Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 225.0    0Xt7.1-CABG7753.3.5                         63 PI      79       5400     5667                plasmalemma vesicle associated protein [Mus musculus]
     2 183.0    0Xt7.1-CBXT7997.3.5                         52 PI      84       5779     5961                Hypothetical protein MGC145644 [Xenopus tropicalis]
     3 202.0    0Xt7.1-XZT30555.3.5                         43 PI      80       5401     5661                (no blast hit)
     4 275.0    0Xt7.1-CAAJ11827.3                          21 PI      85       5401     5667                (no blast hit)
     5 193.0    0Xt7.1-CABD387.3                             7 PI      85       5783     5960                (no blast hit)
     6 217.0    0Xt7.1-CABD2184.3                            7 PI      80       5397     5641                (no blast hit)
     7 240.0    0Xt7.1-CAAL19857.3                           5 PI      83       5401     5664                (no blast hit)
     8 200.0    0Xt7.1-CAAK9545.5                            5 PI      83       5401     5616                (no blast hit)
     9 227.0    0Xt7.1-CABA3749.3                            4 PI      79       5400     5667                (no blast hit)
    10 183.0    0Xt7.1-CABJ4079.5                            2 PI      83       5784     5970                (no blast hit)
    11 181.0    0Xt7.1-CABA4725.3                            2 PI      76       5401     5667                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012153322 Xt7.1-CAAK6403.3.5 - 161 ESTs
                                                                       .......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470......5480......5490......5500......5510......5520......5530......5540......5550......5560......5570......5580......5590......5600......5610......5620......5630......5640......5650......5660......5670......5680......5690......5700......5710......5720......5730......5740......5750......5760......5770......5780......5790......5800......5810......5820......5830......5840......5850......5860......5870......5880......5890......5900......5910......5920......5930......5940......5950......5960......5970......5980......5990......6000......6010......6020......6030......6040......6050......6060......6070......6080......6090......6100......6110......6120......6130......6140......6150......6160......6170......6180......6190......6200......6210......6220......6230......6240......6250......6260......6270......6280......6290......6300......6310......6320......6330......6340......6350......6360......6370......6380......6390......6400......6410......6420......6430......6440......6450......6460......6470......6480......6490......6500......6510......6520......6530......6540......6550......6560......6570......6580......6590......6600......6610......6620......6630......6640......6650......6660......6670......6680......6690......6700......6710......6720......6730......6740......6750......6760......6770......6780......6790......6800......6810......6820......6830......6840......6850......6860......6870......6880......6890......6900......6910......6920......6930......6940......6950......6960......6970......6980......6990......7000......7010......7020......7030......7040......7050......7060......7070......7080......7090......7100......7110......7120......7130......7140......7150......7160......7170......7180......7190......7200......7210......7220......7230......7240......7250......7260......7270......7280......7290......7300......7310......7320......7330......7340......7350......7360......7370......7380......7390......7400......7410......7420......7430......7440......7450......7460......7470......7480......7490......7500......7510......7520......7530......7540......7550......7560......7570......7580......7590......7600......7610......7620......7630......7640......7650.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAK6403.3.5                                                                              GCTTCTCCCTCCCCCTCCCTGTAGCACTCTGCCCCCTCCCTTCACTCCTCCCTCTCGGTATCAGCACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGCATTTTTGCTCCTGTGTCCAAAATCAGCAAAGCCCCTGATCAGCCACCATCCTCAGTCACCTCCACTCCAAGGACTCCCCGTGTGGACTTCTCCCGAGTCACTGGGAAGGGGAGGAAGGAAAAGAAAGCCACACACAAAAAATCGTTGAGTGTGGGGAGCCTGGACAAAGAGGGCCTAAAGATTGACATTGGGGACCAAGTTCTCGTGGCTGGCCAGAAACAGGGATTTGTGAGATTTTATGGAAAAACTGATTTTGCCCCAGGGTACTGGTTTGGCATTGAACTGGAGAAACCAACTGGAAAACACGATGGCTCAGTTTTTGGTGTTCGATATTTTACTTGCTCCCCAAAACATGGAGTATTTGCACCCCCATCCCGGGTACAAAGGACGGGTGGACCCAAGGACCCCCAGACAGACAACAATGGTATGAAGAAGGTGCATCAAGTTACTATGACACAGCCAAAGCGTAACTTCACAACAGTGCGGACTCCAAAAGAAATTGCTTCAGAAAACTCCATCTCCAGGTTACTATTCTGTTGCTGGTTTCCGTGGCTCCTCCGTGCTGAGATGCAGTCTTAGAAACCTGTGTTCCTTTGCCACCTGTGTGTTGGGTCACACAATGATGCGCCCTTCTTTCTATGTATGCTGTCCTCTGGACCCTCCCCAGTGCCTTCTCCACATCCTCCTGCCTGTCACCTCTGATTTCTGCACCCACTGGAAGAAGGTGACAGGGGAGACTATCAACCTGCGCAAGATTATGCCAGAAGGTGTGTGAGTGGATCTGAGCTCTCTCTGTTCCCAACACCAGTCATTCCACAGAACATTCCAGACTGGCTCAATAAATTGCCCTACCCCCAATGCCAAATTACTGAAGCTTCTCTCACTCAAAGTGAACCCTCCCTCTTTACCATAAGGTAAAACAAAAATTGAGAATAATTGAAAGCTCCCAATAGATTCCCTGTTGTTGGGCAAAGAAAAAATTCTTGACATTGCATGTAGAGTTTTAGATTTTCTGTGCCCTGCAGTGTGGGATAGGTTTCCCTATTGGTAAGCAGTGATTATCTAGTATTAACATTTTACAGTTTAGAAACATCTTCCTCTGTATGGAGCAGTCTCATTTGCAGATGAAGGACAGTTTATTATTAGCGATCAATTCCAGCACTTTCTTTTATAGGGCAACACTCTTAATTTGGTTTACATCCCACCAAATAAAAGATGAATGGATTTATCTAAAGGGACATTTTCTGCCAAAATTAGCATTGCTGTAAGTTCTGGTGGGGTGTTTATCACTTGTGATTCCAGAATACTATACCATTTTGCTAGTTAAAAGAGATGTTTTTATGTGTATTTTTTTTATTTGCTAACAGTGTCCATTTTATTTTATGCATTAGATGTTTTGCCTGAAAGATGAGGTTATTTGGGTAGAGGTAAAGAACATCGGTCTATATAAAATTCAGCAAATTTGCATTAAGGCCAACAAGACCTGGATAAAAAGAAGTAGGGTGGGCACATAATCATGGCTGCATCCAAAATACAAAAATGTTTAGCCCCTGGAGTTTGGGGCCTCACGATGGAGAAATCCCACAGTTGATTCTACCTTCATAAACTAAGCTAAGCTTGCTTGCGTGAGGTTTTCTTTTTATTATTTGGGAAATCACCCAAAATGAGATCTAGTTGCTGTCTCCTGAGGAAGGCATACAATCATCATTAGGATGGCTCATTTGTTTCAGATGGATCTTATGTAACAAATGAGCATGGCCTTTCTAATTGCTGCATCTGTCCTGCATGAATTATAAAACAACAGCAGATTTAACTTACCAGATATGCATAAAGGCATTCCTACTAATTATTAATTATGCTAAGACTGTACCCAAGGGTGAAAGTAAACTTATTTACAAATGGGAACTGAACATACGGCATTAGATATACAGGCCATTTAGAATATCGTAGCGAGTTATCTTGTAATGCTCTCGAGATGAGCACGTATTCATAGCGACAGATAATGACAAATATCTGTCATTAAAGCAACTACATTTCCAAAAATAAGTTCTTGTCCAACCCACTTTACCAAAAGTTGGAGCTTTTGTGCTACACACACAGTACAAAATATTAATCCACCTGCAAGTCCTATAAGATGTTATAAGCTACAGGGATCCATCACACTGGCTGTAGGAGAGATGAAAAGGACATTTTTTATCCACTTGCAGTATCTTATATGGACTAACATATGCAGCTTCCTCAGAGAAAGCTTGAATGAATAGAAGAGCTGATAGGTTTTACACGTGTATTGGACAGGATCTGTAGGAGCGCTGTTCTAATGAGCTCTACTGTATCTATTTTAATGCCCCTGTAATTATTTGCGATGAGGGCTACGCCACCTCGCGTAGCTTGTTATTTACAGTAAAGGTTCCCTATAAATGTGCTGAAAAATGGGCATGATTTAAAAAGTTGATGGAAAATGTATATTTGTTCCATTATCTTTTTAGCCCTAGAATGATGGTCCACTGTTAAAAAAAATCATAGCATGAAAATAATATTTAAATATGTGTTAATTAATCTACCCACATTTCCATTCTGACCGTCATCTTACATTATAGGCTGAAGGATTGTGACATTAAGAATATATATGTAAATCTGGTAATTTAGGATTTAGCAGATTAATCCCTTCCTGCAATCTTGCCTGTAGAAAGCCCAGTTCTTAATGCACCCTGGTCTTCCTGTTAAATGCATGATGGTCTGTTTCATTTTCCGTGCAGTATCATCAAGATCATTTTTCCGAAAGAGATATCAGTTGTAATTACTACTGAATACCTTTTATTTCTTGTGGATCAACGAACCATAAAACCCTTGTTGCTGTTGGTTGCTTCCTTTATACGCACATGGAAAGCATATAATTGCTAACTCCTGCATGCTACACATTTGCAATTCCATATTGTCATACCCATAATATGCCATTTCCTGCCCATTAGCATCAGCATGAATGCTTTGATGGTAACCTGCTCTCAGAATCCAACTAGGACCGAGAACATTCACTCTAGAGCATGCAGGAGCCAGCAATAATAAGTCAATACCACATCTATAGCAATTTTATATCATTCACATTAAATTTATGTGGCTGCTCTGTTGGGAGATTTCACCTTTCCCATTAGGACATTTTCACTGGTGGGTAGGTGGTCCAATGTATTGTGTTCTTATGTGAGAATATACAGATGTAAAAGACCTTATTTGTCTCCCTGGCCACTGCATGCATCGCCCTACTCTGTACATAGCATGGGGTATTCATGTACTGTGAGTAATAAGTATCTGTATATTTTGCAAAGGTGCCAGGCTTCCTCCCCAGCAGGGGTTTATCTACGGATTCATAGTGCAGCCAGTGGCAGGTATAAAGGACTGTAAACTTAGTGCATTTCCACAGCGAGCGGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAACCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATGAGAAAAGTAAAAATTTTGCACATGAGCACAGCCCAGGGCAGCAGCAAGAAAGATGGTGGTGCTGCGCTCATTATAAAAGAATCCCGAACCAGTGCTTTTTTTCAGCAAAGAGGAGTGCAGGCCCAGAGCCTGAGGTAAGCAATTATAATAGCTGGGGGAAGGGTGCCTAAGAAATTGCCACCCCACAGTGATGCTTTCATTCTACTTTAACAGATTAATTGTGCTGGATAAAAACTTAATGGCAATATTGTACATTTTACCAAACAGTTACTATTTATGGTCAAGGTGCCATAACCCATAGCAACCAATAAGATGTCTGCTTTTAAATGGGTGACCAGTAAATGCTACCCGCTAACCAGGGTCAGACTGGGCCGCCGAGACACCGAGAAAAATCCCGGTGGGCCCCAGCAGCCCAGACCCGACCCTTGCCGGTGCTCCCCCTGTCCGACTGTTCCACCCCTGACGCGTTAAATTTATGCAGACTCGGGGAGGACGTTGGTGGGGGACCCTGCGGGGGGTTAGGGAGGCCCCTGGGGGGTGTTATGGGACATGGCCGGCGGGGGCACCTGCAGTGCCCCTGGGGCGGGAGACCTGGTGGGCCCTGCACCCCCCAGTCCGACCCTATTGCTAACTGGTTACTATAGGTGATAAGAACTGTAGGAAACTTTGCTCCTTAAATTGCATAACCTGCCGCCCACCCCTGTTCTTCCTAACTCTACTTGTTTGATTCAATACTTCGGGGCATATTCATTACAGTGTTTAAGCCAACATCACCAATGATGTTGCCCATAGCAACCAATGAGCAATTAGAATTTAATGGTCACCTACAAGGTAGAAAACAAAAGCAAAGATCTGTTTGGTTGCTAAGGGCAACATCACCGGTAATTTTGGCTTACACGCTATAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGTGCTGTGTATTTCCCCACTAGGCACAGGACAACACTATCTGCAATATGCAATAAACTGTTTAAACAGACAGCAAATGTAGCCAAATATACGGCACAAAAAGCTTATCCTTAAGCTTCCTTTGACCAGTAATATACAGACAAGTATGGAGAAATTTATATATAAATGCATTTAACGGTGTATGATCCAACAGATGGGTATAAAATATTACTGCCTATTGAGGTACATTTTTATTTTCTTATTTGCAACCCCCTCTCCAGCTATACCAGAAGCAAATATTTCATACTAAATTATTTGGTACTTGATACTGGGAATCAAGCTGTTGCCCAATAAATATTTCAGCCCAACAAACAATTGTATATGAGAACTGCAATAATCCAATAGTTTCGCTGGTTTTACTTCTAACATAAGAATTTAATTTAAATTTAAGAAACAACGATCCATGTACACTATAAATTCTAATTTTTAAAATTAGACTTGTACTTCTAAACAAACTGGAGCATTGGACATAAAATACCTTTTTGCTTGGAAGAGAATCAGATCTGTGTTGTTGTAAAACTACAACTCACATCCCCAGCATTCAACAGCTAGGAAGAGTAGCTCAACAGCAGTTGGCAGGCCACCGCTTGGATATATATCTAATGCAGGGCTGTCAACCAACCTCATGTCATGAGGAAGATAATGATCCAGTCCTGTTTTCTTCTTCTCCACACTAAATTATAATATGAAATAAGGTCTCAAATGCCTGGAATGAATCAGCTCTGCTCATGAATATTTAGAATATCTAGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTGAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008265285                                                                                    CCCTCCCCCTCCCTGTAGCACTCTGCCCCCTCCCTTCACTCCTCCCTCTCGGTATCAGCACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGCATTTTTGCTCCTGTGTCCAAAATCAGCAAAGCCCCTGATCAGCCACCATCCTCAGTCACCTCCACTCCAAGGACTCCCCGTGTGGACTTCTCCCGAGTCACTGGGAAGGGGAGGAAGGAAAAGAAAGCCACACACAAAAAATCGTTGAGTGTGGGGAGCCTGGACAAAGAGGGCCTAAAGATTGACATTGGGGACCAAGTTCTCGTGGCTGGCCAGAAACAGGGATTTGTGAGATTTTATGGAAAAACTGATTTTGCCCCAGGGTACTGGTTTGGCATTGAACTGGAGAAACCAACTGGAAAACACGATGGCTCAGTTTTTGGTGTTCGATATTTTACTTGCTCCCCAAAACATGGAGTATTTGCACCCCCATCCCGGGTACAAAGGACGGGTGGACCCAAGGACCCCCAGACAGACAACAATGGTATGAAGAAGGTGCATCAAGTTACTATGACACAGCCAAAGCGTAACTTCACAACAGTGCGGACTCCAAAAGAAATTGCTTCAGAAAACTCCATCTCCAGGTTACTATTCTGTTGCTGGTTTCCGTGGCTCCTCCGTGCTGAGATGCAGTCTTAGAAACCTGTGTTCCTTTGCCACCTGTGTGTTGGGTCACACAATGATGCGCCCTTCTTTCTATGTATGCTGTCCTCTGGACCCTCCCCAGTGCCTTCTCCACATCCTCCTGCCTGTCACCTCTGATTTCTGCACCCACTGGAAGAAGGTGACAGGGGAGACTATCAACCTGCGCAAGATTATGCCAGAAGGTGTGTGAGTGGATCTGAGCTCTCTCTGTTCCCAACACCAGTCATTCCACAGAACATTCCAGACTGGCTCAATAAATTGCCCTACCCCCAATGCCAAATTACTGAAGCTTCTCTCACTCAAAGTGAACCCTCCCTCTTTACCATAAGGTAAAACAAAAATTGAGAATAATTGAAAGCTCCCAATAGATTCCCTGTTGTTGGGCAAAGAAAAAATTCTTGACATTGCATGTAGAGTTTTAGATTTTCTGTGCCCTGCAGTGTGGGATAGGTTTCCCTATTGGTAAGCAGTGATTATCTAGTATTAACATTTTACAGTTTAGAAACATCTTCCTCTGTATGGAGCAGTCTCATTTGCAGATGAAGGACAGTTTATTATTAGCGATCAATTCCAGCACTTTCTTTTATAGGGCAACACTCTTAATTTGGTTTACATCCCACCAAATAAAAGATGAATGGATTTATCTAAAGGGACATTTTCTGCCAAAATTAGCATTGCTGTAAGTTCTGGTGGGGTGTTTATCACTTGTGATTCCAGAATACTATACCATTTTGCTAGTTAAAAGAGATGTTTTTATGTGTATTTTTTTTATTTGCTAACAGTGTCCATTTTATTTTATGCATTAGATGTTTTGCCTGAAAGATGAGGTTATTTGGGTAGAGGTAAAGAACATCGGTCTATATAAAATTCAGCAAATTTGCATTAAGGCCAACAAGACCTGGATAAAAAGAAGTAGGGTGGGCACATAATCATGGCTGCATCCAAAATACAAAAATGTTTAGCCCCTGGAGTTTGGGGCCTCACGATGGAGAAATCCCACAGTTGATTCTACCTTCATAAACTAAGCTAAGCTTGCTTGCGTGAGGTTTTCTTTTTATTATTTGGGAAATCACCCAAAATGAGATCTAGTTGCTGTCTCCTGAGGAAGGCATACAATCATCATTAGGATGGCTCATTTGTTTCAGATGGATCTTATGTAACAAATGAGCATGGCCTTTCTAATTGCTGCATCTGTCCTGCATGAATTATAAAACAACAGCAGATTTAACTTACCAGATATGCATAAAGGCATTCCTACTAATTATTAATTATGCTAAGACTGTACCCAAGGGTGAAAGTAAACTTATTTACAAATGGGAACTGAACATACGGCATTAGATATACAGGCCATTTAGAATATCGTAGCGAGTTATCTTGTAATGCTCTCGAGATGAGCACGTATTCATAGCGACAGATAATGACAAATATCTGTCATTAAAGCAACTACATTTCCAAAAATAAGTTCTTGTCCAACCCACTTTACCAAAAGTTGGAGCTTTTGTGCTACACACACAGTACAAAATATTAATCCACCTGCAAGTCCTATAAGATGTTATAAGCTACAGGGATCCATCACACTGGCTGTAGGAGAGATGAAAAGGACATTTTTTATCCACTTGCAGTATCTTATATGGACTAACATATGCAGCTTCCTCAGAGAAAGCTTGAATGAATAGAAGAGCTGATAGGTTTTACACGTGTATTGGACAGGATCTGTAGGAGCGCTGTTCTAATGAGCTCTACTGTATCTATTTTAATGCCCCTGTAATTATTTGCGATGAGGGCTACGCCACCTCGCGTAGCTTGTTATTTACAGTAAAGGTTCCCTATAAATGTGCTGAAAAATGGGCATGATTTAAAAAGTTGATGGAAAATGTATATTTGTTCCATTATCTTTTTAGCCCTAGAATGATGGTCCACTGTTAAAAAAAATCATAGCATGAAAATAATATTTAAATATGTGTTAATTAATCTACCCACATTTCCATTCTGACCGTCATCTTACATTATAGGCTGAAGGATTGTGACATTAAGAATATATATGTAAATCTGGTAATTTAGGATTTAGCAGATTAATCCCTTCCTGCAATCTTGCCTGTAGAAAGCCCAGTTCTTAATGCACCCTGGTCTTCCTGTTAAATGCATGATGGTCTGTTTCATTTTCCGTGCAGTATCATCAAGATCATTTTTCCGAAAGAGATATCAGTTGTAATTACTACTGAATACCTTTTATTTCTTGTGGATCAACGAACCATAAAACCCTTGTTGCTGTTGGTTGCTTCCTTTATACGCACATGGAAAGCATATAATTGCTAACTCCTGCATGCTACACATTTGCAATTCCATATTGTCATACCCATAATATGCCATTTCCTGCCCATTAGCATCAGCATGAATGCTTTGATGGTAACCTGCTCTCAGAATCCAACTAGGACCGAGAACATTCACTCTAGAGCATGCAGGAGCCAGCAATAATAAGTCAATACCACATCTATAGCAATTTTATATCATTCACATTAAATTTATGTGGCTGCTCTGTTGGGAGATTTCACCTTTCCCATTAGGACATTTTCACTGGTGGGTAGGTGGTCCAATGTATTGTGTTCTTATGTGAGAATATACAGATGTAAAAGACCTTATTTGTCTCCCTGGCCACTGCATGCATCGCCCTACTCTGTACATAGCATGGGGTATTCATGTACTGTGAGTAATAAGTATCTGTATATTTTGCAAAGGTGCCAGGCTTCCTCCCCAGCAGGGGTTTATCTACGGATTCATAGTGCAGCCAGTGGCAGGTATAAAGGACTGTAAACTTAGTGCATTTCCACAGCGAGCGGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAACCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATGAGAAAAGTAAAAATTTTGCACATGAGCACAGCCCAGGGCAGCAGCAAGAAAGATGGTGGTGCTGCGCTCATTATAAAAGAATCCCGAACCAGTGCTTTTTTTCAGCAAAGAGGAGTGCAGGCCCAGAGCCTGAGGTAAGCAATTATAATAGCTGGGGGAAGGGTGCCTAAGAAATTGCCACCCCACAGTGATGCTTTCATTCTACTTTAACAGATTAATTGTGCTGGATAAAAACTTAATGGCAATATTGTACATTTTACCAAACAGTTACTATTTATGGTCAAGGTGCCATAACCCATAGCAACCAATAAGATGTCTGCTTTTAAATGGGTGACCAGTAAATGCTACCCGCTAACCAGGGTCAGACTGGGCCGCCGAGACACCGAGAAAAATCCCGGTGGGCCCCAGCAGCCCAGACCCGACCCTTGCCGGTGCTCCCCCTGTCCGACTGTTCCACCCCTGACGCGTTAAATTTATGCAGACTCGGGGAGGACGTTGGTGGGGGACCCTGCGGGGGGTTAGGGAGGCCCCTGGGGGGTGTTATGGGACATGGCCGGCGGGGGCACCTGCAGTGCCCCTGGGGCGGGAGACCTGGTGGGCCCTGCACCCCCCAGTCCGACCCTATTGCTAACTGGTTACTATAGGTGATAAGAACTGTAGGAAACTTTGCTCCTTAAATTGCATAACCTGCCGCCCACCCCTGTTCTTCCTAACTCTACTTGTTTGATTCAATACTTCGGGGCATATTCATTACAGTGTTTAAGCCAACATCACCAATGATGTTGCCCATAGCAACCAATGAGCAATTAGAATTTAATGGTCACCTACAAGGTAGAAAACAAAAGCAAAGATCTGTTTGGTTGCTAAGGGCAACATCACCGGTAATTTTGGCTTACACGCTATAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGTGCTGTGTATTTCCCCACTAGGCACAGGACAACACTATCTGCAATATGCAATAAACTGTTTAAACAGACAGCAAATGTAGCCAAATATACGGCACAAAAAGCTTATCCTTAAGCTTCCTTTGACCAGTAATATACAGACAAGTATGGAGAAATTTATATATAAATGCATTTAACGGTGTATGATCCAACAGATGGGTATAAAATATTACTGCCTATTGAGGTACATTTTTATTTTCTTATTTGCAACCCCCTCTCCAGCTATACCAGAAGCAAATATTTCATACTAAATTATTTGGTACTTGATACTGGGAATCAAGCTGTTGCCCAATAAATATTTCAGCCCAACAAACAATTGTATATGAGAACTGCAATAATCCAATAGTTTCGCTGGTTTTACTTCTAACATAAGAATTTAATTTAAATTTAAGAAACAACGATCCATGTACACTATAAATTCTAATTTTTAAAATTAGACTTGTACTTCTAAACAAACTGGAGCATTGGACATAAAATACCTTTTTGCTTGGAAGAGAATCAGATCTGTGTTGTTGTAAAACTACAACTCACATCCCCAGCATTCAACAGCTAGGAAGAGTAGCTCAACAGCAGTTGGCAGGCCACCGCTTGGATATATATCTAATGCAGGGCTGTCAACCAACCTCATGTCATGAGGAAGATAATGATCCAGTCCTGTTTTCTTCTTCTCCACACTAAATTATAATATGAAATAAGGTCTCAAATGCCTGGAATGAATCAGCTCTGCTCATGAATATTTAGAATATCTAGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTGAAAAAAAAAAAA
                                                      consensus depths                                                                                   3     3     3     3     3     3     3     3     3     3     3     3    10    10    12    12    16    16    23    23    29    29    35    35    38    38    38    39    39    40    39    40    39    40    39    40    39    40    39    40    39    40    39    40    39    40    39    40    39    40    39    40    39    40    39    40    39    40    40    41    40    41    42    42    42    42    42    42    43    43    43    43    45    45    45    45    45    45    46    46    46    46    46    47    46    47    46    47    46    47    46    47    46    46    47    47    47    47    45    47    46    48    46    48    46    48    46    48    46    48    47    49    47    49    47    49    47    49    48    50    47    49    47    49    45    48    46    48    46    48    46    48    46    48    45    47    45    47    45    46    45    46    40    43    33    36    29    35    31    34    29    33    29    33    24    27    22    25    18    21    16    20    17    20    16    20    14    16    12    13    12    13    12    13    12    13    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    13    13    13    13    13    13    13    10    11    10    10    10    10     9    10     8     9     7     9     6     9     6     7     6     7     7     8     7     8     6     7     5     6     4     5     4     5     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     6     6     6     6     6     6     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9    10     8     9     8     9     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     8     8     8     8     8     8     8     8     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     5     5     4     4     4     4     4     4     3     3     3     3     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     6     4     6     4     6     4     6     4     6     4     7     4     7     4     7     4     7     5     7     4     7     6     8     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     3     4     4     5     4     5     4     7     5     9    10    20    16    28    15    29    22    39    28    47    28    48    37    55    46    60    50    63    50    63    53    66    54    67    56    71    56    71    70    72    70    72    70    72    70    72    70    72    70    72    70    72    72    74    72    74    72    74    72    74    71    73    71    73    72    74    72    74    72    74    72    74    72    74    72    74    72    74    72    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    74    76    76    76    77    77    77    76    77    77    77    77    77    77    77    73    77    77    77    77    77    77    77    76    76    76    76    76    76    76    76    76    76    76    76    76    76    76    76    76    76    76    76     4     5     3     3
  5   1   2  SIG                                      Xt7.1-CAAK6403.3                                                                            ATGCTTCTCCCTCCCCCTCCCTGTAGCACTCTGCCCCCTCCCTTCACTCCTCCCTCTCGGTATCAGCACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGCATTTTTGCTCCTGTGTCCAAAATCAGCAAAGCCCCTGATCAGCCACCATCCTCAGTCACCTCCACTCCAAGGACTCCCCGTGTGGACTTCTCCCGAGTCACTGGGAAGGGGAGGAAGGAAAAGAAAGCCACACACAAAAAATCGTTGAGTGTGGGGAGCCTGGACAAAGAGGGCCTAAAGATTGACATTGGGGACCAAGTTCTCGTGGCTGGCCAGAAACAGGGATTTGTGAGATTTTATGGAAAAACTGATTTTGCCCCAGGGTACTGGTTTGGCATTGAACTGGAGAAACCAACTGGAAAACACGATGGCTCAGTTTTTGGTGTTCGATATTTTACTTGCTCCCCAAAACATGGAGTATTTGCACCCCCATCCCGGGTACAAAGGACGGGTGGACCCAAGGACCCCCAGACAGACAACAATGGTATGAAGAAGGTGCATCAAGTTACTATGACACAGCCAAAGCGTAACTTCACAACAGTGCGGACTCCAAAAGAAATTGCTTCAGAAAACTCCATCTCCAGGTTACTATTCTGTTGCTGGTTTCCGTGGCTCCTCCGTGCTGAGATGCAGTCTTAGAAACCTGTGTTCCTTTGCCACCTGTGTGTTGGGTCACACAATGATGCGCCCTTCTTTCTATGTATGCTGTCCTCTGGACCCTCCCCAGTGCCTTCTCCACATCCTCCTGCCTGTCACCTCTGATTTCTGCACCCACTGGAAGAAGGTGACAGGGGAGACTATCAACCTGCGCAAGATTATGCCAGAAGGTGTGTGAGTGGATCTGAGCTCTCTCTGTTCCCAACACCAGTCATTCCACAGAACATTCCAGACTGGCTCAATAAATTGCCCTACCCCCAATGCCAAATTACTGAAGCTTCTCTCACTCAAAGTGAACCCTCCCTCTTTACCATAAGGTAAAACAAAAATTGAGAATAATTGAAAGCTCCCAATAGATTCCCTGTTGTTGGGCAAAGAAAAAATTCTTGACATTGCATGTAGAGTTTTAGATTTTCTGTGCCCTGCAGTGTGGGATAGGTTTCCCTATTGGTAAGCAGTGATTATCTAGTATTAACATTTTACAGTTTAGAAACATCTTCCTCTGTATGGAGCAGTCTCATTTGCAGATGAAGGACAGTTTATTATTAGCGATCAATTCCAGCACTTTCTTTTATAGGGCAACACTCTTAATTTGGTTTACATCCCACCAAATAAAAGATGAATGGATTTATCTAAAGGGACATTTTCTGCCAAAATTAGCATTGCTGTAAGTTCTGGTGGGGTGTTTATCACTTGTGATTCCAGAATACTATACCATTTTGCTAGTTAAAAGAGATGTTTTTATGTGTATTTTTTTTATTTGCTAACAGTGTCCATTTTATTTTATGCATTAGATGTTTTGCCTGAAAGATGAGGTTATTTGGGTAGAGGTAAAGAACATCGGTCTATATAAAATTCAGCAAATTTGCATTAAGGCCAACAAGACCTGGATAAAAAGAAGTAGGGTGGGCACATAATCATGGCTGCATCCAAAATACAAAAATGTTTAGCCCCTGGAGTTTGGGGCCTCACGATGGAGAAATCCCACAGTTGATTCTACCTTCATAAACTAAGCTAAGCTTGCTTGCGTGAGGTTTTCTTTTTATTATTTGGGAAATCACCCAAAATGAGATCTAGTTGCTGTCTCCTGAGGAAGGCATACAATCATCATTAGGATGGCTCATTTGTTTCAGATGGATCTTATGTAACAAATGAGCATGGCCTTTCTAATTGCTGCATCTGTCCTGCATGAATTATAAAACAACAGCAGATTTAACTTACCAGATATGCATAAAGGCATTCCTACTAATTATTAATTATGCTAAGACTGTACCCAAGGGTGAAAGTAAACTTATTTACAAATGGGAACTGAACATACGGCATTAGATATACAGGCCATTTAGAATATCGTAGCGAGTTATCTTGTAATGCTCTCGAGATGAGCACGTATTCATAGCGACAGATAATGACAAATATCTGTCATTAAAGCAACTACATTTCCAAAAATAAGTTCTTGTCCAACCCACTTTACCAAAAGTTGGAGCTTTTGTGCTACACACACAGTACAAAATATTAATCCACCTGCAAGTCCTATAAGATGTTATAAGCTACAGGGATCCATCACACTGGCTGTAGGAGAGATGAAAAGGACATTTTTTATCCACTTGCAGTATCTTATATGGACTAACATATGCAGCTTCCTCAGAGAAAGCTTGAATGAATAGAAGAGCTGATAGGTTTTACACGTGTATTGGACAGGATCTGTAGGAGCGCTGTTCTAATGAGCTCTACTGTATCTATTTTAATGCCCCTGTAATTATTTGCGATGAGGGCTACGCCACCTCGCGTAGCTTGTTATTTACAGTAAAGGTTCCCTATAAATGTGCTGAAAAATGGGCATGATTTAAAAAGTTGATGGAAAATGTATATTTGTTCCATTATCTTTTTAGCCCTAGAATGATGGTCCACTGTTAAAAAAAATCATAGCATGAAAATAATATTTAAATATGTGTTAATTAATCTACCCACATTTCCATTCTGACCGTCATCTTACATTATAGGCTGAAGGATTGTGACATTAAGAATATATATGTAAATCTGGTAATTTAGGATTTAGCAGATTAATCCCTTCCTGCAATCTTGCCTGTAGAAAGCCCAGTTCTTAATGCACCCTGGTCTTCCTGTTAAATGCATGATGGTCTGTTTCATTTTCCGTGCAGTATCATCAAGATCATTTTTCCGAAAGAGATATCAGTTGTAATTACTACTGAATACCTTTTATTTCTTGTGGATCAACGAACCATAAAACCCTTGTTGCTGTTGGTTGCTTCCTTTATACGCACATGGAAAGCATATAATTGCTAACTCCTGCATGCTACACATTTGCAATTCCATATTGTCATACCCATAATATGCCATTTCCTGCCCATTAGCATCAGCATGAATGCTTTGATGGTAACCTGCTCTCAGAATCCAACTAGGACCGAGAACATTCACTCTAGAGCATGCAGGAGCCAGCAATAATAAGTCAATACCACATCTATAGCAATTTTATATCATTCACATTAAATTTATGTGGCTGCTCTGTTGGGAGATTTCACCTTTCCCATTAGGACATTTTCACTGGTGGGTAGGTGGTCCAATGTATTGTGTTCTTATGTGAGAATATACAGATGTAAAAGACCTTATTTGTCTCCCTGGCCACTGCATGCATCGCCCTACTCTGTACATAGCATGGGGTATTCATGTACTGTGAGTAATAAGTATCTGTATATTTTGCAAAGGTGCCAGGCTTCCTCCCCAGCAGGGGTTTATCTACGGATTCATAGTGCAGCCAGTGGCAGGTATAAAGGACTGTAAACTTAGTGCATTTCCACAGCGAGCGGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAACCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATGAGAAAAGTAAAAATTTTGCACATGAGCACAGCCCAGGGCAGCAGCAAGAAAGATGGTGGTGCTGCGCTCATTATAAAAGAATCCCGAACCAGTGCTTTTTTTCAGCAAAGAGGAGTGCAGGCCCAGAGCCTGAGGTAAGCAATTATAATAGCTGGGGGAAGGGTGCCTAAGAAATTGCCACCCCACAGTGATGCTTTCATTCTACTTTAACAGATTAATTGTGCTGGATAAAAACTTAATGGCAATATTGTACATTTTACCAAACAGTTACTATTTATGGTCAAGGTGCCATAACCCATAGCAACCAATAAGATGTCTGCTTTTAAATGGGTGACCAGTAAATGCTACCCGCTAACCAGGGTCAGACTGGGCCGCCGAGACACCGAGAAAAATCCCGGTGGGCCCCAGCAGCCCAGACCCGACCCTTGCCGGTGCTCCCCCTGTCCGACTGTTCCACCCCTGACGCGTTAAATTTATGCAGACTCGGGGAGGACGTTGGTGGGGGACCCTGCGGGGGGTTAGGGAGGCCCCTGGGGGGTGTTATGGGACATGGCCGGCGGGGGCACCTGCAGTGCCCCTGGGGCGGGAGACCTGGTGGGCCCTGCACCCCCCAGTCCGACCCTATTGCTAACTGGTTACTATAGGTGATAAGAACTGTAGGAAACTTTGCTCCTTAAATTGCATAACCTGCCGCCCACCCCTGTTCTTCCTAACTCTACTTGTTTGATTCAATACTTCGGGGCATATTCATTACAGTGTTTAAGCCAACATCACCAATGATGTTGCCCATAGCAACCAATGAGCAATTAGAATTTAATGGTCACCTACAAGGTAGAAAACAAAAGCAAAGATCTGTTTGGTTGCTAAGGGCAACATCACCGGTAATTTTGGCTTACACGCTATAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGTGCTGTGTATTTCCCCACTAGGCACAGGACAACACTATCTGCAATATGCAATAAACTGTTTAAACAGACAGCAAATGTAGCCAAATATACGGCACAAAAAGCTTATCCTTAAGCTTCCTTTGACCAGTAATATACAGACAAGTATGGAGAAATTTATATATAAATGCATTTAACGGTGTATGATCCAACAGATGGGTATAAAATATTACTGCCTATTGAGGTACATTTTTATTTTCTTATTTGCAACCCCCTCTCCAGCTATACCAGAAGCAAATATTTCATACTAAATTATTTGGTACTTGATACTGGGAATCAAGCTGTTGCCCAATAAATATTTCAGCCCAACAAACAATTGTATATGAGAACTGCAATAATCCAATAGTTTCGCTGGTTTTACTTCTAACATAAGAATTTAATTTAAATTTAAGAAACAACGATCCATGTACACTATAAATTCTAATTTTTAAAATTAGACTTGTACTTCTAAACAAACTGGAGCATTGGACATAAAATACCTTTTTGCTTGGAAGAGAATCAGATCTGTGTTGTTGTAAAACTACAACTCACATCCCCAGCATTCAACAGCTAGGAAGAGTAGCTCAACAGCAGTTGGCAGGCCACCGCTTGGATATATATCTAATGCAGGGCTGTCAACCAACCTCATGTCATGAGGAAGATAATGATCCAGTCCTGTTTTCTTCTTCTCCACACTAAATTATAATATGAAATAAGGTCTCAAATGCCTGGAATGAATCAGCTCTGCTCATGAATATTTAGAATATCTAGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTGAAAA
  5   1   2  SIG                                     Xt7.1-CAAJ15299.5                                                                                                                                                                              AAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCTTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTATGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACTCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGCATTTTTGCTCCTGTGTCCAAAATCAGCAAAGCCCCTGATCAGCCACCATCCTCAGTCACCTCCACTCCAAGGACTCCCCGTGTGGACTTCTCCCGAGTCACTGGGAAGGGGAGGAAGGAAAAGAAAGCCACACACAAAAAATCGTTGAGTGTGGGGAGCCTGGACAAAGAGGGCCTAAAGATTGACATTGGGGACCAAGTTCTCGTGGCTGGCCAGAAACAGGGATTTGTGAGATTTTATGGAAAAACTGATTTTGCCCCAGGGTACTGGTTTGGCATTGAACTGGAGAAACCAACTGGAAAACACGATGGCTCAGTTTTTGGTGTTCGATATTTTACTTGCTCCCCAAAACATGGAGTATTTGCACCCCCATCCCGGGTACAAAGGACGGGTGGACCCAAGGACCCCCAGACAGACAACAATGGTATGAAGAAGGTGCATCAAGTTACTATGACACAGCCAAAGCGTAACTTCACAACAGTGCGGACTCCAAAAGAAATTGCTTCAGAAAACTCCATCTCCAGGTTACTATTCTGTTGCTGGTTTCCGTGGCTCCTCCGTGCTGAGATGCAGTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATAATATGAAATAGGTCTCAAATGCCTGGAATGAATCAGCTCTGCTCATGAATATTTAGAATATCTAGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGAAATCAGCTTGAATCTGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTGAAAAAA
  5   1   2                                          Xt7.1-CAAJ20363.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTAGGTGGTCCAATGTATTGTGTTCTTATGTGAGAATATACAGATGTAAAAGACCTTATTTGTCTCCCTGGCCACTGCATGCATCGCCCTACTCTGTACATAGCATGGGGTATTCATGTACTGTGAGTAATAAGTATCTGTATATTTTGCAAAGGTGCCAGGCTTCCTCCCCAGCAGGGGTTTATCTACGGATTCATAGTGCAGCCAGTGGCAGGTATAAAGGACTGTAAACTTAGTGCATTTCCACAGCGAGCAGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAGCCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATGAGAAAAGTAAAAATTTTGCACATGAGCACAGCCCAGGGCAGCAGCAAGAAAGATGGTGGTGCTGCGCTCATTATAAAAGAATCCCGAACCAGTGCTTTTTTTCAGCAAAGAGGAGTGCAGGCCCAGAGCCTGAGGTAAGCAATTATAATAGCTGGGGGAAGGGTGCCTAAGAAATTGCCACCCCACAGTGATGCTTTCATTCTACTTTAACAGATTAATTGTGCTGGATAAAAACTTAATGGCAATATTGTACATTTTACCGAACAGTTACTATTTATGGTCAAGGTGCCATAACCCATAGCAACCAATAAGATGTCTGCTTTTAAATGGGTGACCAGTAAATGCTACCTGCTAACCAGGGTCAGACTGGGCCGCCGAGACACCGAGAAAAATCCCGGTGGGCCCCAGCAGCCCAGACCCGAACCTTGCCGGTGCTCCCCCTGTCCGACT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGAAATCAGCTTGAATCTGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGAATATTTAGAATATCTAGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGAAATCAGCTTGAATCTGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---TG-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---T--------
                                               BLH ATG     223    1134                                                                              
                                               BLH MIN     223     185                                                                              
                                               BLH OVR     223      51                                                                              
                                               EST CLI     103      33                                                                              
                                               ORF LNG     223       8                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Sc ---- 3e-010     NP_015151.1 Nuclear import protein; Nip100p [Saccharomyces cerevisiae] ================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 1e-010     NP_001022682.1 M01A8.2a [Caenorhabditis elegans] =========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 8e-037     NP_001036366.1 CLIP-190 CG5020-PG, isoform G [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xt ---- 2e-038     AAI35452.1 Unknown (protein for MGC:121465) [Xenopus tropicalis] ---------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Sp ---- 1e-039     XP_001200672.1 PREDICTED: similar to Restin [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Gg ---- 3e-138     XP_426112.2 PREDICTED: hypothetical protein [Gallus gallus] --------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Dr ---- 0          XP_690922.1 PREDICTED: hypothetical protein XP_685830 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 0          NP_056341.1 CLIP-170-related protein [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Mm ==== 0          XP_920287.1 PREDICTED: similar to CLIP-170-related protein isoform 2 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 0          AAH86287.1 LOC495693 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = ?? ==== 0          NP_001088641.1 hypothetical protein LOC495693 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAK6403.3.5                                                                                                                                                                TGAATG------------------------------------------------------------TGA------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------ATG------TAG---------------------------------------------------------------ATG------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TGA---TAA------------------------------------------------TGA------ATGTAG---------------------------------TAG------------------------------------------------------------------------------------------TGA---------------TAG---------------------------------------TAA---------------------TAA---ATG------------TAA---------------------TAG------------------------------------TGA------------------------TAG---------ATG------------------------------------------------------------------TGA---ATG------------TAG---TAA---------------------------------------------------------TAA------------------------------------------------ATG------------------------------------------------------------TAA---------------------TGA------------------------------------------TAG---------------------------------------------------------------------------TGA------------TAA------------------ATG------------------------------------------------------------------------------------------------------------------------------------TAG------------------------TAG------------TAA------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------TAA------------------------------------TAG------TGA---------------------------------------------------------------------TGAATG---------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------TGA------------ATG---------------------------------------ATGATG---------TAA---------TAG---------------TAA------------TAA---------------------------------------------------------------------------------------TAG------------TAA------------------------------------------------------------TAAATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------TAATAA---------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TAA---TAG---------------------------------------TGA---------------TAA------------------------------------------ATG------------------ATG------------------------------------------------TAA------------TAG------------------------TAA---------------------------------------TGA------------ATG------------------------------------TAA---------------------------------------------------TAGTAG---------------TAGATG---------------------ATG---------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------TAA------------------TAA---------------------------------------------ATG------------TAA------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------TAG---------------------------ATG---------------------------------------------------------------------------------------------TGATAA------TAG---------------------------------------------------------------------------------------------------------------------TGA---------TAG------ATG------TAG------ATG---------------------------------------------TAA---------------TAA------------------------------------------------------------------------------------------------------------------------------------ATGTAG---------------------------------------------------------------ATG------------------------TAA------ATG---------ATG------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------TGA---------TAA---------------------------------------TAA------------------------ATG---------------------TAA---TAG------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------ATG---TGA------TAATGA---------------------------------------ATG---TAA------------------TGA------------------------------------------ATG------------------------------------------------TGA---------------------------------------------------------------------------TAA---------------------TAA------------------TAG------------TAG---------------------TAA------------------ATG---TGA---------------------------TAA---------------------------------------------------------------------------------------TAA------TAG---------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------TAG---------------------------------------------------------ATG---------TAA------TGA---------------------------TAA---TGA---------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
  5   1   2  SIG                                      Xt7.1-CAAK6403.3                                                                            ATGCTTCTCCCTCCCCCTCCCTGTAGCACTCTGCCCCCTCCCTTCACTCCTCCCTCTCGGTATCAGCACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGCATTTTTGCTCCTGTGTCCAAAATCAGCAAAGCCCCTGATCAGCCACCATCCTCAGTCACCTCCACTCCAAGGACTCCCCGTGTGGACTTCTCCCGAGTCACTGGGAAGGGGAGGAAGGAAAAGAAAGCCACACACAAAAAATCGTTGAGTGTGGGGAGCCTGGACAAAGAGGGCCTAAAGATTGACATTGGGGACCAAGTTCTCGTGGCTGGCCAGAAACAGGGATTTGTGAGATTTTATGGAAAAACTGATTTTGCCCCAGGGTACTGGTTTGGCATTGAACTGGAGAAACCAACTGGAAAACACGATGGCTCAGTTTTTGGTGTTCGATATTTTACTTGCTCCCCAAAACATGGAGTATTTGCACCCCCATCCCGGGTACAAAGGACGGGTGGACCCAAGGACCCCCAGACAGACAACAATGGTATGAAGAAGGTGCATCAAGTTACTATGACACAGCCAAAGCGTAACTTCACAACAGTGCGGACTCCAAAAGAAATTGCTTCAGAAAACTCCATCTCCAGGTTACTATTCTGTTGCTGGTTTCCGTGGCTCCTCCGTGCTGAGATGCAGTCTTAGAAACCTGTGTTCCTTTGCCACCTGTGTGTTGGGTCACACAATGATGCGCCCTTCTTTCTATGTATGCTGTCCTCTGGACCCTCCCCAGTGCCTTCTCCACATCCTCCTGCCTGTCACCTCTGATTTCTGCACCCACTGGAAGAAGGTGACAGGGGAGACTATCAACCTGCGCAAGATTATGCCAGAAGGTGTGTGAGTGGATCTGAGCTCTCTCTGTTCCCAACACCAGTCATTCCACAGAACATTCCAGACTGGCTCAATAAATTGCCCTACCCCCAATGCCAAATTACTGAAGCTTCTCTCACTCAAAGTGAACCCTCCCTCTTTACCATAAGGTAAAACAAAAATTGAGAATAATTGAAAGCTCCCAATAGATTCCCTGTTGTTGGGCAAAGAAAAAATTCTTGACATTGCATGTAGAGTTTTAGATTTTCTGTGCCCTGCAGTGTGGGATAGGTTTCCCTATTGGTAAGCAGTGATTATCTAGTATTAACATTTTACAGTTTAGAAACATCTTCCTCTGTATGGAGCAGTCTCATTTGCAGATGAAGGACAGTTTATTATTAGCGATCAATTCCAGCACTTTCTTTTATAGGGCAACACTCTTAATTTGGTTTACATCCCACCAAATAAAAGATGAATGGATTTATCTAAAGGGACATTTTCTGCCAAAATTAGCATTGCTGTAAGTTCTGGTGGGGTGTTTATCACTTGTGATTCCAGAATACTATACCATTTTGCTAGTTAAAAGAGATGTTTTTATGTGTATTTTTTTTATTTGCTAACAGTGTCCATTTTATTTTATGCATTAGATGTTTTGCCTGAAAGATGAGGTTATTTGGGTAGAGGTAAAGAACATCGGTCTATATAAAATTCAGCAAATTTGCATTAAGGCCAACAAGACCTGGATAAAAAGAAGTAGGGTGGGCACATAATCATGGCTGCATCCAAAATACAAAAATGTTTAGCCCCTGGAGTTTGGGGCCTCACGATGGAGAAATCCCACAGTTGATTCTACCTTCATAAACTAAGCTAAGCTTGCTTGCGTGAGGTTTTCTTTTTATTATTTGGGAAATCACCCAAAATGAGATCTAGTTGCTGTCTCCTGAGGAAGGCATACAATCATCATTAGGATGGCTCATTTGTTTCAGATGGATCTTATGTAACAAATGAGCATGGCCTTTCTAATTGCTGCATCTGTCCTGCATGAATTATAAAACAACAGCAGATTTAACTTACCAGATATGCATAAAGGCATTCCTACTAATTATTAATTATGCTAAGACTGTACCCAAGGGTGAAAGTAAACTTATTTACAAATGGGAACTGAACATACGGCATTAGATATACAGGCCATTTAGAATATCGTAGCGAGTTATCTTGTAATGCTCTCGAGATGAGCACGTATTCATAGCGACAGATAATGACAAATATCTGTCATTAAAGCAACTACATTTCCAAAAATAAGTTCTTGTCCAACCCACTTTACCAAAAGTTGGAGCTTTTGTGCTACACACACAGTACAAAATATTAATCCACCTGCAAGTCCTATAAGATGTTATAAGCTACAGGGATCCATCACACTGGCTGTAGGAGAGATGAAAAGGACATTTTTTATCCACTTGCAGTATCTTATATGGACTAACATATGCAGCTTCCTCAGAGAAAGCTTGAATGAATAGAAGAGCTGATAGGTTTTACACGTGTATTGGACAGGATCTGTAGGAGCGCTGTTCTAATGAGCTCTACTGTATCTATTTTAATGCCCCTGTAATTATTTGCGATGAGGGCTACGCCACCTCGCGTAGCTTGTTATTTACAGTAAAGGTTCCCTATAAATGTGCTGAAAAATGGGCATGATTTAAAAAGTTGATGGAAAATGTATATTTGTTCCATTATCTTTTTAGCCCTAGAATGATGGTCCACTGTTAAAAAAAATCATAGCATGAAAATAATATTTAAATATGTGTTAATTAATCTACCCACATTTCCATTCTGACCGTCATCTTACATTATAGGCTGAAGGATTGTGACATTAAGAATATATATGTAAATCTGGTAATTTAGGATTTAGCAGATTAATCCCTTCCTGCAATCTTGCCTGTAGAAAGCCCAGTTCTTAATGCACCCTGGTCTTCCTGTTAAATGCATGATGGTCTGTTTCATTTTCCGTGCAGTATCATCAAGATCATTTTTCCGAAAGAGATATCAGTTGTAATTACTACTGAATACCTTTTATTTCTTGTGGATCAACGAACCATAAAACCCTTGTTGCTGTTGGTTGCTTCCTTTATACGCACATGGAAAGCATATAATTGCTAACTCCTGCATGCTACACATTTGCAATTCCATATTGTCATACCCATAATATGCCATTTCCTGCCCATTAGCATCAGCATGAATGCTTTGATGGTAACCTGCTCTCAGAATCCAACTAGGACCGAGAACATTCACTCTAGAGCATGCAGGAGCCAGCAATAATAAGTCAATACCACATCTATAGCAATTTTATATCATTCACATTAAATTTATGTGGCTGCTCTGTTGGGAGATTTCACCTTTCCCATTAGGACATTTTCACTGGTGGGTAGGTGGTCCAATGTATTGTGTTCTTATGTGAGAATATACAGATGTAAAAGACCTTATTTGTCTCCCTGGCCACTGCATGCATCGCCCTACTCTGTACATAGCATGGGGTATTCATGTACTGTGAGTAATAAGTATCTGTATATTTTGCAAAGGTGCCAGGCTTCCTCCCCAGCAGGGGTTTATCTACGGATTCATAGTGCAGCCAGTGGCAGGTATAAAGGACTGTAAACTTAGTGCATTTCCACAGCGAGCGGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAACCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATGAGAAAAGTAAAAATTTTGCACATGAGCACAGCCCAGGGCAGCAGCAAGAAAGATGGTGGTGCTGCGCTCATTATAAAAGAATCCCGAACCAGTGCTTTTTTTCAGCAAAGAGGAGTGCAGGCCCAGAGCCTGAGGTAAGCAATTATAATAGCTGGGGGAAGGGTGCCTAAGAAATTGCCACCCCACAGTGATGCTTTCATTCTACTTTAACAGATTAATTGTGCTGGATAAAAACTTAATGGCAATATTGTACATTTTACCAAACAGTTACTATTTATGGTCAAGGTGCCATAACCCATAGCAACCAATAAGATGTCTGCTTTTAAATGGGTGACCAGTAAATGCTACCCGCTAACCAGGGTCAGACTGGGCCGCCGAGACACCGAGAAAAATCCCGGTGGGCCCCAGCAGCCCAGACCCGACCCTTGCCGGTGCTCCCCCTGTCCGACTGTTCCACCCCTGACGCGTTAAATTTATGCAGACTCGGGGAGGACGTTGGTGGGGGACCCTGCGGGGGGTTAGGGAGGCCCCTGGGGGGTGTTATGGGACATGGCCGGCGGGGGCACCTGCAGTGCCCCTGGGGCGGGAGACCTGGTGGGCCCTGCACCCCCCAGTCCGACCCTATTGCTAACTGGTTACTATAGGTGATAAGAACTGTAGGAAACTTTGCTCCTTAAATTGCATAACCTGCCGCCCACCCCTGTTCTTCCTAACTCTACTTGTTTGATTCAATACTTCGGGGCATATTCATTACAGTGTTTAAGCCAACATCACCAATGATGTTGCCCATAGCAACCAATGAGCAATTAGAATTTAATGGTCACCTACAAGGTAGAAAACAAAAGCAAAGATCTGTTTGGTTGCTAAGGGCAACATCACCGGTAATTTTGGCTTACACGCTATAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGTGCTGTGTATTTCCCCACTAGGCACAGGACAACACTATCTGCAATATGCAATAAACTGTTTAAACAGACAGCAAATGTAGCCAAATATACGGCACAAAAAGCTTATCCTTAAGCTTCCTTTGACCAGTAATATACAGACAAGTATGGAGAAATTTATATATAAATGCATTTAACGGTGTATGATCCAACAGATGGGTATAAAATATTACTGCCTATTGAGGTACATTTTTATTTTCTTATTTGCAACCCCCTCTCCAGCTATACCAGAAGCAAATATTTCATACTAAATTATTTGGTACTTGATACTGGGAATCAAGCTGTTGCCCAATAAATATTTCAGCCCAACAAACAATTGTATATGAGAACTGCAATAATCCAATAGTTTCGCTGGTTTTACTTCTAACATAAGAATTTAATTTAAATTTAAGAAACAACGATCCATGTACACTATAAATTCTAATTTTTAAAATTAGACTTGTACTTCTAAACAAACTGGAGCATTGGACATAAAATACCTTTTTGCTTGGAAGAGAATCAGATCTGTGTTGTTGTAAAACTACAACTCACATCCCCAGCATTCAACAGCTAGGAAGAGTAGCTCAACAGCAGTTGGCAGGCCACCGCTTGGATATATATCTAATGCAGGGCTGTCAACCAACCTCATGTCATGAGGAAGATAATGATCCAGTCCTGTTTTCTTCTTCTCCACACTAAATTATAATATGAAATAAGGTCTCAAATGCCTGGAATGAATCAGCTCTGCTCATGAATATTTAGAATATCTAGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTGAAAA
                                                  Xt7.1-CHK-1008274034                                                                                  CTCCCTCCCCCTCCCTGTAGCACTCTGCCCCCTCCCTTCACTCCTCCCTCTCGGTATCAGCACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGCATTTTTGCTCCTGTGTCCAAAATCAGCAAAGCCCCTGATCAGCCACCATCCTCAGTCACCTCCACTCCAAGGACTCCCCGTGTGGACTTCTCCCGAGTCACTGGGAAGGGGAGGAAGGAAAAGAAAGCCACACACAAAAAATCGTTGAGTGTGGGGAGCCTGGACAAAGAGGGCCTAAAGATTGACATTGGGGACCAAGTTCTCGTGGCTGGCCAGAAACAGGGATTTGTGAGATTTTATGGAAAAACTGATTTTGCCCCAGGGTACTGGTTTGGCATTGAACTGGAGAAACCAACTGGAAAACACGATGGCTCAGTTTTTGGTGTTCGATATTTTACTTGCTCCCCAAAACATGGAGTATTTGCACCCCCATCCCGGGTACAAAGGACGGGTGGACCCAAGGACCCCCAGACAGACAACAATGGTATGAAGAAGGTGCATCAAGTTACTATGACACAGCCAAAGCGTAACTTCACAACAGTGCGGACTCCAAAAGAAATTGCTTCAGAAAACTCCATCTCCAGGTTACTATTCTGTTGCTGGTTTCCGTGGCTCCTCCGTGCTGAGATGCAGTCTTAGAAACCTGTGTTCCTTTGCCACCTGTGTGTTGGGTCACACAATGATGCGCCCTTCTTTCTATGTATGCTGTCCTCTGGACCCTCCCCAGTGCCTTCTCCACATCCTCCTGCCTGTCACCTCTGATTTCTGCACCCACTGGAAGAAGGTGACAGGGGAGACTATCAACCTGCGCAAGATTATGCCAGAAGGTGTGTGAGTGGATCTGAGCTCTCTCTGTTCCCAACACCAGTCATTCCACAGAACATTCCAGACTGGCTCAATAAATTGCCCTACCCCCAATGCCAAATTACTGAAGCTTCTCTCACTCAAAGTGAACCCTCCCTCTTTACCATAAGGTAAAACAAAAATTGAGAATAATTGAAAGCTCCCAATAGATTCCCTGTTGTTGGGCAAAGAAAAAATTCTTGACATTGCATGTAGAGTTTTAGATTTTCTGTGCCCTGCAGTGTGGGATAGGTTTCCCTATTGGTAAGCAGTGATTATCTAGTATTAACATTTTACAGTTTAGAAACATCTTCCTCTGTATGGAGCAGTCTCATTTGCAGATGAAGGACAGTTTATTATTAGCGATCAATTCCAGCACTTTCTTTTATAGGGCAACACTCTTAATTTGGTTTACATCCCACCAAATAAAAGATGAATGGATTTATCTAAAGGGACATTTTCTGCCAAAATTAGCATTGCTGTAAGTTCTGGTGGGGTGTTTATCACTTGTGATTCCAGAATACTATACCATTTTGCTAGTTAAAAGAGATGTTTTTATGTGTATTTTTTTTATTTGCTAACAGTGTCCATTTTATTTTATGCATTAGATGTTTTGCCTGAAAGATGAGGTTATTTGGGTAGAGGTAAAGAACATCGGTCTATATAAAATTCAGCAAATTTGCATTAAGGCCAACAAGACCTGGATAAAAAGAAGTAGGGTGGGCACATAATCATGGCTGCATCCAAAATACAAAAATGTTTAGCCCCTGGAGTTTGGGGCCTCACGATGGAGAAATCCCACAGTTGATTCTACCTTCATAAACTAAGCTAAGCTTGCTTGCGTGAGGTTTTCTTTTTATTATTTGGGAAATCACCCAAAATGAGATCTAGTTGCTGTCTCCTGAGGAAGGCATACAATCATCATTAGGATGGCTCATTTGTTTCAGATGGATCTTATGTAACAAATGAGCATGGCCTTTCTAATTGCTGCATCTGTCCTGCATGAATTATAAAACAACAGCAGATTTAACTTACCAGATATGCATAAAGGCATTCCTACTAATTATTAATTATGCTAAGACTGTACCCAAGGGTGAAAGTAAACTTATTTACAAATGGGAACTGAACATACGGCATTAGATATACAGGCCATTTAGAATATCGTAGCGAGTTATCTTGTAATGCTCTCGAGATGAGCACGTATTCATAGCGACAGATAATGACAAATATCTGTCATTAAAGCAACTACATTTCCAAAAATAAGTTCTTGTCCAACCCACTTTACCAAAAGTTGGAGCTTTTGTGCTACACACACAGTACAAAATATTAATCCACCTGCAAGTCCTATAAGATGTTATAAGCTACAGGGATCCATCACACTGGCTGTAGGAGAGATGAAAAGGACATTTTTTATCCACTTGCAGTATCTTATATGGACTAACATATGCAGCTTCCTCAGAGAAAGCTTGAATGAATAGAAGAGCTGATAGGTTTTACACGTGTATTGGACAGGATCTGTAGGAGCGCTGTTCTAATGAGCTCTACTGTATCTATTTTAATGCCCCTGTAATTATTTGCGATGAGGGCTACGCCACCTCGCGTAGCTTGTTATTTACAGTAAAGGTTCCCTATAAATGTGCTGAAAAATGGGCATGATTTAAAAAGTTGATGGAAAATGTATATTTGTTCCATTATCTTTTTAGCCCTAGAATGATGGTCCACTGTTAAAAAAAATCATAGCATGAAAATAATATTTAAATATGTGTTAATTAATCTACCCACATTTCCATTCTGACCGTCATCTTACATTATAGGCTGAAGGATTGTGACATTAAGAATATATATGTAAATCTGGTAATTTAGGATTTAGCAGATTAATCCCTTCCTGCAATCTTGCCTGTAGAAAGCCCAGTTCTTAATGCACCCTGGTCTTCCTGTTAAATGCATGATGGTCTGTTTCATTTTCCGTGCAGTATCATCAAGATCATTTTTCCGAAAGAGATATCAGTTGTAATTACTACTGAATACCTTTTATTTCTTGTGGATCAACGAACCATAAAACCCTTGTTGCTGTTGGTTGCTTCCTTTATACGCACATGGAAAGCATATAATTGCTAACTCCTGCATGCTACACATTTGCAATTCCATATTGTCATACCCATAATATGCCATTTCCTGCCCATTAGCATCAGCATGAATGCTTTGATGGTAACCTGCTCTCAGAATCCAACTAGGACCGAGAACATTCACTCTAGAGCATGCAGGAGCCAGCAATAATAAGTCAATACCACATCTATAGCAATTTTATATCATTCACATTAAATTTATGTGGCTGCTCTGTTGGGAGATTTCACCTTTCCCATTAGGACATTTTCACTGGTGGGTAGGTGGTCCAATGTATTGTGTTCTTATGTGAGAATATACAGATGTAAAAGACCTTATTTGTCTCCCTGGCCACTGCATGCATCGCCCTACTCTGTACATAGCATGGGGTATTCATGTACTGTGAGTAATAAGTATCTGTATATTTTGCAAAGGTGCCAGGCTTCCTCCCCAGCAGGGGTTTATCTACGGATTCATAGTGCAGCCAGTGGCAGGTATAAAGGACTGTAAACTTAGTGCATTTCCACAGCGAGCGGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAACCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATGAGAAAAGTAAAAATTTTGCACATGAGCACAGCCCAGGGCAGCAGCAAGAAAGATGGTGGTGCTGCGCTCATTATAAAAGAATCCCGAACCAGTGCTTTTTTTCAGCAAAGAGGAGTGCAGGCCCAGAGCCTGAGGTAAGCAATTATAATAGCTGGGGGAAGGGTGCCTAAGAAATTGCCACCCCACAGTGATGCTTTCATTCTACTTTAACAGATTAATTGTGCTGGATAAAAACTTAATGGCAATATTGTACATTTTACCAAACAGTTACTATTTATGGTCAAGGTGCCATAACCCATAGCAACCAATAAGATGTCTGCTTTTAAATGGGTGACCAGTAAATGCTACCCGCTAACCAGGGTCAGACTGGGCCGCCGAGACACCGAGAAAAATCCCGGTGGGCCCCAGCAGCCCAGACCCGACCCTTGCCGGTGCTCCCCCTGTCCGACTGTTCCACCCCTGACGCGTTAAATTTATGCAGACTCGGGGAGGACGTTGGTGGGGGACCCTGCGGGGGGTTAGGGAGGCCCCTGGGGGGTGTTATGGGACATGGCCGGCGGGGGCACCTGCAGTGCCCCTGGGGCGGGAGACCTGGTGGGCCCTGCACCCCCCAGTCCGACCCTATTGCTAACTGGTTACTATAGGTGATAAGAACTGTAGGAAACTTTGCTCCTTAAATTGCATAACCTGCCGCCCACCCCTGTTCTTCCTAACTCTACTTGTTTGATTCAATACTTCGGGGCATATTCATTACAGTGTTTAAGCCAACATCACCAATGATGTTGCCCATAGCAACCAATGAGCAATTAGAATTTAATGGTCACCTACAAGGTAGAAAACAAAAGCAAAGATCTGTTTGGTTGCTAAGGGCAACATCACCGGTAATTTTGGCTTACACGCTATAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGTGCTGTGTATTTCCCCACTAGGCACAGGACAACACTATCTGCAATATGCAATAAACTGTTTAAACAGACAGCAAATGTAGCCAAATATACGGCACAAAAAGCTTATCCTTAAGCTTCCTTTGACCAGTAATATACAGACAAGTATGGAGAAATTTATATATAAATGCATTTAACGGTGTATGATCCAACAGATGGGTATAAAATATTACTGCCTATTGAGGTACATTTTTATTTTCTTATTTGCAACCCCCTCTCCAGCTATACCAGAAGCAAATATTTCATACTAAATTATTTGGTACTTGATACTGGGAATCAAGCTGTTGCCCAATAAATATTTCAGCCCAACAAACAATTGTATATGAGAACTGCAATAATCCAATAGTTTCGCTGGTTTTACTTCTAACATAAGAATTTAATTTAAATTTAAGAAACAACGATCCATGTACACTATAAATTCTAATTTTTAAAATTAGACTTGTACTTCTAAACAAACTGGAGCATTGGACATAAAATACCTTTTTGCTTGGAAGAGAATCAGATCTGTGTTGTTGTAAAACTACAACTCACATCCCCAGCATTCAACAGCTAGGAAGAGTAGCTCAACAGCAGTTGGCAGGCCACCGCTTGGATATATATCTAATGCAGGGCTGTCAACCAACCTCATGTCATGAGGAAGATAATGATCCAGTCCTGTTTTCTTCTTCTCCACACTAAATTATAATATGAAATAAGGTCTCAAATGCCTGGAATGAATCAGCTCTGCTCATGAATATTTAGAATATCTAGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTGAAAAAAAAAA
  5   1   2   14  add Brn2 5g3  in                        CAAJ12402.5p .....................................CCCTATACTCCTGTCCCCTCTCCCTCCTCTCTGGGCCTATGCTTCTCCCTCCCCCTCCCTGTAGCACTCTGCCCCCTCCCTTCACTCCTCCCTCTCGGTATCAGCACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCTTGCAAAGCTGGAGCACATGGAGTGGGTAATGTATCAGTGTTAGTTATACACTGCACTCAAGCATAATGTATACAAAGCACACACTGTGGTGTCCGACCTGCCTTTATTGCAGTCTGGTCTGAGTTCAGGAAGTAAGTCACACATTCAATGAAAATTGAGGGGCTGCTCCTAGCATACACTACTATGAACCTCTCTTAATATGTCACTCATTCAGATCATGGTATCCATTGGCTAAGAATAGAAGATGCAAGTTACATATTGAGGTT
  5   1   2   24  ext Brn2 5g                             CAAJ15905.5p .........................................ATACTCCTGTCCCCTCTCCCTCCTCTCTGGGCCTATGCTTCTCCCTCCCCCTCCCTGTAGCACTCTGCCCCCTCCCTTCACTCCTCCCTCTCGGTATCAGCACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGG
  5   1   2   14  ext Brn2 5g3  in                        CAAJ20113.5p ...........................................................................ATGCTTCTCCCTCCCCCTCCCTGTAGCACTCTGCCCCCTCCCTTCACTCCTCCCTCTCGGTATCAGCACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCC
  5   1   3   14   nb Brn2 5g3  in                        CAAJ12983.5p .............................................................................................................................................CACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCT
  5   1   3   14   nb Brn2 5g3  in                        CAAJ16926.5p .............................................................................................................................................CACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCANAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCCTCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACAT
  5   1   4   14 seed Brn2 5g3  in                        CAAJ17228.5p .............................................................................................................................................CACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGG
  5   1   3   14   nb Brn2 5g3  in                        CAAJ18067.5p .............................................................................................................................................CACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTG
  5   1   3   14   nb Brn2 5g3  in                        CAAJ20501.5p .............................................................................................................................................CACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGGCAATCCTTCTGT
  5   1   3   14   nb Brn2 5g3  in                          CAAJ739.5p .............................................................................................................................................CACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCANAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGG
  5   1   3   14   nb Brn2 5g3  in                        CAAJ24011.5p ..............................................................................................................................................ACAGACCCAGTAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCANAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGC
  5   1   3   14   nb Brn2 5g3  in                         CAAJ6270.5p ........................................................................................................................................................TAGCATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGG
  5   1   3   14   nb Brn2 5g3  in                        CAAJ13767.5p ...........................................................................................................................................................CATCTGAATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGT
  5   1   3   14   nb Brn2 5g3  in                          CAAJ426.5p ..................................................................................................................................................................ATGACGCACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCTTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACT
  5   1   2   14  ext Brn2 5g3  in                        CAAJ19642.5p ........................................................................................................................................................................CACGAAAGAAAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACNAGGCGGAGTCTGCTATGATTGCCCAAGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTT
  5   1   3   14   nb Brn2 5g3  in                        CAAJ17492.5p .................................................................................................................................................................................AAGAGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCANAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTTCTGTTAGAAATAGCAAGGGCCAAGT
  5   1   2   14  ext Brn2 5g3  in                        CAAJ18084.5p ....................................................................................................................................................................................AGACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCTTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGNAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGANATAGCAGGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTT
  5   1   3   14   nb Brn2 5g3  in                        CAAJ14606.5p ......................................................................................................................................................................................ACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGA
  5   1   3   14   nb Brn2 5g3  in                        CAAJ15589.5p ......................................................................................................................................................................................ACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCA
  5   1   3   14   nb Brn2 5g3  in                        CAAJ22865.5p ......................................................................................................................................................................................ACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCANAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGGCCAGTACCAGCTGACGTAGTTCCTGACCCCTATGATATGGGCTTGGACAAGGC
  5   1   3   14   nb Brn2 PIPE in                        CAAJ22893.5p ......................................................................................................................................................................................ACAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGAAATTATTGGCAGTGAGATCCTGAAGAGGGGCTGTCATGTAAACGATAAAGATGGATTGACAGGATATGAC
  5   1   3   14   nb Brn2 5g3  in                        CAAJ15071.5p .......................................................................................................................................................................................CAATATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGC
  5   1   3   14   nb Brn2 5g3  in                         CAAJ6409.5p ...........................................................................................................................................................................................ATACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGT
  5   1   3   24   nb Brn2 5g                             CAAJ13727.5p .............................................................................................................................................................................................ACAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGA
  5   1   3   14   nb Brn2 5g3  in                         CAAJ6146.5p ..............................................................................................................................................................................................CAATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAGGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATAT
  5   1   3   14   nb Brn2 5g3  in                        CAAJ13808.5p ...............................................................................................................................................................................................AATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAAGTCCTGACCCTATGGATATGGGCTTGGAC
  5   1   3   14   nb Brn2 5g3  in                        CAAJ22982.5p ................................................................................................................................................................................................ATTGACAGGAGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGNGCAAATCCT
  5   1   3   14   nb Brn2 5g3  in                        CAAJ14202.5p .........................................................................................................................................................................................................AGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAATAGCAAGGGCCAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTG
  5   1   3   14   nb Brn2 5g3  in                        CAAJ24010.5p .........................................................................................................................................................................................................AGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGT
  5   1   0       chi Tad5 5x   out                        XZT26499.5p                                                                                                                                                                                                          AGCAGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGGTAAGTGGCCAAGAATGATATACAAAAGGAAAGATTTATAATAAATGCTTTTCTTCATTTTCAGTTATTCATTTATTTTTCAATTATTACTGCATTTTTAACTTTTTTAACAGTAACTGGTCGAGGAGCCATTCTTCTCTTAGATTATGTGTCTCTAAATATTTCTCTGCTGGGTGAAATTCAATGTAATTATTGCTGTGAGAATATACTGTAAGTTGTCAGAAAGAAACAGAAATATATGCTGTTCCACCTTTTTACTTATTTTATTGTTATAAGGTCCTATAACACTTTTTTCTGGCTTAACTTTACCTTTACACTGTATCTTTTCTGATATCTCTTATCCGAAAACCAAATGTATTTATATGTATGAAGCACTGTGTAGTATTTCTAGNTATAAATCAGACACAAATAGGAAAAGTA
  5   1   3   14   nb Brn2 5g3  in                        CAAJ13603.5p ............................................................................................................................................................................................................AGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCANATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGC
  5   1   3   14   nb Brn2 5g3  in                        CAAJ17691.5p ............................................................................................................................................................................................................AGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCCTGACCTGTACCCTGC
  5   1   3   14   nb Brn2 5g3  in                        CAAJ23471.5p ............................................................................................................................................................................................................AGCATCAGGACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGNAGTCTGCTATGATTTGCANGGAG
  5   1   3   14   nb Brn2 5g3  in                        CAAJ11168.5p ....................................................................................................................................................................................................................GACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAA
  5   1   3   14   nb Brn2 5g3  in                        CAAJ18158.5p ....................................................................................................................................................................................................................GACCACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTTCTGACCCTATGGATATGGGCTTGGACAAGGC
  5   1   3   24   nb Brn2 5g   ?                         CAAJ12972.5p .......................................................................................................................................................................................................................CACATCCACCTGAATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCTTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGA
  5   1   3   15   nb Brn2 5g3  in                        CAAJ18303.5p ...................................................................................................................................................................................................................................ATAACAGCAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAGGCGGAGTCTGCTATGATTG
  5   1   3   14   nb Brn2 5g3  in                        CAAJ19917.5p ...........................................................................................................................................................................................................................................CAAGAGAGTCCGGACAATCAGGACCAAGGACAGCGGCCTTCGCCTGCGCAAAGCCTGGGGGAATCATGACCAGAGAGGATCCCCCTGATTCTACCCCAGAGGAGAGCAAACTTCCCTTGGAGTTCCAGAGCCCATTACTGGAGAAACGGAGAAGACCTAAAGTTCATCCTTCAGCACCTGCACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAAGGAGCTGAACAGCTGCTGTTGGATGCAGTGCCCTT
  5   1   2       add Brn2      in                        CAAJ11942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                CACCACTGCCTAAGGACTATGCCTTTACATTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCTTGCAAAGCTGGAGCACATGGAGTGGGTAATGTATCAGTGTTAGTTATACACTGCACTCAAGCATAATGTATACAAAGCACACACTGTGGTGTCCGACCTGCCTTTATTGCAGTCTGGTCTGAGTTCAGGAAGTAAGTCACACATTCAATGAAAATTGAGGGGCTGCTCCTAGCATACACTACTATGAACCTCTCTTAAATATGTCACTCATTCAGATCATGTTATCCATTGGCTAAGAATAGAGAATGCAAGTTACATATTGAGGTTGTGGTCAAACACAGTAGTACTGTTTTCTGAGTTCAAATCAGAGTTGGGAAACCTGCTTCCCTCCAGATGTTGTTGCTACAACTCCCAGCACTCCTGCCAGTGGGAGGGAGTTGCAGTTAAAGGGGATTTCCACTTACACACCTACACATTTTTAGCTTAATGAAAAAAACAGTATTCTCAGCAATTCCAAATTACAAGTTATTTGTAATAGGGGTAGTTGACCTTTAAGGTAACTTTTAGTATGTTGTATTGCAGAATTCTAAAAAAATTAGTAATTTTTCAGTTGGTCTTAATTTCTACAGTTGTTTTATTTATTGAATATTACATTA
  5   1   3        nb Brn2      in                        CAAJ15815.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTGACCCCAATGACCCAGCTTGCCAGGAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGNGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATC
  5   1   3        nb Brn2      in                        CAAJ13778.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGATCTTGTTCGATCCACAGACCAGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGCATTTTTGCTCCTG
  5   1   2       ext Brn2      in                        CAAJ13408.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCG
  5   1   2       ext Brn2      in                        CAAJ15944.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGTCCCTGAGCTTTTTGCCATTATACGGCAGTGGGTTCCTCAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGCATTTTTGCTCCTGTGTCCAAAATCAGCAAAAGCCCCTGATCAGCCACC
  5   1   2       ext Brn2      in                        CAAJ18830.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGTTCAACACAAAATCGATATTATTGGCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGNGACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGGCATTTTTGCTCCTGTGTCCAAAATCAGCAAAAGCCCCTGATCAGCCACCATCCTCAG
  5   1   3        nb Brn2                                CAAJ23981.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGTGAGATCCTAAAGAGGGGCTGTCATGTAAACGATAGAGATGGATTGACAGATATGACCTTACTACATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATT
  5   1   2       add In63                            IMAGE:8962172.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCAGCTTTATTTTTTGCTTAAATTTACAAATTAAAAATCTCCGAAGGATGAAGATATGACCTTACTACATTATGCTTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTATGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACTCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGCATCCGATATTTTTATTTGTCCTCCTAAACAGGGCATTTTTGCTCCTGTGTCCAAATCAGCAAAGCCCCTGATCAGCCACATCTCAGTCACCTCCACTCAGACTCCCGTGTGAACTCTCCGAGTCCTGGAAGGAAGAGGAAAGAAGCCAACACAAAATCGTGATGTGGGAGCCTGGCCTAG
  5   1   3        nb Brn2      in                        CAAJ19988.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATTATGCCTGCAAAGCTGGAGCACATGGAGTGGGTGACCCTGCAGCTGCTGTCAGACTGACCAATCAGCTCCTGCTGCTGGGAGCAGACATTACCCTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGCATTTTTGCTCCTGTGTCCAAAATCAGCAAAGCCCCTGATCAGCCACCATCCTCAGTCACCTCCACTCCAAGGACTCCCCGTGTGGACTTCTCCCGAGTCACTGGGAAGGGGAGGA
  5   1   3        nb Brn2      in                        CAAJ20329.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGCGCAGTCGCTGGACCAATATGAACGCTCTGCATTATGCTGCCTATTTCGATGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGCATTTTTGCTCCTGTGTCCAAAATCAGCAAAGCCCCTGATCAGCCACCATCCTCAGTCACCTCCACTCCAAGGACTCCCCGTGTGGACTTCTCCCGAGTCACTGGG
  5   1   2       ext Brn2      in                          CAAJ576.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTATTTCGACTGTTCCAGAACTTCTTCGCACTCTGTTAAAAGCATCAAAGCCCAAAGTGCTGAATTCCACCTGCAATGATTTTAACCATGGAACTGCTCTGCACATTGCTGCCTCCAATCTCTGTCTCGGAGCTGTGAAATGTCTGCTTGAACATGGGGCAAATCCTTCTGTTAGAAATAGCAAGGGCCAAGTACCAGCTGACGTAGTTCCTGACCCTATGGATATGGGCTTGGACAAGGCGGAGTCTGCTATGATTGCCAAGGAGCTGAAACAGCTGCTGTTGGATGCAGTGCCCTTGACCTGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGCATTTTTGCTCCTGTGTCCAAAATCAGCAAAGCCCCTGATCAGCCACCATCCTCAGTCACCTCCACTCCAAGGACTCCCCGTGTGGACTTCTCCCGAGTCACTGGGAAGGGGAGGAAGGAA
  5   1   2       ext Brn2      in                        CAAJ20612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTAACCTGCCCAAGGTGACATTACCAAACTACGATAACATCCCTGGCAACCTAATGTTGGCATCTCTGGGAATGAAATTGGGCGACAGAATACTGTTGGATGCTGAAAAGGCAGGCACCCTCCGTTTCTGTGGAACCACTGAATTTGCCAGTGGACAGTGGGTTGGAGTGGAGCTGGATGAACCAGAGGGCAAAAATGATGGCAGTGTAGGGGGCATCCGATATTTTATTTGTCCCCCTAAACAGGGCATTTTTGCTCCTGTGTCCAAAATCAGCAAAGCCCCTGATCAGCCACCATCCTCAGTCACCTCCACTCCAAGGACTCCCCGTGTGGACTTCTCCCGAGTCACTGGGAAGGGGAGGAAGGAAAAGAAAGCCACACACAAAAAATCGTTGAGTGTGGGGAGCCTGGACAAAGAGGGCCTAAAGATTGACATTGGGGACCAAGTTCTCGTGGCTGGCCAGAAACAGGGATTTGTGAGATTTTATGGAAAAACTGATTTTGCCCCAGGGTACTGGTTTGGCATTGAACTGGAGAAACCAACTGGAAAACACGATGGCTCAGTTTTTGGTGTTCGATATTTTACTTGCTCCCCAAAACATGGAGTATTTGCACCCCCATCCCGGGTACAAAGGACGGGTGGACCCAAGGACCCCCAGACAGACAACAATGGTATGAAGAAGGTGCATCAAGTTACTATGACACAGCCAAAGCGTAACTTCACAACAGTGCGGACTCCAAAAGAAATTGCTTC
  5   1   2       ext Brn2      in                        CAAJ16106.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAGGACTCCCCGTGTGGACTTCTCCCGAGTCACTGGGAAGGGGAGGAAGGAAAAGAAAGCCACACACAAAAAATCGTTGAGTGTGGGGAGCCTGGACAAAGAGGGCCTAAAGATTGACATTGGGGACCAAGTTCTCGTGGCTGGCCAGAAACAGGGATTTGTGAGATTTTATGGAAAAACTGATTTTGCCCCAGGGTACTGGTTTGGCATTGAACTGGAGAAACCAACTGGAAAACACGATGGCTCAGTTTTTGGTGTTCGATATTTTACTTGCTCCCCAAAACATGGAGTATTTGCACCCCCATCCCGGGTACAAAGGACGGGTGGACCCAAGGACCCCCAGACAGACAACAATGGTATGAAGAAGGTGCATCAAGTTACTATGACACAGCCAAAGCGTAACTTCACAACAGTGCGGACTCCAAAAGAAATTGCTTCAGAAAACTCCATCTCCAGGTTACTATTCTGTTGCTGGTTTCCGTGGCTCCTCCGTGCTGAGATGCAGTCTTAGAAACCTGTGTTCCTTTGCCACCTGTGTGTTGGGTCACACAATGATGCGCCCTTCTTTCTATGTATGCTGTCCTCTGGACCCTCCCCAGTGCCTTCTCCACATCCTCCTGCCTGTCACCTCTGATTTCTGCACCCACTGGAAGAAGGTGACAGGGGAGACTATCAACCTGCGCAAGATTATGCCAGAAGGTGTGTGAGTGGATCTGAGCTCTCTCTGTTCCCAACACCAGTCATTCCACAGAACATTCCAGACTGGCTCAATAAATTGCCCTACCCCCA
  3   1   2       ext Brn2 5g3  in                        CAAJ18084.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGATGCAGTCTTAGAAACCTGTGTTCTTTTGTCACCTGTGTGTTGGTCACACAATGATGCGCCCTTCTTTCTATGTATGCTGTCCTCTGGACCCTCCCCAGTGCCTTCTCCACATCCTCCTGCCTGTCACCTCTGATTTCTGCACCCACTGGAAGAAGGTGACAGGGGAGACTATCAACCTGCGCAAGATTATGCCAGAAGGTGTGTGAGTGGATCTGAGCTCTCTCTGTTCCCAACACCAGTCATTCCACAGAACATTCCAGACTGGCTCAATAAATTGCCCTACCCCCAATGCCAAATTACTGAAGCTTCTCTCACTCAAAGTGAACCCTCCCTCTTTACCATAAGGTAAAACAAAAATTGAGAATAATTGAAAGCTCCCAATAGATTCCCTGTTGTTGGGCAAAGAAAAAATTCTTGACATTGCATGTAGAGTTTTAGATTTTCTGTGCCCTGCAGTGTGGGATAGGTTTCCCTATTGGTAAGCAGTGATTATCTAGTATTAACATTTTACAGTTTAGAAACATCTTCCTCTGTATGGAGCAGTCTCATTTGCAGATGAAGGACAGTTTATTATTAGCGATCAATTCCAGCACTTTCTTTTATAGGGCAACACTCTTAATTTGGTTTACATCCCACCAAATAAAAGATGAATGGATTTATCTAAAGGGACATTTTCTGCCAAAATTAGCATTGCTGTAAGTTCTGGTGGGGTGTTTATCACTTGTGATTCCAGAATACTATACCATTTTACTAGTTAAAAGAGATGTTTTTATGTGTATTTTTTTTATTTGCTAACAGTGTCCATTTTAGC
  5   1   2       ext Brn2      in                        CAAJ24229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATTATCTAGTATTAACATTTTACAGTTTAGAAACATCTTCCTCTGTATGGAGCAGTCTCATTTGCAGATGAAGGACAGTTTATTATTAGCGGTCAATTCCAGCACTTTCTTTTATAGGGCAACACTCTTAATTTGGTTTACATCCCACCAAATAAAAGATGAATGGATTTATCTAAAGGGACATTTTCTGCCAAAATTAGCATTGCTGTAAGTTCTGGTGGGGTGTTTATCACTTGTGATTCCAGAATACTATACCATTTTGCTAGTTAAAAGAGATGTTTTTATGTGTATTTTTTTTATTTGCTAACAGTGTCCATTTTATTTTATGCATTAGATGTTTTGCCTGAAAGATGAGGTTATTTGGGTAGAGGTAAAGAACATCGGTCTATATAAAATTCAGCAAATTTGCATTAAGGCCAACAAGACCTGGATAAAAAGAAGTAGGGTGGGCACATAATCATGGCTGCATCCAAAATACAAAAATGTTTAGCCCCTGGAGTTTGGGGCCTCACGATGGAGAAATCCCACAGTTGATTCTACCTTCATAAACTAAGCTAAGCTTGCTTGCGTGAGGTTTTCTTTTTATTATTTGGGAAATCACCCAAAATGAGATCTAGTTGCTGTCTCCTGAGGAAGGCATACAATCATCATTAGGATGGCTCATTTGTTTCAGATGGATCTTATGTAACAAATGAGCATGGCCTTTCTAATTGCTGCATTTGTCCTGCATGAATTATAAAACAACAGCAGATTTAACTTACCAGATATGCATAAAGGCATTCCTACTAATTATTAATTATGCTAAGACTGTACCCAAGGGTGAAAGTAAACTTATTTACAAATGGGGACTGAACATACGGCAATAGATATACAGGCCATT
  5   1   3        nb Brn3                                  CAAK681.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTGAGGTTTTCTTTTTATTATTTGGGAAATCACCCAAAATGAGATCTAGTTGCTGTCTCCTGAGGAAGGCATACAATCATCATTAGGATGGCTCATTTGTTTCAGATGGATCTTATGTAACAAATGAGCATGGCCTTTCTAATTGCTGCATCTGTCCTGCATGAATTATAAAACAACAGCAGATTTAACTTACCAGATATGCATAAAGGCATTCCTACTAATTATTAATTATGCTAAGACTGTACCCAAGGGTGAAAGTAAACTTATTTACAAATGGGAACTGAACATACGGCATTAGATATACAGGCCATTTAGAATATCGTAGCGAGTTATCTTGTAATGCTCTCGAGATGAGCACGTATTCATAGCGACAGATAATGACAAATATCTGTCATTAAAGCAACTACATTTCCAAAAATAAGTTCTTGTCCAACCCACTTTACCAAAAGTTGGAGCTTTTGTGCTACACACACAGTACAAAATATTAATCCACCTGCAAGTCCTATAAGATGTTATAAGCTACAGGGATCCATCACACTGGCTGTAGGAGAGATGAAAAGGACATTTTTTATCCACTTGCAGTATCTTATATGGACTAACATATGCAGCTTCCTCAGAGAAAGCTTGAATGAATAGAAGAGCTGATAGGTTTTACACGTGTATTGGACAGGATCTGTAGGAGCGCTGTTCTAATGAGCTCTACTGTATCTATTTTAATGCCCCTGTAATTATTTGCGATGAGGGCTA
  5   1   2       ext Brn3                                 CAAK5473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAAATGAGATCTAGTTGCTGTCTCCTGAGGAAGGCATACAATCATCATTAGGATGGCTCATTTGTTTCAGATGGATCTTATGTAACAAATGAGCATGGCCTTTCTAATTGCTGCATCTGTCCTGCATGAATTATAAAACAACAGCAGATTTAACTTACCAGATATGCATAAAGGCATTCCTACTAATTATTAATTATGCTAAGACTGTACCCAAGGGTGAAAGTAAACTTATTTACAAATGGGAACTGAACATACGGCATTAGATATACAGGCCATTTAGAATATCGTAGCGAGTTATCTTGTAATGCTCTCGAGATGAGCACGTATTCATAGCGACAGATAATGACAAATATCTGTCATTAAAGCAACTACATTTCCAAAAATAAGTTCTTGTCCAACCCACTTTACCAAAAGTTGGAGCTTTTGTGCTACACACACAGTACAAAATATTAATCCACCTGCAAGTCCTATAAGATGTTATAAGCTACAGGGATCCATCACACTGGCTGTAGGAGAGATGAAAAGGACATTTTTTATCCACTTGCAGTATCTTATATGGACTAACATATGCAGCTTCCTCAGAGAAAGCTTGAATGAATAGAAGAGCTGATAGGTTTTACACGTGTATTGGACAGGATCTGTAGGAGCGCTGTTCTAATGAGCTCTACTGTATCTATTTTAATGCCCCTGTAATTATTTGCGATGAGGGCTACGCCACCTCGCGTAGCTTGTTATTTACAGTAAAGGTTCCCTATAAATGTGCTGAAAAATGNGCATGA
  5   1   2       add Brn3      in                        CAAK12203.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCTTTCTAATTGCTGCATCTGTCCGGCATGAATTATAAAACAACAGCAGGTTTCACTTACCAGATATGCATAAAGGCATTCCTACTAATTATTAATTATGCTAAGACTGTACCCAAGGGTGAAAGTAAACTTATTTACAAATGGGAACTGAACATACGGCATTAGATATACAGGCCATTTAGAATATCGTAGAGAGTTATCTTGTAATGCTCTCGAGATGAGCACGTATTCATAGCGACAGATAATGACAGATATCTGTCATTAAAGCAACTACATTTCCAAAAATAAGTTCTTGTCCAACCCACTTTACCAAAAGTTGGAGCTTTTGTGCTACACACACAGTACAAAATATTAATCCACCTGCAAGTCCTATAAGATGTTATAAGCTACAGGGATCCATCACACTGGCTGTAGGAGAGATGAAAAGGACATTTTTTATCCACTTGCAGTATCTTATATGGACTAACATATGCAGCTTCCTCAGAGAAAGCTTGAATGAATAGAAGAGCTGATAGGTTTTACACGTATATTGGACAGGATCTGTAGGAGCGCTGTTCTAATGAGCTCTACTGTATCTATTTTAATGCCCCTGTAATTATTTGCGATGAGGGCTACGCCACCTCGCGTAGCTTGTTATTTACAGTAAAGGTTCCCTATAAATGTGCTGAAAAATGGGCATGATTTAAAAAGTTGATGGAAAATGTATATTTGTTCCATTATCTTTTTAGCCCTAGAATGATGGTCCACTGTTAAAAAAAATCATAGCATGAAAATAATATTTAAATATGTGTTAATTAATCTACCCACATTTCCATTCTGACCATCATCTTACATTATAGGCTGAAGGATTGTGACATTAAGAATATATATATGTAAATCTGGTAATTTAGGATTTAGCAGATTAATCCCTTC
  5   1   2       ext Brn2      in                        CAAJ23394.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCACACTGGCTGTAGGAGAGATGAAAAGGACATTTTTTATCCACTTGCAGTATCTTATATGGACTAACATATGCAGCTTCCTCAGAGAAAGCTTGAATGAATAGAAGAGCTGATAGGTTTTACACGTGTATTGGACAGGATCTGTAGGAGCGCTGTTCTAATGAGCTCTACTGTATCTATTTTAATGCCCCTGTAATTATTTGCGATGAGGGCTACGCCACCTCGCGTAGCTTGTTATTTACAGTAAAGGTTCCCTATAAATGTGCTGAAAAATGGGCATGATTTAAAAAGTTGATGGAAAATGTATATTTGTTCCATTATCTTTTTAGCCCTAGAATGATGGTCCACTGTTAAAAAAAATCATAGCATGAAAATAATATTTAAATATGTGTTAATTAATCTACCCACATTTCCATTCTGACCGTCATCTTACATTATAGGCTGAAGGATTGTGACATTAAGAATATATATGTAAATCTGGTAATTTAGGATTTAGCAGATTAATCCCTTCCTGCAATCTTGCCTGTAGAAAGCCCAGTTCTTAATGCACCCTGGTCTTCCTGTTAAATGCATGATGGTCTGTTTCATTTTCCGTGCAGTATCATCAAGATCATTTTTCCGAAAGAGATATCAGTTGTAATTACTACTGAATACCTTTTATTTCTTGTGGATCAACGAACCATAAAACCCTTGTTGCTGTTGGTTGCTTCCTTTATACGCACATGGAAAGCATATAATTGCTAACTCCTGCATGCTACACATTTGCAATTCCATATTGTCATACCCATAATATGCCATTTCCTGCCCNATAGCATCAGCATGAATGCTTTGATGGTAACCTGCTCTCAGAATCCAACTAGGACCGAGAACATTCACTCTAGAGCATGCA
  5   1   3        nb Brn2      in                        CAAJ12505.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCAGCTTCCTCAGAGAAAGCTTGAATGAATAGAAGAGCTGATAGGTTTTACACGTGTATTGGACAGGATCTGTAGGAGCGCTGTTCTAATGAGCTCTACTGTATCTATTTTAATGCCCCTGTAATTATTTGCGATGAGGGCTACGCCACCTCGCGTAGCTTGTTATTTACAGTAAAGGTTCCCTATAAATGTGCTGAAAAATGGGCATGATTTAAAAAGTTGATGGAAAATGTATATTTGTTCCATTATCTTTTTAGCCCTAGAATGATGGTCCACTGTTAAAAAAAATCATAGCATGAAAATAATATTTAAATATGTGTTAATTAATCTACCCACATTTCCATTCTGACCGTCATCTTACATTATAGGCTGAAGGATTGTGACATTAAGAATATATATGTAAATCTGGTAATTTAGGATTTAGCAGATTAATCCCTTCCTGCAATCTTGCCTGTAGAAAGCCCAGTTCTTAATGCACCCTGGTCTTCCTGTTAAATGCATGATGGTCTGTTTCATTTTCCGTGCAGTATCATCAAGATCATTTTTCCGAAAGAGATATCAGTTGTAATTACTACTGAATACCTTTTATTTCTTGTGGATCAACGAACCATAAAACCCTTGTTGCTGTTGGTTGCTTCCTTTATACGCACATGGAAAGCATATAATTGCTAACTCCTGCATGCTACACATTTGCAATTCCATATTGTCATACCCATAATATGCCATTTCCTGCCCATTAGCATCAGCATGAATGCTTTGATGGTAACCTGCTCTCAGAATCCAACTAGGACCGAGAACATTCACTCTAGAGCATGCAGGAGCCAGCAATAAATAGTCAATACCACATCTATAGCAATTTTATATCATTCACATAAAATTTATGTGGCTGCTCTGTTGG
  5   1   3        nb Brn3      in                         CAAK6403.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGTTCTAATGAGCTCTACTGTATCTATTTTAATGCCCCTGTAATTATTTGCGATGAGGGCTACGCCACCTCGCGTAGCTTGTTATTTACAGTAAAGGTTCCCTATAAATGTGCTGAAAAATGGGCATGATTTAAAAAGTTGATGGAAAATGTATATTTGTTCCATTATCTTTTTAGCCCTAGAATGATGGTCCACTGTTAAAAAAAATCATAGCATGAAAATAATATTTAAATATGTGTTAATTAATCTACCCACATTTCCATTCTGACCGTCATCTTACATTATAGGCTGAAGGATTGTGACATTAAGAATATATATGTAAATCTGGTAATTTAGGATTTAGCAGATTAATCCCTTCCTGCAATCTTGCCTGTAGAAAGCCCAGTTCTTAATGCACCCTGGTCTTCCTGTTAAATGCATGATGGTCTGTTTCATTTTCCGTGCAGTATCATCAAGATCATTTTTCCGAAAGAGATATCAGTTGTAATTACTACTGAATACCTTTTATTTCTTGTGGATCAACGAACCATAAAACCCTTGTTGCTGTTGGTTGCTTCCTTTATACGCACATGGAAAGCATATAATTGCTAACTCCTGCATGCTACACATTTGCAATTCCATATTGTCATACCCATAATATGCCATTTCCTGCCCATTAGCATCAGCATGAATGCTTTGATGGTAACCTGCTCTCAGAATCCAACTAGGACCGAGAACATTCACTCTAGAGCATGCAGGAGCCAGCAATAATAAGTCAATACCACATCTATAGCAATTTTATATCATTCACATTAAATTTATGTGGCTGCTCTGTTGNGAGATTTCACC
  5  -1   3        nb Brn2      out                       CAAJ18351.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTGGATCAACGAACCATAAAACCCTTGTTGCTGTTGGTTGCTCCCTTTATACGCACATGGAAAGCATATAATTGCTAACTCCTGCATGCTACACATTTGCAATTCCATATTGTCATACCCATAATATGCCATTTCCTGCCCATTAGCATCAGCATGAATGCTTTGATGGTAACCTGCTCTCAGAATCCAACTAGGACCGAGAACATTCACTCTAGAGCATGCAGGAGCCAGCAATAATAAGTCAATACCACATCTATAGCAATTTTATATCATTCACATTAAATTTATGTGGCTGCTCTGTTGGGAGATTTCACCTTTCCCATTAGGACATTTTCACTGGTGGGTAGGTGGTCCAATGTATTGTGTTCTTATGTGAGAATATACAGATGTAAAAGACCTTATTTGTCTCCCTGGCCACTGCATGCATCGCCCTACTCTGTACATAGCATGGGGTATTCATGTACTGTGAGTAATAAGTATCTGTATATTTTGCAAAGGTGCCAGGCTTCCTCCCCAGCAGGGGTTTATCTACGGATTCATAGTGCAGCCAGTGGCAGGTATAAAGGACTGTAAACTTAGTGCATTTCCACAGCGAGCGGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAAAAAAAAAAAAAGGGCGCCGCTCGGGATCTAGAA
  3   1   2       ext Brn2      in                        CAAJ16106.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCCATTTGCAATTCCATATTGTCATACCCATAATATGCCATTTCCTGCCCATTAGCATCAGCATGAATGCTTTGATGGTAACCTGCTCTCAGAATCCAACTAGGACCGAGAACATTCACTCTAGAGCATGCAGGAGCCAGCAATAATAAGTCAATACCACATCTATAGCAATTTTATATCATTCACATTAAATTTATGTGGCTGCTCTGTTGGGAGATTTCACCTTTCCCATTAGGACATTTTCACTGGTGGGTAGGTGGTCCAATGTATTGTGTTCTTATGTGAGAATATACAGATGTAAAAGACCTTATTTGTCTCCCTGGCCACTGCATGCATCGCCCTACTCTGTACATAGCATGGGGTATTCATGTACTGTGAGTAATAAGTATCTGTATATTTTGCAAAGGTGCCAGGCTTCCTCCCCAGCAGGGGTTTATCTACGGATTCATAGTGCAGCCAGTGGCAGGTATAAAGGACTGTAAACTTAGTGCATTTCCACAGCGAGCGGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAACCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATG
  5   1   2       ext Brn2      in                         CAAJ6503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTAGCATCAGCATGAATGCTTTGATGGTAACCTGCTCTCAGAATCCAACTAGGACCGAGAACATTCACTCTAGAGCATGCAGGAGCCAGCAATAATAAGTCAATACCACATCTATAGCAATTTTATATCATTCACATTAAATTTATGTGGCTGCTCTGTTGGGAGATTTCACCTTTCCCATTAGGACATTTTCACTGGTGGGTAGGTGGTCCAATGTATTGTGTTCTTATGTGAGAATATACAGATGTAAAAGACCTTATTTGTCTCCCTGGCCACTGCATGCATCGCCCTACTCTGTACATAGCATGGGGTATTCATGTACTGTGAGTAATAAGTATCTGTATATTTTGCAAAGGTGCCAGGCTTCCTCCCCAGCAGGGGTTTATCTACGGATTCATAGTGCAGCCAGTGGCAGGTATAAAGGACTGTAAACTTAGTGCATTTCCACAGCGAGCGGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAACCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATGAGGAAAGTAAAAATTTTGCACATGAGCACAGCCCAGGGCAGCAGCAAGAA
  5   1   3        nb Tad5                                 XZT38493.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCTATAGCAATTTTATATCATTCACATTAAATTTATGTGGCTGCTCTGTTGGGAGATTTCACCTTTCCCATTAGGACATTTTCACTGGTGGGTAGGTGGTCCAATGTATTGTGTTCTTATGTGAGAATATACAGATGTAAAAGACCTTATTTGTCTCCCTGGCCACTGCATGCATCGCCCTACTCTGTACATAGCATGGGGTATTCATGTACTGTGAGTAATAAGTATCTGTATATTTTGCAAAGGTGCCAGGCTTCCTCCCCAGCAGGGGTTTATCTACGGATTCATAGTGCAGCCAGTGGCAGGTATAAAGGACTGTAAACTTAGTGCATTTCCACAGCGAGCAGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAGCCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATGAGAAAAG
  5   1   3        nb Brn3      in                         CAAK4307.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTCACCTTTCCCATTAGGACATTTTCACTGGTGGGTAGGTGGTCCAATGTATTGTGTTCTTATGTGAGAATATACAGATGTAAAAGACCTTATTTGTCTCCCTGGCCACTGCATGCATCGCCCTACTCTGTACATAGCATGGGGTATTCATGTACTGTGAGTAATAAGTATCTGTATATTTTGCAAAGGTGCCAGGCTTCCTCCCCAGCAGGGGTTTATCTACGGATTCATAGTGCAGCCAGTGGCAGGTATAAAGGACTGTAAACTTAGTGCATTTCCACAGCGAGCGGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAACCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATGAGAAAAGTAAAAATTTTGCACATGAGCACAGCCCAGGGCAGCAGCAAGAAAGATGGTGGTGCTGCGCTCATTATAA
  5   1   3        nb Brn2      in                        CAAJ13122.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATGGGGTATTCATGTACTGTGAGTAATAAGTATCTGTATATTTTGCAAAGGTGCCAGGCTTCCTCCCCAGCAGGGGTTTATCTACGGATTCATAGTGCAGCCAGTGGCAGGTATAAAGGACTGTAAACTTAGTGCATTTCCACAGCGAGCGGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAACCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATGAGAAAAGTAAAAATTTTGCACATGAGCACAGCCCAGGGCAGCAGCAAGAAAGATGGTGGTGCTGCGCTCATTATAAAAGAATCCCGAACCAGTGCTTTTTTTCAGCAAAGAGGAGTGCAGGCCCAGAGCCTGAGGTAAGCAATTATAATAGCTGGGGGAAGGGTGCCTAAGAAATTGCCACCCCACAGTGATGCTTTCATTCTACTTTAACAGATTAATTGTGCTGGATAAAAACTTAATGGCAATATTGTACATTTTACCAAACAGTTACTATTTATGGTCAAGGTGCCATAACCCATAGCACCCA
  5   1   3        nb Brn3      in                         CAAK6837.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCGAGCGGACACAACACACATACTCTGTGAAGAGTGCATATTTATTAATTTGCACACGCAAGGATAGCATGTATTCCTGTGTATCATGGAATGTGGTGTATAAACATTATAATGGAAGGAGAGGGATGTAAATGTATTGTCCTGTGTTCCCATATAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAACCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATGAGAAAAGTAAAAATTTTGCACATGAGCACAGCCCAGGGCAGCAGCAAGAAAGATGGTGGTGCTGCGCTCATTATAAAAGAATCCCGAACCAGTGCTTTTTTTCAGCAAAGAGGAGTGCAGGCCCAGAGCCTGAGGTAAGCAATTATAATAGCTGGGGGAAGGGTGCCTAGGAAATTGCCACCCCACAGTGATGCTTTCATTCTACTTTAACAGATTAATTGTGCTGGATAAAAACTTAATGGCAATATTGTACATTTTACCAAACAGTTACTATTTATGGTCAAGGTGCCAtaacccatagcaaccaataagatgtctgcttttaaatgggtgaccagtaaatgctacccgctaaccagggtcagactgngccgccgagacaccgagaaaaatcccggtgggccccagcagcccagacccgacccttgccggtgctcccccTGTCCGACTGTTCCACCCCTGACGC
  5   1   3        nb Brn3      in                         CAAK4335.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAAGGAATAATTATGTGAAAGTTAGGACACCCTTGCCAAGCTATATTTTTAATCAATTTATATTTTAAAGGAAAATAAAAAGCTTAACCACTGAACGGGTTTCAATATGATAGGCCCCAACCGCATAAAATATAATCGCTCACCATAAAGACCCCTAGGCCAGTGCTTTCTTGTGGCTGCTCTGAGCTGGGTGTATGATTAGTAGAGTAGAAGTGAGACTTAGATGAGAAAAGTAAAAATTTTGCACATGAGCACAGCCCAGGGCAGCAGCAAGAAAGATGGTGGTGCTGCGCTCATTATAAAAGAATCCCGAACCAGTGCTTTTTTTCAGCAAAGAGGAGTGCAGGCCCAGAGCCTGAGGTAAGCAATTATAATAGCTGGGGGAAGGGTGCCTAAGAAATTGCCACCCCACAGTGATGCTTTCATTCTACTTTAACAGATTAATTGTGCTGGATAAAAACTTAATGGCAATATTGTACATTTTACCAAACAGTTACTATTTATGGTCAAGGTGCCAtaacccatagcaaccaataagatgtctgcttttaaatgggtgaccagtaaatgctacccgctaaccagggtcagactgggccgccgagacaccgagaaaaatcccggtgggccccagcagcccagacccgacccttgccggtgctccccctgtccgactgttccacccctgacgcgttanatttaTGCAGACTC
  5   1   2       ext Brn4      in                        CAAL20847.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGACTTAGATGAGAAAAGTAAAAATTTTGCACATGAGCACAGCCCAGGGCAGCAGCAAGAAAGATGGTGGTGCTGCGCTCATTATAAAAGAATCCCGAACCAGTGCTTTTTTTCAGCAAAGAGGAGTGCAGGCCCAGAGCCTGAGGTAAGCAATTATAATAGCTGGGGGAAGGGTGCCTAAGAAATTGCCACCCCACAGTGATGCTTTCATTCTACTTTAACAGATTAATTGTGCTGGATAAAAACTTAATGGCAATATTGTACATTTTACCAAACAGTTACTATTTATGGTCAAGGTGCCAtaacccatagcaaccaataagatgtctgcttttaaatgggtgaccagtaaatgctacccgctaaccagggtcagactgggccgccgagacaccgagaaaaatcccggtgggccccagcagcccagacccgacccttgccggtgctccccctgtccgactgttccacccctgacgcgttaaatttatgcagactcggggaggacgttggTGGGGGACCCTGCGG
  5   1   2       add TpA       in                   TTpA044i04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCAGGGCAGCAGCAAGAAAGATGGTGNGTGCTGCGCTCATTATAAAAGAATCCCGAACCAGTGGCTTTTTTTCAGCAAAGAGGAGTGCAGGCCCAGAGCCTGAGGTAAGCAATTATAATAGCTGGGGGAAGGGTGCCTAAGAAATTGCCACCCCACAGTGATGCTTTCATTCTACTTTAACAGATTAATTGTGCTGGATAAAAACTTAATGGCAATATTGTACATTTTACCAAACAGTTACTATTTATGGTCAAGGTGCCAtaacccatagcaaccaataagatgtctgcttttaaatgggtgaccagtaaatgctacccgctaaccagggtcagactgggccgccgagacaccgagaaaaatcccggtgggccccagcagcccagacccgacccttgccggtgctccccctgtccgactgttccacccctgacgcgttaaatttaTGCAGACTCGGGGAGGACGTTGGTGGGGGACCCTGCGGGGGGTTAGGGAGGCCCCTGGGGGGTGTTATGGGACATGGCCGGCGGGGGCACCTGCAGTGCCCCTGGGGCGGGAGACCTGGTGGGCCCTGCACCCCCCAGTCCGACCCTATTGCTAACTGGTTACTATAGGTGATAAGAACTGTAGGAAACTTTGCTCCTTAAATTGCATAACCTGCCGCCCACCCCTGTTCTTCCTAACTCTACTTGTTTGATTCAATACTTCGGGGCATATTCATTACAGTGTTTAAGCCAACATCACCNGGTAATTTTGGCTTACACGCTATAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGTNGCTGTGTATTTCCCCACTAGGCACAGGACAACACTATCTGCAATATGCAATANACTGTTTAACAGACAGC
  5   1   2       ext Brn2      in                        CAAJ15051.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGCAATATTGTACATTTTACCAAACAGTTACTATTTATGGTCAAGGTGCCAtaacccatagcaaccaataagatgtctgcttttaaatgggtgaccagtaaatgctacccgctaaccagggtcagactgggccgccgagacaccgagaaaaatcccggtgggccccggcggcccagacccgacccttgccggtgctccccctgtccgactgttccacccctgacgcgttaaatttatgcagactcggggaggacgttggtgggggaccctgcggggggTTAGGGAGGCCCCTGGGGGGTGTTATGGGACATGGCCGGCGGGGGCACCTGCAGTGCCCCTGGGGCGGGAGACCTGGTGGGCCCTGCACCCCCCAGTCCGACCCTATTGCTAACTGGTTACTATGGGTGATAAGAACTGTAGGAAACTTTGCTCCTTAAATTGCATAACCTGCCGCCCACCCCTGTTCTTCCTAACTCTACTTGTTTGATTCAATACTTCGGGGcatattcattacagtgtttaagccaacatcaccaatgatgttgcccatagcaaccaatgagcaattagaatttaatggtcacctacaaggtagaaaacaaaagcaaagatctgtttggttgctaagggcaaCATCACCGGTAATTTTGGCTTATACGCTATAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGTGCTGTGTATTTCCCCACTAGGCACAGGACAACACTATCTGCAATATGCAATAAACTGTTTAAACAGACAGCAAATGTAGCCAAATATACGGCACAAAAAGCTTATCCTTAAGCTTCCTTTGACCAGTAATATACAGACAAGTATGGAGAAATTTATATATAAATGCATT
  5   1   2       add TpA                            TTpA039n03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCTGGGGTAAATGCTACCTGCTAACCAGGGTCAGACTGGGCCGCCGAGACACCGAGAAAAATCCCGGTgggccccagcagcccagacccgacccttgccggtgctccccctgtccgactgttccacccctgacgcgttaaatttatgcaaactcggggaggacgttggtgggggaccctgcggggggTTAGGGAGGCCCCTGGGGGGTGTTATGGGACATGGCCGGCGGGGGCACCTGCAGTGCCCCTGGGGCGGGAGACCTGGTGGGCCCTGCACCCCCCAGTCCGACCCTATTGCTAACTGGTTACTATAGGTGATAAGAACTGTAGGAAACTTTGCTCCTTAAATTGCATAACCTGCCGCCCACCCCTGTTCTTCCTAACTCTACTTGTTTGATTCAATACTTCGGGGCATATTCATTACAGTGTTTAAGCCAACATCACCGGTAATTTTGGCTTACACGCTATAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGAGCTGTGTATTTCCCCACTAGGCACAGGACAACACTAGCTGCAATATGCAATANACTGTTTAAACAGACAGCANATGTAGCCAAATATACGGCACAAAAAGCTTATCCTTAAGCTTCC
  5   1   3        nb Brn2      in                        CAAJ16534.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCCCTGGGGGGTGTTATGGGACATGGCCGGCGGGGGCACCTGCAGTGCCCCTGGGGCGGGAGACCTGGTGGGCCCTGCACCCCCCAGTCCGACCCTATTGCTAACTGGTTACTATAGGTGATAAGAACTGTAGGAAACTTTGCTCCTTAAATTGCATAACCTGCCGCCCACCCCTGTTCTTCCTAACTCTACTTGTTTGATTCAATACTTCGGGGcatattcattacagtgtttaagccaacatcaccaatgatgttgcccatagcaaccaatgagcaattagaatttaatggtcacctacaaggtagaaaacaaaagcaaagatctgtttggttgctaggggcaaCATCACCGGTAATTTTGGCTTACACGCTATAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGTGCTGTGTATTTCCCCACTAGGCACAGGACAACACTATCTGCAATATGCAATAAACTGTTTAAACAGACAGCAAATGTAGCCAAATATACGGCACAAAAAGCTTATCCTTAAGCTTCCTTTGACCAGTAATATACAGACAAGTATGGAGAAATTTATATATAAATGCATTTAACGGTGTATGATCCAACAGATGGGTATAAAATATTACTGCCTATTGAGGTACATTTTTATTTTCTTATTTGCAACCCCCTCTCCAGCTATACCAGAAGCAAATATTTCATACTAAATTATTTGGTACTTGATACTGGGAATCAAGCTGTTGCCCAATAAATATTTCAGCCCAACAAACAATTGTATATGAGAACTGCAATAATCCAATAGTTTCGCTGGTTTTACTTCTNAACATAGAATTTNATTTAAA
  5   1   2       ext Brn2      in                        CAAJ20458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGGACATGGCCGGCGGGGGCACCTGCAGTGCCCCTGGGGCGGGAGACCTGGTGGGCCCTGCACCCCCCAGTCCGACCCTATTGCTAACTGGTTACTATAGGTGATAAGAACTGTAGGAAACTTTGCTCCTTAAATTGCATAACCTGCCGCCCACCCCTGTTCTTCCTAACTCTACTTGTTTGATTCAATACTTCGGGGcatattcattacagtgtttaagccaacatcaccaatgatgttgcccatagcaaccaatgagcaattagaatttaatggtcacctacaaggtagaaaacaaaagcaaagatctgtttggttgctaagggcaaCATCACCGGTAATTTTGGCTTACACGCTATAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGTGCTGTGTATTTCCCCACTAGGCACAGGACAACACTATCTGCAATATGCAATAAACTGTTTAAACAGACAGCAAATGTAGCCAAATATACGGCACAAAAAGCTTATCCTTAAGCTTCCTTTGACCAGTAATATACAGACAAGTATGGAGAAATTTATATATAAATGCATTTAACGGTGTATGATCCAACAGATGGGTATAAAATATTACTGCCTATTGAGGTACATTTTTATTTTCTTATTTGCAACCCCCTCTCCAGCTATACCAGAAGCAAATATTTCATACTAAATTATTTGGTACTTGATACTGGGAATCAAGCTGTTGCCCAATAAATATTTCAGCCCAACAAACAATTGTATATGAGAACTGCAATAATCCAATAGTTTCGCTGGTTTTACTTCTAACATAA
  5   1   3        nb Brn2      in                        CAAJ16366.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGGTGGGCCCTGCACCCCCCAGTCCGACCCTATTGCTAACTGGTTACTATAGGTGATAAGAACTGTAGGAAACTTTGCTCCTTAAATTGCATAACCTGCCGCCCACCCCTGTTCTTCCTAACTCTACTTGTTTGATTCAATACTTCGGGGcatattcattacagtgtttaagccaacatcgccaatgatgttgcccatagcaaccaatgagcaattagaatttaatggtcacctacaaggtagaaaacaaaagcaaagatctgtttggttgctaagggcaaCATCACCGGTAATTTTGGCTTACACGCTGTAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGTGCTGTGTATTTCCCCACTAGGCACAGGACAACACTATCTGCAATATGCAATAAACTGTTTAAACAGACAGCAAATGTAGCCAAATATACGGCACAAAAAGCTTATCCTTAAGCTTCCTTTGACCAGTAATATACAGACAAGTATGGAGAAATTTATATATAAATGCATTTAACGGTGTATGATCCAACAGATGGGTATAAAATATTACTGCCTATTGAGGTACATTTTTATTTTCTTATTTGCAACCCCCTCTCCAGCTATACCAGAAGCAAATATTTCATACTAAATTATTTGGTACTTGATACTGGGAATCAAGCTGTTGCCCAATAAATATTTCAGCCCAACAAACAATTGTATATGAGAACTGCAATAATCCAATAGTTTCGCTGGTTTTACTTCTAACATAAGAATTTAATTTAAATTTAAGAAACAACGATCCATGTACACTATAAATTCTAATTTTTAAAATTAGACTTGTACTTCTAAACAAACTGGAGCATTGNACAT
  5   1   2       add Brn4      in                        CAAL19154.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTAACTCTACTTGTTTGATTCAATACTTCGGGGCATATTCATTGCAGTGTTTAAGCCAACATCACCGGTGGTTTTGGCTTACACGCTATAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGTGCTGTGTATTTCCCCACTAGGCACAGGACAACACTATCTGCAATATGCAATAAACTGTTTAAACAGACAGCAAATGTAGCCAAATATACGGCACAAAAAGCTTATCCTTAAGCTTCCTTTGACCAGTAATATACAGACAAGTATGGAGAAATTTATATATAAATGCATTTAACGGTGTATGATCCAACAGATGGGTATAAAATATTACTGCCTATTGAGGTACATTTTTATTTTCTTATTTGCAACCCCCTCTCCAGCTATACCAGAAGCAAATATTTCATACTAAATTATTTGGTACTTGATACTGGGAATCAAGCTGTTGCCCAATAAATATTTCAGCCCAACAAACAATTGTATATGAGAACTGCAATAATCCAATAGTTTCGCTGGTTTTACTTCTAACATAAGAATTTAATTTAAATTTAAGAAACAACGATCCATGTACACTATAAATTCTAATTTTTAAAATTAGACTTGTACTTCTAAACAAACTGGAGCATTGGACATAAAATACCTTTTTGCTTGGAAGAGAATCAGATCTGTGTTGTTGTAAAACTACAACTCACATCCCCAGCATTCAACAGCTAGGAGAGTAGCTCAACAGCAGTTGGCAGGCCACCGCTTGGATATATATCTAATGCAGGGCTGTCAACCAACCTCATGTCATGAGGA
  5   1   3        nb Brn2                                CAAJ22995.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTACACGCTATAATATATATGCCCCTACTTGTCTGAGATCTCACCATACTGTGCTGTGTATTTCCCCACTAGGCACAGGACAACACTATCTGCAATATGCAATAAACTGTTTAAACAGACAGCAAATGTAGCCAAATATACGGCACAAAAAGCTTATCCTTAAGCTTCCTTTGACCAGTAATATACAGACAAGTATGGAGAAATTTATATATAAATGCATTTAACGGTGTATGATCCAACAGATGGGTATAAAATATTACTGCCTATTGAGGTACATTTTTATTTTCTTATTTGCAACCCCCTCTCCAGCTATACCAGAAGCAAATATTTCATACTAAATTATTTGGTACTTGATACTGGGAATCAAGCTGTTGCCCAATAAATATTTCAGCCCAACAAACAATTGTATATGAGAACTGCAATAATCCAATAGTTTCGCTGGTTTTACTTCTAACATAAGAATTTAATTTAAATTTAAGAAACAACGATCCATGTACACTATAAATTCTAATTTTTAAAATTAGACTTGTACTTCTAAACAAACTGGAGCATTGGACATAAAATACCTTTTTGCTTGGAAGAGAATCAGATCTGTGTTGTTGTAAAACTACAACTCACATCCCCAGCATTCAACAGCTAGGAAGAGTAGCTCAACAGCAGTTGGCAGGCCACCGCTTGGATATATATCTAATGCAGGGCTGTCAACCAACCTCATGTCATGAGGAAGATAATGATCCAGTCCTGTTTTCTTCTTCTCCACACTAAATTATAATATGAAATAAGGTCTCAAATGCCTGGAATGAATCAGCTCTGCTCATGAATATTTAGAATATCTAGCAGTTATTATGCAGTATAATCATATATATATCTTTTCAGATCAAGACCAGAGTAGTTACTGACAATT
  5   1   2       ext Brn2      in                        CAAJ14663.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTATTTGGTACTTGATACTGGGAATCAAGCTGTTGCCCAATAAATATTTCAGCCCAACAAACAATTGTATATGAGAACTGCAATAATCCAATAGTTTCGCTGGTTTTACTTCTAACATAAGAATTTAATTTAAATTTAAGAAACAACGATCCATGTACACTATAAATTCTAATTTTTAAAATTAGACTTGTACTTCTAAACAAACTGGAGCATTGGACATAAAATACCTTTTTGCTTGGAAGAGAATCAGATCTGTGTTGTTGTAAAACTACAACTCACATCCCCAGCATTCAACAGCTAGGAAGAGTAGCTCAACAGCAGTTGGCAGGCCACCGCTTGGATATATATCTAATGCAGGGCTGTCAACCAACCTCATGTCATGAGGAAGATAATGATCCAGTCCTGTTTTCTTCTTCTCCACACTAAATTATAATATGAAATAAGGTCTCAAATGCCTGGAATGAATCAGCTCTGCTCATGAATATTTAGAATATCTAGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCCTTAATAGAGTACACA
  5   1   3        nb Brn2      in                        CAAJ16056.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATAAGGTCTCAAATGCCTGGAATGAATCAGCTCTGCTCATGAATATTTAGAATATCTAGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGC
  3   1   2       ext Brn2      in                         CAAJ6503.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCCTGAATGAATCAGCTCTGCTCATGAATATTTAGAATATCTAGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGAAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACT
  3   1   2       ext Brn2 5g3  in                        CAAJ19642.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTAGAATATCTAGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCATGGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                         CAAJ6409.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCAGTTATTATGCAGTATATTCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       add TpA       in                    TTpA044i04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCACATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGCGTATAAAGGTATTTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTTTTTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTTTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTTTTACTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Brn2      in                        CAAJ13778.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACT
  3   1   3        nb Brn2      in                        CAAJ16366.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   4      seed Brn2 5g3  in                        CAAJ17228.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAGTTATTATGCAGTATATTCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ16926.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ18158.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGTATTTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCATGGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ13767.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCAGTTATTATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACATTTCAATGAGTATAGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       ext Brn2      in                        CAAJ15051.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGTTATTATGCAGTATAATCATATATATATCTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2      in                        CAAJ16534.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACATTTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ18067.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACATTTCAATGGGAGTATAGGAAAAAAAAAAGCCTGGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       ext Brn2      in                        CAAJ15944.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ13603.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       ext Brn2      in                        CAAJ23394.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTCAATGGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2      in                        CAAJ12505.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTTCT
  3   1   3        nb Brn2 PIPE in                        CAAJ22893.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGAAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       add Brn3      in                        CAAK12203.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGCAGTATAATCATATATATATCTTTCAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGAAATCAGCTTGAATCTGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ13808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGATCAAGACCCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACT
  3   1   3        nb Brn2 5g3  in                        CAAJ14202.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCAAGATCAAGACCAGAGTAGTTACTGACATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGCTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2                                CAAJ23560.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                         CAAJ6270.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGATCAAGACCAGAGTAGTTACTGACAATTTCATGGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACT
  3   1   3        nb Brn2 5g3  in                        CAAJ23471.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGATCAAGACCAGAGTAGTTACTGACATTTTCAATGGAGTATAGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ19917.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCAAGACCAGAGTAGTTACTGACANTTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       ext Brn2      in                        CAAJ20458.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       ext Brn2      in                        CAAJ24229.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACT
  3   1   3        nb Brn2 5g3  in                        CAAJ20501.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGACCAGAGTAGTTACTGACAATTCAATGGAGTATAGGAAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ18303.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAGTAGTTACTGACAATTTCAATGGAGTATAGAAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn3      in                         CAAK4335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAGTAGTTACTGACATTTTCAATGGAGTATAGGAAAAAAAAAGCTGGTAGGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTTTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTNCTG
  3   1   3        nb Brn3      in                         CAAK6403.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ12983.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTGAAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACT
  3   1   3        nb Brn2 5g3  in                        CAAJ15071.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ17492.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn3      in                         CAAK6837.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTTTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       add Brn2 5g3  in                        CAAJ12402.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCAAGACCAGAGTAGTTACTGACAATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGAAATCAGCTTGAATCTGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       add Brn2      in                        CAAJ11942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGTAGTTACTGACATTTCAATGGAGTATAGGAAAAAAAAAGCCTGGTAGAAATCAGCTTGAATCTGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       ext Brn2      in                        CAAJ13408.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATGGGAGTATAGGAAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTGAT
  3   1   2       ext Brn2      in                        CAAJ14663.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ14606.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGAGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                         CAAJ6146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACT
  3   1   3        nb Brn2 5g3  in                          CAAJ739.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2      in                        CAAJ15815.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       ext Brn2      in                        CAAJ18830.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       ext Brn2 5g3  in                        CAAJ20113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATAGGAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATGTGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2      in                        CAAJ16056.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTTTTTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTTCTG
  3   1   3        nb Brn2 5g3  in                        CAAJ22982.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAAAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ17691.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAGCCTGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       add Brn4      in                        CAAL19154.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCTGGTAGGAATCAGCTGAAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ24010.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGTAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2      in                        CAAJ13122.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       ext Brn2      in                        CAAJ20612.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGGAATCAGCTTGAATATGCTTGTGTTTATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn3      in                         CAAK4307.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       ext Brn4      in                        CAAL20847.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTGAT
  3   1   3        nb Brn2 5g3  in                        CAAJ15589.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCACTGGTGTAATTATACCACCTAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       ext Brn2      in                          CAAJ576.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAATTATACCACTAGGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2      in                        CAAJ19988.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTTTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTTCTGG
  3   1   3        nb Brn2 5g3  in                        CAAJ22865.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGGAATTTTTAAAAATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   3        nb Brn2 5g3  in                        CAAJ24011.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGCCTCATTTGGCATTAGCCTAACACTCCATAGGAAATAAATGTGTTTAACTGCTAAAAGAAGTTTAACATTCTAATGAATTGACACATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTCTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTG
  3   1   2       ext TpA  5x3  out                   TTpA011h13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCACCATTCAAGCTGCTATGTAGTAGTACTGTGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTATCCAGAAAATGTACACACAAAGGAATACATCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCACACAGGTAATGAGTATAAAGGTATCTTAAGATATGACCCTTGGTGGGGAGAGGTGATGGTCACTCAATAATTTCTTTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTCTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTATCTACTGAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Brn2      in                        CAAJ20329.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAATCAGACAGAGAAATGTTCCTAACAGACAACTCTTGATAAATCCTTAAATAGAGTACACAGACTAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGCATAGATGTGCAGAGTCCCCATTCAAGCTGCTATGTAGTAGTACTGGGCAATCATTATGTTTTGAAAGTTGTATATGTACTACTGGGCTTTTGTAGTAGTGTTTTCCAGAAAATGTACCCCCAAAGGAATACCTCATTTGTAAAGGTAAATTCACATAACGTGACATGCTAGCCCCCAGGTAATGAGTATAAAGGTTTCTTAAGATATGACCCTTGGTGGGGAGAGGGGATGGTCCCTCAATAATTTTTTTGATACAGCATTACCCAGCTAACTTCCGTATAAACATGAAACGTTACTAGCCTTTCCTGTAACCTTGTGTACAATTATTGTGCTGGTATAAGCCTGTTACACCTAGTTTTACAAGCTCTGTGTACAGGATATGTGGATGTATATCTAATAATAAACAGATTTTTTTTCTGG
  3   1   3        nb Brn2 5g3  in                        CAAJ11168.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAAATAGAGCTGCAAATGGATTATTCCATAGCAGGGACAACTTAATCTAACTGATCTAGATACTACCCTTGCATACTCTGTAAGTATGTCTTTTACTGCAAGGAGAAAAAAGC