAGCAGAAGCAGCGTGAGGAGCAAGCTGAACCCGATGGCACTGAAGAGGCTGACAAAGCTGCCTATTTAATGGGATTGAACTCTGCTGACTTGCTTAAGGGCTTGTGCCACCCACGCGTCAAGGTTGGAAATGAGTATGTGACCAAGGGACAAAATGTCCAGCAGGTCAATTACTCTATTGGTGCACTGGCCAAGTCAGTGTATGAGAAGATGTTCTTGTGGATGGTTGTGAGAATCAACGCCACTCTAGAGACCAAGCAGCCCAGACAGTACTTCATAGGAGTACTGGATATTGCAGGCTTCGAGATCTTTGATTTTAACAGCTTTGAGCAGCTCTGTATTAATTTCACCAACGAGAAACTGCAGCAGTTCTTCAATCATCACATGTTCGTGCTGGAGCAGGAAGAGTACAAGAAAGAAGGAATTGAATGGGAGTTCATAGACTTTGGGATGGACTTGCAGGCCTGCATTGATCTTATAGAAAAGCCTATGGGCATCATGTCCATCCTGGAAGAAGAGTGCATGTTTCCCAAAGCCAGTGATACGACCTTCAAGGCTAAACTATATGACAATCATCTGGGCAAGTCAAACAACTTCCAAAAGCCCAGAAACATCAAGGGGAAGCCTGAGGCTCACTTTGCTCTTGTACACTATGCTGGCACCGTGGACTATAACATCTCTGGCTGGCTGGAGAAGAACAAGGATCCCCTGAATGAGACAGTTGTTGGGCTGTACCAGAAGTCCTCCCTCAAGCTCTTGGCAGTTCTGTTTGCTAACTATGCTGGTGCTGATTCAGATACTGGTGGAAAAGGCAAAGGAGCAAAGAAAAAGGGTTCTTCTTTCCAGACAGTATCTGCTCTACACAGGGAGAATCTTAACAAGCTAATGACAAATCTGAGAACCACCCACCCACACTTTGTGCGTTGTATCATCCCCAATGAACGCAAGGCTCCAGGAGAGATGGACAATCCTCTAGTGATGCACCAGTTGCGTTGTAATGGTGTCCTGGAAGGTATTAGAATCTGCAGAAAGGGATTTCCCAACCGTATCCTGTATGGAGACTTCAGGCAGAGATACCGAATACTGAACCCTGCAGCCATCCCTGAAGGGCAGTTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCAACAAGTGGATGATTTAGAAGGATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAxxAAAAAAAA
                                                      consensus depths                                                           4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     5     5     5     5     5     5     4     5     5     5     4     4     3     3     3     3     3     3     3     3     3     3     2     3     2     3     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     3     5     3     5     3     5     3     5     2     5     3     4     3     4     2     3     3     3     3     3     3     3     4     4     4     4     3     4     4     5     6     6     6     6     6     6     6     6     5     6     6     6     6     6     5     6     6     6     5     7     7     8     9     9     9     9    10    10    11    11    11    11    10    11    11    11    11    11    11    13    13    13    13    13    12    13    12    13    13    13    12    13    11    12    11    11    10    11    11    11    11    11    12    12    12    12    11    12    12    12    11    12    12    12    11    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    11    12    13    13    13    14    13    14    13    14    13    14    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    13    12    13    12    13    12    13    13    14    13    14     8     9     6     8     6     7     7     8     7     8     7     8     7     8     7     8     7     8     8     9     9    10     9    10     9    10     9    10    11    11    11    11    11    11    14    14    15    15    15    15    14    14    14    14    14    14    14    14    14    14    14    14    15    15    17    17    17    17    17    17    17    17    17    17    18    18    19    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    19    19    20    20    19    20    19    20    19    20    18    19    18    19    18    19    18    19    19    20    19    20    19    20    17    18    17    18    16    17    16    17    16    17    16    17    16    16    17    17    17    17    18    18    19    19    19    19    19    19    19    19    20    20    18    18    19    19    19    19    19    19    18    18    19    19    19    19    18    19    19    20    20    21    20    20    20    20    18    20    20    20    22    23    21    22    20    21    20    20    22    22    21    21    23    24    24    24    24    24    24    26    25    26    25    26    24    26    24    27    26    27    23    26    22    27    23    25    24    25    24    25    26    27    26    27    26    27    28    29    30    31    30    31    30    31    30    31    30    31    29    31    30    31    31    32    31    32    30    31    31    32    31    31    29    30    29    29    29    29    29    29    28    29    29    29    29    29    28    29    29    29    30    31    30    31    30    31    30    32    30    32    30    33    30    34    32    35    33    36    34    35    33    34    34    34    34    34    34    34    33    35    33    35    35    35    35    39    37    38    36    37    37    37    37    38    38    38    39    39    38    39    38    39    40    42    40    42    39    41    40    41    42    43    41    42    38    38    36    36    36    36    36    41    37    43    40    51    42    56    63    67    68    73    68    72    69    75    72    74    72    76    75    81    76    84    86    90    88    92    90    92    90    93    91    93    91    93    89    92    89    92    91    95    94    97    94    97    94    97    96    98    96    98    97   100    97   100    97   100    97   100    97   100    96    99    95    98    97   101    98   101    96   100    96   101    93    99    94    98    94    98    93    96    94    96    96    98    96   100    98   101    99   101    96   101    98   100    98    99    96    98    97    98    96    97    93    95    93    97    93    97    94    98    95    98    96    98    93    95    92    94    91    94    91    94    89    93    82    90    80    87    80    87    80    87    79    86    79    86    79    86    78    86    76    84    73    80    14    20
  5   1   2      ests                                 Xt7.1-CAAQ3242.5 CATCGATTCAATCGGCACGAGGCTGGTCCTTTTGCTGAACACAAGGCTCCACAATGGGTGATGCCCTGATGGCAGACTTTGGGGCTGCAGCCCCCTTCCTCAGAAAATCAGACAAAGAACGTCTGGAGGCTCAGACCCGGGTTTTTGATATCAAGACTGAGTGCTTTGTGCCTGAACCCCAACAAGAATATGTGAAAGCAAAAATTATTAGTCGTGAAGGGGGCAAAGTGACAGCTGAAACTCAAGATGGCAAGACAATCACAGTTAAAGACTCTGATGTTCACCAGCAAAATCCTCCCAAGTTCGATAAGATTGAGGACATGGCGATGTTGACCTTTCTGCACGAGCCAGCTGTACTGTACAACCTCAAAGAGCGTTATGCAGCCTGGATGATCTACACATATTCTGGTCTCTTCTGTGTGACCGTAAATCCCTACAAGTGGCTTCCTGTGTATAATTCAGAGGTTGTGACTGCTTACCGTGGGAAGAAAAGGAGTGAAGCCCCACCACACATCTTCTCTATCTCTGATAATGCATATCAGTACATGCTGACAGATCGTGAGAATCAGTCCATTCTTATCACTGGAGAATCTGGTGCTGGGAAGACTGTGAACACAAAGCGTGTCATCCAGTACTTTGCAAGTATTGCATCTGTTGGAGGCAAAAAAGAACAAGCAAATGCCAACAAGGGAACTCTGGAAGATCAAATCATCCAGGCCAACCCTGCTCTGGAGGCTTTTGGTAATGCCAAGACTGTCAGGAATGACAACTCCTCACGTTTTGGTAAATTTATCAGAATTCACTTTGGTGCCTCTGGGAAGTTGGCATCTGCTGATATAGAAACCTATCTCCTGGAAAAATCCAGAGTTATCTTCCAGCTGAAGTCTG
  5   1   2      ests                                 Xt7.1-CAAQ8283.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCAGAAGCAGCGTGAGGAGCAAGCTGAACCCGATGGCACTGAAGAGGCTGACAAAGCTGCCTATTTAATGGGATTGAACTCTGCTGACTTGCTTAAGGGCTTGTGCCACCCACGCGTCAAGGTTGGAAATGAGTATGTGACCAAGGGACAAAATGTCCAGCAGGTCAATTACTCTATTGGTGCACTGGCCAAGTCAGTGTATGAGAAGATGTTCTTGTGGATGGTTGTGAGAATCAACGCCACTCTAGAGACCAAGCAGCCCAGACAGTACTTCATAGGAGTACTGGATATTGCAGGCTTCGAGATCTTTGATTTTAACAGCTTTGAGCAGCTCTGTATTAATTTCACCAACGAGAAACTGCAGCAGTTCTTCAATCATCACATGTTCGTGCTGGAGCAGGAAGAGTACAAGAAAGAAGGAATTGAATGGGAGTTCATAGACTTTGGGATGGACTTGCAGGCCTGCATTGATCTTATAGAAAAGCCTATGGGCATCATGTCCATCCTGGAAGAAGAGTGCATGTTTCCCAAAGCCAGTGATACGACCTTCAAGGCTAAACTATATGACAATCATCTGGGCAAGTCAAACAACTTCCAAAAGCCCAGAAACATCAAGGGGAAGCCTGAGGCTCACTTTGCTCTTGTACACTATGCTGGCACCGTGGACTATAACATCTCTGGCTGGCTGGAGAAGAACAAGGATCCCCTGAATGAGACAGTTGTTGGGCTGTACCAGAAGTCCTCCCTCAAGCTCTTGGCAGTTCTGTTTGCTAACTATGCTGGTGCTGATTCAGATACTGGTGGAAAAGGCAAAGGAGCAAAGAAAAAGGGTTCTTCTTTCCAGACAGTATCTGCTCTACACAGGGAGAATCTTAACAAGCTAATGACAAATCTGAGAACCACCCACCCACACTTTGTGCGTTGTATCATCCCCAATGAACGCAAGGCTCCAGGAGAGATGGACAATCCTCTAGTGATGCACCAGTTGCGTTGTAATGGTGTCCTGGAAGGTATTAGAATCTGCAGAAAGGGATTTCCCAACCGTATCCTGTATGGAGACTTCAGGCAGAGATACCGAATACTGAACCCTGCAGCCATCCCTGAAGGGCAGTTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCAACAAGTGGATGATTTAGAAGGATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAA
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --TC--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------A
                                               BLH ATG       0    2969                                                      
                                               BLH MPR      -3     381                                                      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bf ---- 1e-012     CAA11444.1 intermediate filament protein C1 [Branchiostoma floridae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Br ---- 4e-014     CAC13104.1 nuclear lamin [Branchiostoma lanceolatum] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Cs ---- 4e-016     AAX84194.1 cytospin A [Ciona savignyi] -----------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ci ---- 2e-021     NP_001007565.1 hyaluronan-mediated motility receptor [Ciona intestinalis] ---------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                    PROTEIN --- Sc ---- 0          NP_011888.1 myosin class II; Myo1p [Saccharomyces cerevisiae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bb ---- 0          BAC16746.1 myosin heavy chain [Branchiostoma belcheri] ----------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                        PROTEIN --- Ce ---- 0          NP_493596.1 UNCoordinated locomotion UNC-54, MYOsin heavy chain structural gene MYO-4 (224.8kD) (unc-54) [Caenorhabditis elegans] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                 PREDICTED - Sp ---- 0          XP_785810.2 PREDICTED: similar to myosin heavy chain [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                         PROTEIN --- Dm ---- 0          NP_723999.1 CG17927-PC [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Xt ==== 0          AAH76678.1 Myosin, heavy polypeptide 13, skeletal muscle [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                        PROTEIN --- Gg ==== 0          NP_001001302.1 chick atrial myosin heavy chain [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED = Dr ==== 0          XP_684394.1 PREDICTED: ventricular myosin heavy chain isoform 1 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Hs ==== 0          NP_002462.1 myosin heavy chain 6; myosin heavy chain, cardiac muscle alpha isoform [Homosapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Mm ==== 0          NP_034986.1 myosin, heavy polypeptide 6, cardiac muscle, alpha; myosin heavy chain, cardiacmuscle, adult; alpha myosin; alpha cardiac MHC; cardiomyopathy, hypertrophic 1[Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Xl ==== 0          AAW88310.1 cardiac myosin heavy chain-alpha [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED = ?? ==== 0          NP_001085070.1 hypothetical protein LOC432141 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAQ8283.3.5                                                      ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------ATG------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------ATG------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATGATG---ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------ATG---------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------TAA---------------ATGTGA---TAA
                                                                   ORF                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2      ests                                 Xt7.1-CAAQ3242.5 CATCGATTCAATCGGCACGAGGCTGGTCCTTTTGCTGAACACAAGGCTCCACAATGGGTGATGCCCTGATGGCAGACTTTGGGGCTGCAGCCCCCTTCCTCAGAAAATCAGACAAAGAACGTCTGGAGGCTCAGACCCGGGTTTTTGATATCAAGACTGAGTGCTTTGTGCCTGAACCCCAACAAGAATATGTGAAAGCAAAAATTATTAGTCGTGAAGGGGGCAAAGTGACAGCTGAAACTCAAGATGGCAAGACAATCACAGTTAAAGACTCTGATGTTCACCAGCAAAATCCTCCCAAGTTCGATAAGATTGAGGACATGGCGATGTTGACCTTTCTGCACGAGCCAGCTGTACTGTACAACCTCAAAGAGCGTTATGCAGCCTGGATGATCTACACATATTCTGGTCTCTTCTGTGTGACCGTAAATCCCTACAAGTGGCTTCCTGTGTATAATTCAGAGGTTGTGACTGCTTACCGTGGGAAGAAAAGGAGTGAAGCCCCACCACACATCTTCTCTATCTCTGATAATGCATATCAGTACATGCTGACAGATCGTGAGAATCAGTCCATTCTTATCACTGGAGAATCTGGTGCTGGGAAGACTGTGAACACAAAGCGTGTCATCCAGTACTTTGCAAGTATTGCATCTGTTGGAGGCAAAAAAGAACAAGCAAATGCCAACAAGGGAACTCTGGAAGATCAAATCATCCAGGCCAACCCTGCTCTGGAGGCTTTTGGTAATGCCAAGACTGTCAGGAATGACAACTCCTCACGTTTTGGTAAATTTATCAGAATTCACTTTGGTGCCTCTGGGAAGTTGGCATCTGCTGATATAGAAACCTATCTCCTGGAAAAATCCAGAGTTATCTTCCAGCTGAAGTCTG
                                                  Xt7.1-CHK-1008245023       TTCAATCGGCACGAGGCTGGTCCTTTTGCTGAACACAAGGCTCCACAATGGGTGATGCCCTGATGGCAGACTTTGGGGCTGCAGCCCCCTTCCTCAGAAAATCAGACAAAGAACGTCTGGAGGCTCAGACCCGGGTTTTTGATATCAAGACTGAGTGCTTTGTGCCTGAACCCCAACAAGAATATGTGAAAGCAAAAATTATTAGTCGTGAAGGGGGCAAAGTGACAGCTGAAACTCAAGATGGCAAGACAATCACAGTTAAAGACTCTGATGTTCACCAGCAAAATCCTCCCAAGTTCGATAAGATTGAGGACATGGCGATGTTGACCTTTCTGCACGAGCCAGCTGTACTGTACAACCTCAAAGAGCGTTATGCAGCCTGGATGATCTACACATATTCTGGTCTCTTCTGTGTGACCGTAAATCCCTACAAGTGGCTTCCTGTGTATAATTCAGAGGTTGTGACTGCTTACCGTGGGAAGAAAAGGAGTGAAGCCCCACCACACATCTTCTCTATCTCTGATAATGCATATCAGTACATGCTGACAGATCGTGAGAATCAGTCCATTCTTATCACTGGAGAATCTGGTGCTGGGAAGACTGTGAACACAAAGCGTGTCATCCAGTACTTTGCAAGTATTGCATCTGTTGGAGGCAAAAAAGAACAAGCAAATGCCAACAAGGGAACTCTGGAAGATCAAATCATCCAGGCCAACCCTGCTCTGGAGGCTTTTGGTAATGCCAAGACTGTCAGGAATGACAACTCCTCACGTTTTGGTAAATTTATCAGAATTCACTTTGGTGCCTCTGGGAAGTTGGCATCTGCTGATATAGAAACCTATCTCCTGGAAAAATCCAGAGTTATCTTCCAGCTGA
  5   1   2       bld Hrt1 PIPE in                         CAAQ4990.5p CATCGATTCAATCGGCACGAGGCTGGTCCTTTTGCTGAACACAAGGCTCCACAATGGGTGATGCCCTGATGGCAGACTTTGGGGCTGCAGCCCCCTTCCTCAGAAAATCAGACAAAGAACGTCTGGAGGCTCAGACCCGGGTTTTTGATATCAAGACTGAGTGCTTTGTGCCTGAACCCCAACAAGAATATGTGAAAGCAAAAATTATTAGTCGTGAAGGGGGCAAAGTGACAGCTGAAACTCAAGATGGCAAGACAATCACAGTTAAAGACTCTGATGTTCACCAGCAAAATCCTCCCAAGTTCGATAAGATTGAGGACATGGCGATGTTGACCTTTCTGCACGAGCCAGCTGTACTGTACAACCTCAAAGAGCGTTATGCAGCCTGGATGATCTACACATATTCTGGTCTCTTCTGTGTGACCGTAAATCCCTACAAGTGGCTTCCTGTGTATAATTCAGAGGTTGTGACTGCTTACCGTGGGAAGAAAAGGAGTGAAGCCCCACCACACATCTTCTCTATCTCTGATAATGCATATCAGTACATGCTGACAGATCGTGAGAATCAGTCCATTCTTATCACTGGAGAATCTGGTGCTGGGAAGACTGTGAACACAAAGCGTGTCATCCAGTACTTTGCAAGTATTGCATCTGTTGGAGGCAAAAAAGAACAAGCAAATGCCAACAAGGGAACTCTGGAAGATCAAATCATCCAGGCCAACCCTGCTCTGGAGGCTTTTGGTAATGCCAAGACTGTCANGAAATGACACTCCTCACGTTTTGGTAAATTTATC
  5   1   2      seed Hrt1      in                         CAAQ3242.5p                  CTCGATTCAATTCGGCACGAGGCACAAGGCTCCACAATGGGTGATGCCCTGATGGCAGACTTTGGGGCTGCAGCCCCCTTCCTCAGAAAATCAGACAAAGAACGTCTGGAGGCTCAGACCCGGGTTTTTGATATCAAGACTGAGTGCTTTGTGCCTGAACCCCAACAAGAATATGTGAAAGCAAAAATTATTAGTCGTGAAGGGGGCAAAGTGACAGCTGAAACTCAAGATGGCAAGACAATCACAGTTAAAGACTCTGATGTTCACCAGCAAAATCCTCCCAAGTTCGATAAGATTGAGGACATGGCGATGTTGACCTTTCTGCACGAGCCAGCTGTACTGTACAACCTCAAAGAGCGTTATGCAGCCTGGATGATCTACACATATTCTGGTCTCTTCTGTGTGACCGTAAATCCCTACAAGTGGCTTCCTGTGTATAATTCAGAGGTTGTGACTGCTTACCGTGGGAAGAAAAGGAGTGAAGCCCCACCACACATCTTCTCTATCTCTGATAATGCATATCAGTACATGCTGACAGATCGTGAGAATCAGTCCATTCTTATCACTGGAGAATCTGGTGCTGGGAAGACTGTGAACACAAAGCGTGTCATCCAGTACTTTGCAAGTATTGCATCTGTTGGAGGCAAAAAAGAACAAGCAAATGCCAACAAGGGAACTCTGGAAGATCAAATCATCCAGGCCAACCCTGCTCTGGAGGCTTTTGGTAATGCCAAGACTGTCAGGAATGACAACTCCTCACGTTTTGGTAAATTTATCAGAATTCACTTTGGTGCCTCTGGGAAGTTGGCATCTGCTGATATAGAAACCTATCTCCTGGAAAATCCAGAGTTATCTTCCAGCTGAAGTCTG
  5   1   2       bld Hrt1      in                        CAAQ11969.5p                                                  CACAATGGGTGATGCCCTGATGGCAGACTTTGGGGCTGCAGCCCCCTTCCTCAGAAAATCAGACAAAGAACGTCTGGAGGCTCAGACCCGGGTTTTTGATATCAAGACTGAGTGCTTTGTGCCTGAACCCCAACAAGAATATGTGAAAGCAAAAATTATTAGTCGTGAAGGGGGCAAAGTGACAGCTGAAACTCAAGATGGCAAGACAATCACAGTTAAAGACTCTGATGTTCACCAGCAAAATCCTCCCAAGTTCGATAAGATTGAGGACATGGCGATGTTGACCTTTCTGCACGAGCCAGCTGTACTGTACAACCTCAAAGAGCGTTATGCAGCCTGGATGATCTACACATATTCTGGTCTCTTCTGTGTGACCGTAAATCCCTACAAGTGGCTTCCTGTGTATAATTCAGAGGTTGTGACTGCTTACCGTGGGAAGAAAAGGAGTGAAGCCCCACCACACATCTTCTCTATCTCTGATAATGCATATCAGTACATGCTGACAGATCGTGAGAATCAGTCCATTCTTATCACTGGAGAATCTGGTGCTGGGAAGACTGTGAACACAAAGCGTGTCATCCAGTACTTTGCAAGTATTGCATCTGTTGGAGGCAAAAAAGAACAAGCAAATGCCAACAAGGGAACTCTGGAAGATCANATCATCCAGGCCAACCCTGCTCTGGAGGCTTTTGGTAATGCCAAGACTGTCAGGAATGACAACTCCTCACGTTTTGGTAAATTTATCAGAATTCA
  5   1   2       bld Hrt1      in                         CAAQ9535.5p                                                  CCACATGGGTGATGCCCTGATGGCAGACTTTGGGGCTGCAGCCCCCTTCCTCAGAAAATCAGACAAAGAACGTCTGGAGGCTCAGACCCGGGTTTTTGATATCAAGACTGAGTGCTTTGTGCCTGAACCCCAACAAGAATATGTGAAAGCAAAAATTATTAGTCGTGAAGGGGGCAAAGTGACAGCTGAAACTCAAGATGGCAAGACAATCACAGTTAAAGACTCTGATGTTCACCAGCAAAATCCTCCCAAGTTCGATAAGATTGAGGACATGGCGATGTTGACCTTTCTGCACGAGCCAGCTGTACTGTACAACCTCAAAGAGCGTTATGCAGCCTGGATGATCTACACATATTCTGGTCTCTTCTGTGTGACCGTAAATCCCTACAAGTGGCTTCCTGTGTATAATTCAGAGGTTGTGACTGCTTACCGTGGGAAGAAAAGGAGTGAAGCCCCACCACACATCTTCTCTATCTCTGATAATGCATATCAGTACATGCTGACAGATCGTGAGAATCAGTCCATTCTTATCACTGGAGAATCTGGTGCTGGGAAGACTGTGAACACAAAGCGTGTCATCCAGTACTTTGCAAGTATTGCATCTGTTGGAGGCAAAAAAGAACAAGCAAATGCCAACAAGGGAACTCTGGAAGATCAAATCATCCAGGCCAACCCTGCTCTGGAGGCTTTTGGTAATGCCAAGACTGTCAGGAATGACAACTCCTCACGTTTTGGTAAATTTATCAGAATTCACTTTGGTGCCTCTGGGAAGTTGGCATCTGCTGATATAGAAACCTATCTCCTGGAAAAATCCAGAGTTATCTTCCAGCTGAAGTCTG
  5   1   2      ests                                 Xt7.1-CAAQ8283.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGCAGAAGCAGCGTGAGGAGCAAGCTGAACCCGATGGCACTGAAGAGGCTGACAAAGCTGCCTATTTAATGGGATTGAACTCTGCTGACTTGCTTAAGGGCTTGTGCCACCCACGCGTCAAGGTTGGAAATGAGTATGTGACCAAGGGACAAAATGTCCAGCAGGTCAATTACTCTATTGGTGCACTGGCCAAGTCAGTGTATGAGAAGATGTTCTTGTGGATGGTTGTGAGAATCAACGCCACTCTAGAGACCAAGCAGCCCAGACAGTACTTCATAGGAGTACTGGATATTGCAGGCTTCGAGATCTTTGATTTTAACAGCTTTGAGCAGCTCTGTATTAATTTCACCAACGAGAAACTGCAGCAGTTCTTCAATCATCACATGTTCGTGCTGGAGCAGGAAGAGTACAAGAAAGAAGGAATTGAATGGGAGTTCATAGACTTTGGGATGGACTTGCAGGCCTGCATTGATCTTATAGAAAAGCCTATGGGCATCATGTCCATCCTGGAAGAAGAGTGCATGTTTCCCAAAGCCAGTGATACGACCTTCAAGGCTAAACTATATGACAATCATCTGGGCAAGTCAAACAACTTCCAAAAGCCCAGAAACATCAAGGGGAAGCCTGAGGCTCACTTTGCTCTTGTACACTATGCTGGCACCGTGGACTATAACATCTCTGGCTGGCTGGAGAAGAACAAGGATCCCCTGAATGAGACAGTTGTTGGGCTGTACCAGAAGTCCTCCCTCAAGCTCTTGGCAGTTCTGTTTGCTAACTATGCTGGTGCTGATTCAGATACTGGTGGAAAAGGCAAAGGAGCAAAGAAAAAGGGTTCTTCTTTCCAGACAGTATCTGCTCTACACAGGGAGAATCTTAACAAGCTAATGACAAATCTGAGAACCACCCACCCACACTTTGTGCGTTGTATCATCCCCAATGAACGCAAGGCTCCAGGAGAGATGGACAATCCTCTAGTGATGCACCAGTTGCGTTGTAATGGTGTCCTGGAAGGTATTAGAATCTGCAGAAAGGGATTTCCCAACCGTATCCTGTATGGAGACTTCAGGCAGAGATACCGAATACTGAACCCTGCAGCCATCCCTGAAGGGCAGTTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCAACAAGTGGATGATTTAGAAGGATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAA
                                                  Xt7.1-CHK-1008221975                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCAGCGTGAGGAGCAAGCTGAACCCGATGGCACTGAAGAGGCTGACAAAGCTGCCTATTTAATGGGATTGAACTCTGCTGACTTGCTTAAGGGCTTGTGCCACCCACGCGTCAAGGTTGGAAATGAGTATGTGACCAAGGGACAAAATGTCCAGCAGGTCAATTACTCTATTGGTGCACTGGCCAAGTCAGTGTATGAGAAGATGTTCTTGTGGATGGTTGTGAGAATCAACGCCACTCTAGAGACCAAGCAGCCCAGACAGTACTTCATAGGAGTACTGGATATTGCAGGCTTCGAGATCTTTGATTTTAACAGCTTTGAGCAGCTCTGTATTAATTTCACCAACGAGAAACTGCAGCAGTTCTTCAATCATCACATGTTCGTGCTGGAGCAGGAAGAGTACAAGAAAGAAGGAATTGAATGGGAGTTCATAGACTTTGGGATGGACTTGCAGGCCTGCATTGATCTTATAGAAAAGCCTATGGGCATCATGTCCATCCTGGAAGAAGAGTGCATGTTTCCCAAAGCCAGTGATACGACCTTCAAGGCTAAACTATATGACAATCATCTGGGCAAGTCAAACAACTTCCAAAAGCCCAGAAACATCAAGGGGAAGCCTGAGGCTCACTTTGCTCTTGTACACTATGCTGGCACCGTGGACTATAACATCTCTGGCTGGCTGGAGAAGAACAAGGATCCCCTGAATGAGACAGTTGTTGGGCTGTACCAGAAGTCCTCCCTCAAGCTCTTGGCAGTTCTGTTTGCTAACTATGCTGGTGCTGATTCAGATACTGGTGGAAAAGGCAAAGGAGCAAAGAAAAAGGGTTCTTCTTTCCAGACAGTATCTGCTCTACACAGGGAGAATCTTAACAAGCTAATGACAAATCTGAGAACCACCCACCCACACTTTGTGCGTTGTATCATCCCCAATGAACGCAAGGCTCCAGGAGAGATGGACAATCCTCTAGTGATGCACCAGTTGCGTTGTAATGGTGTCCTGGAAGGTATTAGAATCTGCAGAAAGGGATTTCCCAACCGTATCCTGTATGGAGACTTCAGGCAGAGATACCGAATACTGAACCCTGCAGCCATCCCTGAAGGGCAGTTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCAACAAGTGGATGATTTAGAAGGATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAxTAAAAA
  5   1   2       bld Hrt1      in                         CAAQ4502.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAATTCGGCACGAGGGGCCACCCTGCTCTGGAGGCTTTTGGTAATGCCAAGACTGTCAGGAATGACAACTCCTCACGTTTTGGTAAATTTATCAGAATTCACTTTGGTGCCTCTGGGAAGTTGGCATCTGCTGATATAGAAACCTATCTCCTGGAAAAATCCAGAGTTATCTTCCAGCTGAAGTCTGAGAGAGACTATCACATCTTCTATCAGATTCTATCCAATAAAAAGCCAGAGCTTTTGGACATGTTGCTAGTGACCAACAATCCCTATGACTATTCCTACATCTCCCAAGGAGAAGTCACAGTCGCCTCCATTGATGATTCTGATGAACTGATGGCAACAGATAATGCATTTGATGTGCTGGGTTTCACTGCTGATGAGAAAGTTGGAGTGTACAAACTGACTGGAGCCATCATGCACTCTGGAAACATGAGGTTCAAGCAGAAGCAGCGTGAGGAGCAAGCTGAACCCGATGGCACTGAAGAGGCTGACAAAGCTGCCTATTTAATGGGATTGAACTCTGCTGACTTGCTTAAGGGCTTGTGCCACCCACGCGTCAAGGTTGGAAATGAGTATGTGACCAAGGGACAAAATGTCCAGCAGGTCAATTACTCTATTGGTGCACTGGCCAAGTCAGTGTATGAGAAGATGTTCTTGTGGATGGTTGTGAGAATCAACGCCACTCTAGAGACCAAGCAGCCCAGACAGTACTTCATAGGAGTACTGGATATTGCAGGCTTCGAGATCTTTGATTTTAACAGCTTTGAGCAGCTCTGTATTAATTTCACCAACGAGAAACTGCAGCAGTTCTTCAATCATCACATGTTCGTGCTGGAGCAGGAAGAGTACCAGAAAGAAGGAAT
  5   1   2       bld Hrt1      in                        CAAQ12507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTCTATCCAATAAAAAGCCAGAGCTTTTGGACATGTTGCTAGTGACCAACAATCCCTATGACTATTCCTACATCTCCCAAGGAGAAGTCACAGTCGCCTCCATTGATGATTCTGATGAACTGATGGCAACAGATAATGCATTTGATGTGCTGGGTTTCACTGCTGATGAGAAAGTTGGAGTGTACAAACTGACTGGAGCCATCATGCACTCTGGAAACATGAGGTTCAAGCAGAAGCAGCGTGAGGAGCAAGCTGAACCCGATGGCACTGAAGAGGCTGACAAAGCTGCCTATTTAATGGGATTGAACTCTGCTGACTTGCTTAAGGGCTTGTGCCACCCACGCGTCAAGGTTGGAAATGAGTATGTGACCAAGGGACAAAATGTCCAGCAGGTCAATTACTCTATTGGTGCACTGGCCAAGTCAGTGTATGAGAAGATGTTCTTGTGGATGGTTGTGAGAATCAACGCCACTCTAGAGACCAAGCAGCCCAGACAGTACTTCATAGGAGTACTGGATATTGCAGGCTTCGAGATCTTTGATTTTAACAGCTTTGAGCAGCTCTGTATTAATTTCACCAACGAGAAACTGCAGCAGTTCTTCAATCATCACATGTTCGTGCTGGAGCAGGAAGAGTACAAGAAAGAAGGAATTGAATGGGAGTTCATAGACTTTGGGATGGACTTGCAGGCCTGCATTGATCTTATAGAAAAGCCTATGGGCATCATGTCCATCCTGGAAGAAGAGTGCATGTTTCCCANAGCCAGTGATACGACCTTCAAGGCTAAACTATATGACAATCATCTGGGCAAGTCAAACAACTTC
  5   1   2       bld Hrt1      in                        CAAQ10054.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATGAGGTTCAAGCAGAAGCAGCGTGAGGAGCAAGCTGAACCCGATGGCACTGAAGAGGCTGACAAAGCTGCCTATTTAATGGGATTGAACTCTGCTGACTTGCTTAAGGGCTTGTGCCACCCACGCGTCAAGGTTGGAAATGAGTATGTGACCAAGGGACAAAATGTCCAGCAGGTCAATTACTCTATTGGTGCACTGGCCAAGTCAGTGTATGAGAAGATGTTCTTGTGGATGGTTGTGAGAATCAACGCCACTCTAGAGACCAAGCAGCCCAGACAGTACTTCATAGGAGTACTGGATATTGCAGGCTTCGAGATCTTTGATTTTAACAGCTTTGAGCAGCTCTGTATTAATTTCACCAACGAGAAACTGCAGCAGTTCTTCAATCATCACATGTTCGTGCTGGAGCAGGAAGAGTACAAGAAAGAAGGAATTGAATGGGAGTTCATAGACTTTGGGATGGACTTGCAGGCCTGCATTGATCTTATAGAAAAGCCTATGGGCATCATGTCCATCCTGGAAGAAGAGTGCATGTTTCCCAAAGCCAGTGATACGACCTTCAAGGCTAAACTATATGACAATCATCTGGGCAAGTCAAACAACTTCCAAAAGCCCAGAAACATCAAGGGGAAGCCTGAGGCTCACTTTGCTCTTGTACACTATGCTGGCACCGTGGACTATAACATCTCTGGCTGGCTGGAGAAGAACAAGGATCCCCTGAATGAGACAGTTGTTGGGCTGTACCAGAAGTCCTCCCTNCAGCTCTTGGCAGTTCTGTTTGCTAACTATGCTGGTGCTGATTCAGATACTGNTGGAAAAAGCAAAGGAGCAAGAAAAAGGGTTCTTCTTTTCAGACAGTATCTGCTCTACACAGGGAGAATC
  5   1   2       bld Hrt1      in                        CAAQ11399.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGGAGCAAGCTGAACCCGATGGCACTGAAGAGGCTGACAAAGCTGCCTATTTAATGGGATTGAACTCTGCTGACTTGCTTAAGGGCTTGTGCCACCCACGCGTCAAGGTTGGAAATGAGTATGTGACCAAGGGACAAAATGTCCAGCAGGTCAATTACTCTATTGGTGCACTGGCCAAGTCAGTGTATGAGAAGATGTTCTTGTGGATGGTTGTGAGAATCAACGCCACTCTAGAGACCAAGCAGCCCAGACAGTACTTCATAGGAGTACTGGATATTGCAGGCTTCGAGATCTTTGATTTTAACAGCTTTGAGCAGCTCTGTATTAATTTCACCAACGAGAAACTGCAGCAGTTCTTCAATCATCACATGTTCGTGCTGGAGCAGGAAGAGTACAAGAAAGAAGGAATTGAATGGGAGTTCATAGACTTTGGGATGGACTTGCAGGCCTGCATTGATCTTATAGAAAAGCCTATGGGCATCATGTCCATCCTGGAAGAAGAGTGCATGTTTCCCAAAGCCAGTGATACGACCTTCAAGGCTAAACTATATGACAATCATCTGGGCAAGTCAAACAACTTCCAAAAGCCCAGAAACATCAAGGGGAAGCCTGAGGCTCACTTTGCTCTTGTACACTATGCTGGCACCGTGGACTATAACATCTCTGGCTGGCTGGAGAAGAACAAGGATCCCCTGAATGAGACAGTTGTTGGGCTGTACCAGAAGTCCTCCCTCAAGCTCTTGGCAGTTCTGTTTGCTAACTATGCTGGTGCTGATTCAGATACTGGTGGAAAGGCAAAGGAGCAAAGAAAAAGGGTTCTTCTTTCCAGACAGTATCTGCTCTACACAGGGAGAATCTTAACAGCTAATGACAAATC
  5   1   2       bld Hrt1      in                         CAAQ5646.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATAGAAAAGCCTATGGGCATCATGTCCATCCTGGAAGAAGAGTGCATGTTTCCCAAAGCCAGTGATACGACCTTCAAGGCTAAACTATATGACAATCATCTGGGCAAGTCAAACAACTTCCAAAAGCCCAGAAACATCAAGGGGAAGCCTGAGGCTCACTTTGCTCTTGTACACTATGCTGGCACCGTGGACTATAACATCTCTGGCTGGCTGGAGAAGAACAAGGATCCCCTGAATGAGACAGTTGTTGGGCTGTACCAGAAGTCCTCCCTCAAGCTCTTGGCAGTTCTGTTTGCTAACTATGCTGGTGCTGATTCAGATACTGGTGGAAAAGGCAAAGGAGCAAAGAAAAAGGGTTCTTCTTTCCAGACAGTATCTGCTCTACACAGGGAGAATCTTAACAAGCTAATGACAAATCTGAGAACCACCCACCCACACTTTGTGCGTTGTATCATCCCCAATGAACGCAAGGCTCCAGGAGAGATGGACAATCCTCTAGTGATGCACCAGTTGCGTTGTAATGGTGTCCTGGAAGGTATTAGAATCTGCAGAAAGGGATTTCCCAACCGTATCCTGTATGGAGACTTCAGGCAGAGATACCGAATACTGAACCCTGCAGCCATCCCTGAAGGGCAGTTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGA
  5   1   2       bld Hrt1      in                         CAAQ6998.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAAGAAGAGTGCATGTTTCCCAAAGCCAGTGATACGACCTTCAAGGCTAAACTATATGACAATCATCTGGGCAAGTCAAACAACTTCCAAAAGCCCAGAAACATCAAGGGGAAGCCTGAGGCTCACTTTGCTCTTGTACACTATGCTGGCACCGTGGACTATAACATCTCTGGCTGGCTGGAGAAGAACAAGGATCCCCTGAATGAGACAGTTGTTGGGCTGTACCAGAAGTCCTCCCTCAAGCTCTTGGCAGTTCTGTTTGCTAACTATGCTGGTGCTGATTCAGATACTGGTGGAAAAGGCAAAGGAGCAAAGAAAAAGGGTTCTTCTTTCCAGACAGTATCTGCTCTACACAGGGAGAATCTTAACAAGCTAATGACAAATCTGAGAACCACCCACCCACACTTTGTGCGTTGTATCATCCCCAATGAACGCAAGGCTCCAGGAGAGATGGACAATCCTCTAGTGATGCACCAGTTGCGTTGTAATGGTGTCCTGGAAGGTATTAGAATCTGCAGAAAGGGATTTCCCAACCGTATCCTGTATGGAGACTTCAGGCAGAGATACCGAATACTGAACCCTGCAGCCATCCCTGAAGGGCAGTTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTA
  5   1   2       bld Brn3      in                         CAAK8689.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACCGTGGACTATAACATCCTTAACTGGCTGACGAAGAACAAGGATCCCCTGAATGAGACTGTTGTTGGGCTGTACCAGAAGTCCTCCCTCAAGCTCTTGGCAGTTCTGTTTGCTAACTATGCTGGTGCTGATTCAGTTGACCCAGGAACAAAGAAGGGCACAAAGAAGAAGGGTTCAACCTTCCAGACAGTGTCAGCACTGCATCGTGAAAACCTGAACAAGCTGATGACAAACCTTCGCTCCACTCATCCTCACTTTGTCCGCTGCATCATTCCAAACGAAACCAAGGCACCAGGTGTGATGGATAACCGTTTGGTGATGCACCAGCTGCGTTGTAATGGTGTCCTGGAAGGCATCAGAATCTGTAGGAAAGGATTCCCAAATCGCATTCTGTATGGAGACTTCAGGCAACGGTATCGAATTCTAAACCCTGCTGCTATTCCAGATGGGCAATTTATAGACAGTAGGAAAGGGGCAGAGAAACTCTTGGCTTCACTGGAGATTGATCATACTCAGTACAAATTTGGGCACACCAAGGTCTTCTTTAAGGCTGGTCTGTTGGGTCAGCTAGAAGAAATGAGAGATGAACGTCTTGCCAGAATCATCACACGTATCCAGGCACAGTCCAGAGGTGTCCTATCCAGAATTGAATTTAAAAAGATGGTGGAGCGCAGAGACGCCCTCCTAGTCATCCAGTGGAACGTCAGAGCTTTTATGGGAGTCAAAAATTGGCCCTGGATGAAGCTCTACTTCAAGATCAAACCCCTGCTNAAGAGTGCAGAAACAGAAAAGGAAATGCAGAACATGAAAGAGGAGTTCCAGAGACTG
  3   1   2       bld Hrt1      in                         CAAQ3242.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAACGCAAGGCTCCAGGAGAGATGGACAATCCTCTAGTGATGCACCAGTTGCGTTGTAATGGTGTCCTGGAAGGTATTAGAATCTGCAGAAAGGGATTTCCCAACCGTATCCTGTATGGAGACTTCAGGCAGAGATACCGAATACTGAACCCTGCAGCCATCCCTGAAGGGCAGTTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAAAAAAAA
  5   1   2       bld Hrt1      in                         CAAQ8478.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCGGCACGAGGGCACCAGTTGCGTTGTAATGGTGTCCTGGAAGGTATTAGAATCTGCAGAAAGGGATTTCCCAACCGTATCCTGTATGGAGACTTCAGGCAGAGATACCGAATACTGAACCCTGCAGCCATCCCTGAAGGGCAGTTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCANAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAA
  3   1   2       bld Hrt1      in                         CAAQ8478.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCAGTTGCGTTGTAATGGTGTCCTGGAAGGTATTAGAATCTGCAGAAAGGGATTTCCCAACCGTATCCTGTATGGAGACTTCAGGCAGAGATACTGAATACTGAACCCTGCAGCCATCCCTGAAGGGCAGTTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGCCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGCCAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCTCAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGCCC
  3   1   2       bld Hrt1      in                        CAAQ10054.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGANCCCTGCAGCCATCCCTGAAGGGCAGTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCCTCTCGCCCTA
  3   1   2       bld Hrt1      in                        CAAQ11399.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAAGGGCAGTTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAA
  3   1   2       bld Hrt1      in                         CAAQ4502.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTTTATAGACAGCAGAAAGGGTTCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAA
  3   1   2       bld Hrt1      in                        CAAQ12507.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAGAGAAGCTCCTGGGTTCACTTGATATTGACCATACTCAGTACAAATTTGGACATACCAAGGTATTCTTCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAA
  3   1   2       bld Hrt1      in                         CAAQ5646.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACTTGATATTGACCATACTCAGTACAAATTTTGACATACCAAGGTATTCTTCAAGGCTGGTNTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCCTCTCGCC
  3   1   2       bld Hrt1 PIPE in                         CAAQ4990.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAAGGCTGGTTTGCTGGGTTTACTAGAAGAAATGAGAGATGAGCGTCTTTCAAGGATTATTACTCGATCCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTNTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAA
  3   1   2       bld Hrt1      in                        CAAQ11969.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGTTGNCTGGGTTANCTAGAGAAAATGAGAGATGAGCGTCTTCNAAGGATTATTACTCGAATCCAGGCACAGTCCCGAGGACTGCTAATGAGAAGAGAGTTTAAGAAAATTTTGGAACGCAGAGATGCCCTACTGGTTATTCAATGGAACATCCGTGCTTTCATGGGTGTCAAAAACTGGCCATGGATGAAACTTTACTTTAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAA
  3   1   2       bld Hrt1      in                         CAAQ9535.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAACATCCGTGCTTTCATGGGTGTCAAAAACTGCCCATGGATGAAACTTTACTTNAAAATTAAACCTTTGCTGAAGACAGCGGAGACTGAAAAGGAGATGGCAAACATGAAGGAGGAGTTCCAAAGGCTGAAGGAAGCTCTAGAGAAGTCTGAGACAAGACGTAAGGAGCTAGAAGAAAAGATGGTGTCACTGCTGCAGGAGAAGAATGATCTTCAGCTGCAAGTCCAGGCTGAATCAGACAACCTGAATGATGCGGAAGAGAGGTGCGAACAGCTTATCAAAAATAAAATCCAACTGGAGGCAAAGTTAAAGGAGCAGACAGAGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCAACAAGTGGATGATTTAGAAGGATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAAAAAA
  5   1   2       bld Hrt1      in                         CAAQ8104.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAGACTAGAGGATGAGGAGGAGATGAATGCAGAACTCACAGCAAAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCAACAAGTGGATGATTTAGAAGGATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTA
  5   1   2       bld Hrt1      in                         CAAQ4142.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAAGAGAAAGCTGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCAACAAGTGGATGATTTAGAAGGATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGANACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAG
  5   1   2       bld Hrt1      in                         CAAQ7468.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGAGGATGAGTGTTCTGAGCTAAAGAAAGATATCGATGACCTTGAGCTGACTCTGGCCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCAACAAGTGGATGATTTAGAAGGATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGANACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGNCAATAGACAATTTGCAGAGG
  5   1   2       bld Hrt1                                 CAAQ8570.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAAAGTTGAAAAAGAAAAACATGCTACAGAAAATAAGGTCAAAAATCTAACTGAAGAGATGGCCGGTTTAGATGAGATTATTGCTAAACTGACTAAGGAGAAGAAAGCCCTCCAGGAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCAACAAGTGGATGATTTAGAAGGATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAGGCTAACCTTGAGAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCCAGTATGAAGAAGC
  5   1   2       bld Hrt1      in                         CAAQ1737.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGCCCACCAGCAAACACTAGATGACCTACAAGCTGAGGAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCAACAAGTGGATGATTTAGAAGGATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACA
  5   1   2       bld Hrt1      in                        CAAQ12963.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGACAAAGTCAACTCCTTAACTAAAGCCAAATCCAAACTCGAGCAACAAGTGGATGATTTAGAAGGATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACG
  5   1   2       bld Hrt1      in                         CAAQ8021.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCCCTGGAGCAAGAGAAGAAACTTAGAATGGATATGGAGAGAGCCAAGAGAAAGCTAGAAGGTGATCTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGT
  5   1   2       bld Hrt1      in                         CAAQ1974.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAAACTGACACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCANACAAACCTACTCCCAGCAGTTAGAAGACCTANAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTTGGCCCATGGACTGCAATCAGCCCCGCATGACTGTG
  5   1   2       bld Hrt1      in                        CAAQ10249.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACAAGAAAATGTTATGGATCTGGAGAACGACAAGCAGCAACTAGAAGAGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCT
  5   1   2       bld Hrt1      in                        CAAQ12455.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAGGCAAAAAAAAAAGAGTTTGAGATCAGTCAGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGA
  5   1   2       bld Hrt1      in                         CAAQ6883.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTTAACAGCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCTCAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAGAACAGAGGAGCTAGA
  5   1   2       bld Tad5                                 XZT31010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAAGCAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCA
  5   1   2       bld Hrt1      in                         CAAQ1300.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGATTGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCTAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGA
  5   1   2       bld Tad5      in                         XZT57659.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAAGATGAACAGATGATGGGTATGCAACTACAGAAAAAGATGAAAGAGCACCAGGCCCGCATTGAAGAGTTAGAAGAAGAACTAGAAGCAGAAAGAACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCCAGGGCCAATGCGGAGGTAGCTCAGT
  5   1   2       bld Hrt1      in                         CAAQ2693.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACAGCTCGAGCCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCNAAGACTGCAGGAAGCAGAGGAAGCAGTGGAAGCTGTAAATGCCAAATGCTCATCATTGGAAAAG
  3  -1   2       chi Hrt1      in                         CAAQ6998.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAAAGTGGAAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTTCCATATTGGATGCCACATCATCAAGCTCCAGTTTGAATTCACTCTTCTCTTTCTCAAGTTTCTGTTTAACCCTCTGCAAATTGTCTATTTGCTCACTCTGTTCTGCGACGGAGTCTGCATGCTTCTGT
  5   1   2       bld Hrt1      in                        CAAQ10345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGAGGGAAAACTTCGCTCTGATCTGTCTCGGGAACTAGAGGAAATCAGTGAACGGTTGGAGGAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGNCAGAAGCCAAGGCAGAGTTTGCAAGAATATTGTCCAAGGCCAATG
  5   1   2       bld Hrt1      in                         CAAQ3865.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGCTGGAGGGGCCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCANAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCNAATGCTCATCATTGGAAAAGACCAAGCATCGTTNGCAGAATGAAATC
  5   1   2       bld Hrt1      in                        CAAQ10274.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCANAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACAAGCATCGTTTGCAGAATGAAAT
  5   1   2       bld Hrt1      in                         CAAQ4905.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCAGTGCAGATGGAGTTAAACAAGAAGAGGGAGGCAGAGTTCCTGAAACTCAGAAGAGACCTTGAGGAGTCCACATTGCAATCTGAGGCTACTGCTGCTGCACTAAGGAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCANAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGNTAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAAATGAAT
  5   1   2       bld Hrt1      in                         CAAQ4201.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGAAGCATGCAGACTCTGTGGCAGAACTGAGTGAGCAAATAGACAATTTGCAGAGGGTTAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCT
  5   1   2       bld Hrt1                                 CAAQ7131.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAAACAGAAACTTGAGAAAGAGAAGAGTGAATTCAAACTGGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTC
  5   1   2       bld Tbd1      in                        CBXT11917.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAGCTTGATGATGTGGCATCCAATATGGAACAGATTGTTAAATCCAAGGCTAACCTTGAGAAGATGTGTCGCACATTAGAAGACCAGATGAATGAAAATCGTTCCAAGTATGAAGAGGCTCAGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAG
  5   1   2       bld Hrt1      in                         CAAQ3240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGGACTCTGAATGACATATCTTCCCAGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGG
  5   1   2       bld Hrt1      in                        CAAQ12831.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAGGCAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCACCAGNTGAAGTCAGAGATTGATCGCAAATT
  5   1   2       bld Hrt1      in                         CAAQ2580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAAGCTGCAAACAGAGAATGGGGAGCTGAACCGAAGACTAGATGAGAAGGAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGA
  5   1   2       bld Hrt1      in                         CAAQ2179.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGCACTAGTATCACAGATGACACGTGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAG
  5   1   2       bld Te1       in                        CBWN16975.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGCAAACAAACCTACTCCCAGCAGTTAGAAGACCTAAAGCGACAGCTGGAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGGAAGCAGCTGGAGCAAGAGAA
  5   1   2       bld Hrt1      in                         CAAQ3732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGAGGAAAGCAAGGCTAAAAATGCCTTGGCCCATGGACTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAG
  5   1   2       bld Hrt1      in                         CAAQ9307.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGCAATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCT
  5   1   2       bld Tad5                                 XZT58580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATCAGCCCGCCATGACTGTGACCTTTTGAGGGAACAGTATGAAGAAGAGCAAGAAGCCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAAAATGAAATTGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACT
  5   1   2       bld Hrt1      in                         CAAQ4273.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAGGCAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAA
  3   1   2       chi Brn3      in                         CAAK8689.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCAGAGTTACAAAGAATATTGTCCAAGGCCAATTCAGAGGTAGCTCAATGGAGGACCAAGTATGAGACAGATGCTATCCAGAGAACAGAGGAACTGGAGGAGGCCAAGAAAAAGCTAGCACAGAGGCTGCAAGAGGCAGAAGAAGCTGTTGAAGCTGTAAATGCAAAATGTTCATCACTTGAAAAAACAAAACACCGCCTACAAAATGAGATTGAGGACTTAATGGTGGATCTAGAAAGGTCAAATGCTGCAGCTGCTGCACTGGACAAAAAGCAAAGGAACTTTGACAAGATCCTTTCTGAATGGAAGCAAAAGTTTGAGGAGTCTCAGGCAGAGCTTGAATCCTCACAGAAAGAGGCCCGTTCTCTCAGCACTGAGCTTTTCAAACTAAAGAATTCTTATGAGGAATCTTTAGAGCATCTAGAGACCTTCAAGAGAGAGAACAAGAACTTGCAGGAGGAGATCTCAGACCTGACAGAGCAACTGGGAGAAAGTGGAAAGAGCATCCATGAACTGGAAAAGGTCCGCAAACAGCTGGAGCAGGAAAAAATGGAGCTACAATCGGCACTGGAGGAGGCAGAGGGCTCACTGGAACATGAGGAGGGCAAGATTCTCCGTGTACAGTTGGAGTTGCAGCAAATAAAAGCTGAATTTGAACGGAAATTGTCTGAAAAAGATGAGGAGTTTGATCAAGCCAAAAGAAATAACCAGCGAGCTGTGGATACCCTTCAGGCATCACTAGAAGCTGAAACTAGAAGTCGCAATGAGGCCCTTAGAGTT
  5   1   2       bld Tad5                                 XZT35288.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAGTTGCAAAGAATATTGTCCAAGGCCAATGCGGAGGTAGCTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAAAATGAAATTGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATG
  5   1   2       bld Hrt1      in                         CAAQ8796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAGTGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACCAAAACCTA
  5   1   2       bld Hrt1      in                        CAAQ10573.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGAGGACCAAGTATGAGACTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCT
  5   1   2       bld Hrt1      in                         CAAQ3185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGACGCCATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTG
  5   1   2       bld Hrt1      in                         CAAQ8859.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCCAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCT
  5   1   2       bld Hrt1      in                         CAAQ8082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAGAACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCCCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGC
  5   1   2       bld Hrt1      in                         CAAQ7936.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGACAGAGGAGCTAGAAGAGGCCAAAAAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAAGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAA
  5   1   2       bld Hrt1      in                         CAAQ4797.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGAGGGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCCATGATGATCT
  5   1   2       bld Hrt1      in                         CAAQ2723.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGAAGTTGGCTCAAAGACTGCAGGAAGCAGAGGAAGCAGTGGAGGCTGTAAATGCCAAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTC
  5   1   2       bld Hrt1      in                        CAAQ11272.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATCGATTCGCAATGCTCATCATTGGAAAAGACCAAGCATCGTTTGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTNCAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCANACTTGCTG
  5   1   2       bld Tad5      in                         XZT57826.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGCATTCGTTTGCAAAATGAAATTGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTNCAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTTGAACCAGTGAA
  5   1   2       bld Hrt1                                 CAAQ9750.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCAGAATGAAATCGAAGATCTAATGGTGGACCTAGAGAGGTCAAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAA
  5   1   2       bld Hrt1      in                        CAAQ12945.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGGTCAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACT
  5   1   2       bld Hrt1      in                         CAAQ4645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATGCTGCTGCTGCTGCTCTAGACAAGAAACAGAGGAATTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGNCAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCC
  5   1   2       bld Hrt1      in                        CAAQ10447.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAAACACAGTCTTTATAATCAAAAGAAGAAGACAGAGTCCGATTTGGCTCAGCTGCAGGC
  3   1   2       bld Hrt1      in                         CAAQ3732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTGGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATC
  5   1   2       bld Hrt1      in                         CAAQ2738.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCANACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCCAGC
  5   1   2       bld Hrt1      in                         CAAQ6957.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAGGTTCTCGCTGAATGGAAGCAAAAGTTTGAAGAGTCACAAACAGAGCTGGAATCCTCACAGAAAGACGCTCGCTCCCTGAGCACCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTNGAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACANCAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAG
  5   1   2       bld Tad5                                 XZT20996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGAGCTCTTCAAGCTAAAGAATGCCTATGAGGAGTCTCTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGC
  5   1   2       bld Hrt1      in                        CAAQ10768.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTTGAACCCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGA
  5   1   2       bld Hrt1      in                         CAAQ5387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGAACACCTGGAGACATTTAAGAGGGAAAACAAAAACCTACAAGAGGAGATATCAGACCTCACAGAGCAGCTAGGAGAGGGGGGCAAGAGTATCCATGAGCTAGAGAAGATTCGCAAGCAGCTGGAGCAAGAGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCANAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAG
  3   1   2       bld Hrt1      in                         CAAQ2870.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAAA
  5   1   2       bld Hrt1      in                         CAAQ2870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAAA
  5   1   2       bld Hrt1      in                          CAAQ439.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAAAATGGAGTTACAGACTGCACTGGAAGAAGCTGAGGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCCATG
  5   1   2       bld Tad5      in                         XZT17626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCTTCTCTAGAGCATGAAGAGGGTAAGATTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCANAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTG
  3   1   2       bld Hrt1      in                         CAAQ4273.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAGCATGAGAGGGTAAGATTTCTACGTGCCCAGCTTGAGTTCAACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATTAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAAAAAAA
  5   1   2       bld Hrt1      in                         CAAQ4808.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAGATTCTACGTGCCCAGCTTGAGTTCACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATTAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAACGAGCA
  5   1   2       bld Hrt1      in                         CAAQ4981.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGGCACGAGGCTTGAGTTCACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAAT
  5   1   2       bld Hrt1      in                         CAAQ1970.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCAGCTTGAGTTCACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGGAAAACGAGCAGAAGCGAAATGCTGAGTCTAT
  3  -1   2       chi Hrt1      in                         CAAQ1963.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCACCAGTTGAAGTCAGAGATTGATCGCAAATTAGCAGAGAAAGATGAGGAGATGGAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGGTCAGAAGTGATCTTATTTCCTTACTGTTTTTCAGCTTTATTCTTCCTTGTTTGTATTTTTTTTAATAACAACATTAATTCTCATTTTTATTTTTACATTTTAAGATGATTTTTGTTAATGTCATTTATCTTCCCGCTATATAATTGTTCATTATATGGGTTAATGATTTTCTATAAATAAGTCATCATTTATTTATATATATATATATGTATGTATATATATATATATATACCAAATCAAACACAACCAGCACCAAGGGTCTTGTGGTTCAAACAAATATTAGTGTATTATAATTGCATGTACAACCGACGTTTCGGTCCCTTTTGGGACCTTTTTTCAGGTACAATTACATACAACTGTGTTTAAATAGCCTCCTCCCATGAATCCAGGGAGTACCAGTGACATCATATGCACATAAACCCCTAGTGACCATTATATATAAGCGA
  5   1   2       bld Hrt1      in                         CAAQ2192.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCAAGTAAAGAGAAATAATCAGCGCTTGGTGGATGCACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGT
  5   1   2       bld Te5                                  CAAO5254.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCGAGCTGTGGATACCCTTCAGGCATCACTAGAAGCTGAAACTAGAAGTCGCAATGAGGCCCTTAGAGTTAAAAAGAAGATGGAGGGGGATCTAAATGAGATGGAAATCCATCTCAGCCAAGCTAACCGTATAGCAAGTGAAGCACAGAAGCAACTTAAAAACCTGCAAGGAGTCCTAAAGGACACGCAGCTTCAGCTGGATGATACTTTGAGAATCAATGAGGATTTGAAAGAGAACACTGCAATTGTGGAGAGAAGGAACACATTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATCGAGACCAACGAGAGAGTGCAGCTCCTTCACTCCCAGAACACCAGTCTGATTAATCAGAAGAAGAAGATGGAGAATGACTTGTCCCAGCTTCAAGGTGAAGTGGAGGAAGCAGTGCAAGAATGTCGCAACGCAGAGGAGAAGGCCAAGAAAGCCATCACTGATGCTGCAATGATGGCTGAAGAATTAAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAGATTGCAATGAAAGGTGGCAAGAAACAGCTACAGAAGCTGGAGGCTCGAGTCCGAGAACTAGACAATGAATTGGAAGCTGAACAGAAGCGAAATGCTGAGTCCGTCAAGGGCATGAGAAAGTATGAGAGGCGCATTAAGGAGCTCACCTATCAGACTGAGGGAGACAGAAAGAACCTGATTCGTCTT
  5   1   2       bld Hrt1      in                         CAAQ4887.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACTTCAAACCCAGTTAGAGGCTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGA
  5   1   2       chi Tad0                               IMAGE:6984169                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAAACAGGGGCTGGGTACCGCGTCCGGGATTCCCGGGGATAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCATACATTGGAACGTACTTAATAATATGAATGATTAGGATGAGAATGAGAAGATCGAACATGTGAGCCGGTCTCACAAACAAGTCTATAGGCACCTTGTGGTTATATGGCAAGTTCGGAGAATTGACTCATGACCGCATCACCTGATACCACAATGTAAACATCTTTTTTATCTCGTTCATGATGGTATAGCATCATGATGATTGCAGATAGAAATCTCTGCTTTCGGTACAATTCACGTTTGCCTACTGGTAATGAAGGAACGTTGCCCTCATTAAAGCCTTCGTATTACGTATGTCTGCTCTTCTCCCTAAAAGTCCCCTCAACGCAGGAACTGTTGTGAATGGCCGAATTATCGCCACAACGCTCCGTTGTCTGGTTTTCTCCTAATATACAAGGATCACCAACTTCTCTTACCTAGAATACATGACTAAGAACTAAATTTTTCTTTATCCAAATAAGTGATCATACACACCAGCACTGGAGCTAGTCTC
  5   1   2       bld Hrt1      in                        CAAQ12557.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACNAGACCTTGTGGACAAGCTGCAGCTCNAAGTAAAGGCTTACAAGCGACAGGC
  5   1   2       bld Hrt1      in                         CAAQ3629.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCGGCACGAGGGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATTAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGTACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCANAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCT
  5   1   2       bld Hrt1      in                         CAAQ7629.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGAGATCAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATTAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGTACGCCTACAAGACCTTGTGGACAAGCTGCAGCTC
  5   1   2       bld Hrt1      in                         CAAQ8283.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGAGTCGTAATGAGGCCCTAAGAGTTAAAAAGAAGATGGAAGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCT
  5   1   2       bld Hrt1      in                         CAAQ8176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCACGAGGGGTGATCTCAATGAGATGGAGATCCAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCANAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTTCAACCTCTCCAAGTNCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGC
  5   1   2       bld Hrt1      in                         CAAQ7391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCTAAGCCAGGCCAACCGCTCAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATTAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGTACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCANAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCCAGTTCCGTAAAGTTCAGCATGAATTGGATGAGGCTGAAGAAAGAGC
  3   1   2       bld Hrt1      in                        CAAQ10447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCTTCTGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATGTGGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAG
  5   1   2       bld Hrt1      in                         CAAQ7745.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAGGCTCACAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGC
  5   1   2       bld Hrt1      in                        CAAQ10825.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCANAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTANAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCANGTCAACAGTTGAGAGCCAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGA
  5   1   2       bld Hrt1      in                         CAAQ5049.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAACATCTGAAGGCAGCACACGGAAGTCTTAAGGACACTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCANAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGNTAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGT
  5   1   2       bld Hrt1      in                          CAAQ742.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACTTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCANAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCANACCTCTCCAAGTTCCGTANAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCCAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGA
  5   1   2       bld Hrt1      in                          CAAQ767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAGATGCAGCTTGATGATACTATGAGAGCCAATGATGATCTCAAAGAAAACACTGCAATTGTGGAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCANAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAAATCCATTCANACCTCTCCAAGTTCCGTANNAGTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGA
  3   1   2       bld Hrt1      in                        CAAQ10825.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAA
  3   1   2       bld Hrt1      in                         CAAQ9307.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAAGGACATGTTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAA
  3   1   2       bld Hrt1      in                        CAAQ12831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGAGGGAACATGTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCNCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ2179.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGAAGGAACATGTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAAACCTCTCG
  3   1   2       bld Hrt1      in                          CAAQ767.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGAAGGAACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACGAAAAAAAAAC
  3   1   2      seed Hrt1      in                         CAAQ8283.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACATGTTGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAA
  5   1   2       bld Hrt1      in                         CAAQ8275.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCTTCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAAT
  3   1   2       bld Hrt1      in                        CAAQ12963.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAAGCTGAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTACCTCTCGCCCT
  3   1   2       bld Hrt1      in                        CAAQ10573.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAAGCTGAGCTGGAGGAGCTGCGCTCTATATGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTAAAAAAAGCCTCTCGCCCTAT
  3   1   2       bld Hrt1      in                        CAAQ12945.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAAGCTGAGCTGGAGGAGCTGCGCTCTATATGGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAAAAAAA
  3  -1   0       chi Hrt1      in                         CAAQ7958.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTCCTATAGGGCGAGAGGAAAACCAGTCTTCCTATATTTTTATTCTTTTTGCTATTAACATTGATATCAAGCACAATTTTTATCATACAGGCCAGTAAAATACAGAGCAGGTGGCAATCTTATATATGCCAAATGTTGCCATGTCTATAAATATTGTCAGATAATAAATCTGCTACTTGCATCAAGCATTCAAGCTGCAGTCATAATTCAAATGCTGAGAAGGCAAAACATATATATATATATATACAATATATATGCACATATTGTCTTATCAGATTTACAGCTATGTGAGAATCATAAATATCAGGCTTCTTGCTGTAACAGATATAGATAACACAGTGAAATATCTACCTCTTACTCCCATTCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGTGAGTGCATTTATGAGCTACAAATTGAATCTGATTTTTCTTCTTTCTTCTATTCTTCTTTTTCATTGTTCTGTTTCTTCTTTCTAGAACTATTTTGGGAACTATTCTAAAACTATTCAACCTTTGTCTTTTTGCATGTATAGGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGGTGAGTATAGAGGGTTGGAGAGCTGCATTTCAATANATATTGTCTTTAAAGCACCAAAACATATGTCTCTTAATTTCAAGAATTACTATTATAAAACAAAATAATAATGGACATGGCTGAAACTTGATCATTGCAATCATGTTTTCTT
  3   1   2       bld Hrt1      in                         CAAQ3185.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAGCTGGAGGAGCTGCGCTCTATATGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAA
  3   1   2       bld Hrt1      in                         CAAQ2693.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTG
  3   1   2       bld Hrt1      in                         CAAQ8859.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGCTGGAGGAGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTG
  3   1   2       bld Hrt1      in                         CAAQ3629.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCTGGAGGAGCTGCGCTCTATATTGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATTAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGTACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAATTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGAGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAA
  3   1   2       bld Hrt1      in                         CAAQ1974.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGGAGGAGCTGCGCTCTATATTGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAA
  3   1   2       bld Hrt1      in                         CAAQ4142.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCTGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAA
  3   1   2       bld Hrt1      in                         CAAQ8104.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAA
  3   1   2       bld Hrt1      in                        CAAQ10274.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGCTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAAAGCCTCTCGC
  3   1   2       bld Hrt1      in                         CAAQ1300.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGCTCTATATGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ8275.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGCTCTATATTGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTAAAAAA
  5   1   2       bld Hrt1      in                         CAAQ2617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTATATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAATGTGACCATAAA
  3   1   2       bld Hrt1      in                         CAAQ2617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTATATTGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAA
  3   1   2       bld Hrt1      in                         CAAQ4645.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATATGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ8796.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGGAACAGACAGAGAGATCACGCAAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ4981.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ8176.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTGGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ7468.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTG
  3   1   2       bld Hrt1      in                         CAAQ7629.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATTATNCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGTACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAATTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGAGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTG
  3   1   2       bld Hrt1      in                         CAAQ8021.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACT
  3   1   2       bld Hrt1      in                        CAAQ10768.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTG
  3   1   2       bld Hrt1      in                         CAAQ2723.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTG
  3   1   2       bld Hrt1      in                         CAAQ7391.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATTAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGTACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAATTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGAGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAATTAAAAAAAAAAG
  3   1   2       bld Hrt1      in                        CAAQ11272.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTG
  3   1   2       bld Hrt1      in                         CAAQ2580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTG
  3   1   2       bld Hrt1      in                         CAAQ5387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAAAGCCTCTCGCCCTATA
  3   1   2       bld Hrt1      in                          CAAQ439.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGAGAGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACG
  5   1   2       bld Hrt1      out                        CAAQ2704.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGATCACGCAAACTTGCTGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCCCTCGTGC
  3   1   2       bld Hrt1      in                         CAAQ4201.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAGCAAGAGCTGATTGAAACCAGTGAAAGAGTTCAACTCCTTCACTCCCAGAACACAAGTCTTATAAATCAAAAGAAGAAGACAGAGTCAGATTTGGCTCAGCTGCAGGCAGAAGTGGAAGAAGCTGTTCAGGAATGTCGTAATGCAGAGGAGAAGGCCAAGAAGGCAATCACTGATGCTGCAATGATGGCCGAAGAGTTGAAGAAGGAGCAGGACACAAGTGCCCACCTGGAAAGGATGAAGAAGAACATGGAGCAGACCATCAAAGACCTCCAGCAGCGGCTTGATGAAGCTGAGCAAATTGCCATGAAAGGTGGGAAGAAACAACTGCAGAAGCTGGAGAGTCGAGTCCGAGAACTGGACAGTGAATTGGAAAACGAGCAGAAGCGAAATGCTGAGTCTATTAAGAACATGAGAAAGTATGAGAGGCGCATTAAGGAGTTAACCTACCAGACTGAGGAAGACAAGAAGAATATGGCACGCCTACAAGACCTTGTGGACAAGCTGCAGCTCAAAGTAAAGGCTTACAAGCGACAGGCAGAAGAAGCTGAAGAACAATCCAATTCAAACCTCTCCAAGTTCCGTAAAGTTCAGCATGAACTGGATGAGGCTGAAGAAAGAGCAGATATTGCTGAGTCGCAGGTCAACAAGTTGAGAGCCAAAAGCAGGGATGTGGGTGGCAAGCAGAAACTCCATGAGGAAGAGTAGAAATCATGGACCCACAGAAGCACCAAGTGGATCCCTAAATTGTATATACCCTGTTAACCAGCATTTAATAAAATGTGACCATAAAGTTCAGCACTGAAAA
  3   1   2       bld Hrt1      in                         CAAQ1737.3p