Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 96%

 1012153352 Xt7.1-THdA010g07.3.5 - 125 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   3     4     7     9    12    14    12    14    13    15    15    17    15    17    15    17    15    17    16    17    16    17    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    18    18    17    18    16    17    17    17    16    17    16    17    17    17    17    17    16    17    17    17    17    17    18    18    18    18    17    19    18    19    20    20    20    20    20    20    20    20    21    21    21    21    21    21    22    22    22    23    22    23    22    23    22    23    21    23    22    23    22    23    19    23    20    23    19    24    20    23    20    23    19    23    18    21    16    20    19    22    18    22    16    22    15    23    14    22    16    22    17    22    15    21    15    21    14    21    13    21    15    19    13    16    12    15    12    15    12    14    11    14    13    14    13    14    13    14    14    16    14    16    14    16    15    17    15    17    15    16    15    16    16    17    16    17    17    18    18    19    19    19    19    19    19    19    19    19    19    20    19    20    20    21    20    21    21    21    19    20    20    22    22    23    22    23    23    25    24    25    25    26    25    26    25    26    25    26    26    27    24    26    25    25    25    25    24    25    24    25    24    24    24    24    24    24    24    24    22    23    21    22    21    22    21    23    21    23    21    23    21    22    21    22    21    22    20    21    19    20    19    20    19    20    19    20    19    20    15    17    15    18    15    18    17    19    17    19    18    20    18    19    19    20    19    21    19    21    18    20    18    20    17    19    21    23    21    23    21    25    26    29    29    32    30    35    30    35    33    37    33    39    34    41    35    43    39    44    39    48    43    49    43    49    44    50    42    50    44    51    45    51    46    52    47    53    47    53    48    53    48    54    50    55    50    56    50    56    52    56    53    57    53    57    51    56    54    59    56    60    56    61    59    62    60    63    60    63    58    63    59    63    59    63    59    63    61    63    59    63    61    63    60    63    57    63    60    64    60    64    59    64    59    62    59    62    57    63    59    63    59    63    58    62    59    64    60    66    62    67    63    66    63    66    64    66    64    66    60    65    62    65    58    65    63    65    63    64    61    63    60    63    58    60    57    60    55    60    44    57    14    35    15    17    14    16    11    15    11    14    11    13     6     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATAGGGGTATTTGTTGTATTGCAGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---G--G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------A
                                               BLH ATG     111    1707                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH MIN      57     291                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH OVR     111      32                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               EST CLI       9      17                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               ORF LNG     111       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 2e-020     FAA00102.1 TPA: zinc finger protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Sc ---- 2e-020     NP_011987.1 Gene has a 'SET' or 'TROMO' domain at its carboxyterminus like the trithoraxgene family from human and Drosophila with postulated function inchromatin-mediated gene regulation.; Set1p [Saccharomyces cerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 2e-051     NP_496992.3 Maternal Effect Sterile family member (mes-2) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Dm ==== 0          NP_524021.2 Enhancer of zeste CG6502-PA [Drosophila melanogaster] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---= 0          XP_790741.2 PREDICTED: similar to ENX-1 [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 0          XP_683738.1 PREDICTED: similar to Enhancer of zeste homolog 2 isoform 1 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 0          NP_004447.2 enhancer of zeste 2 isoform a; enhancer of zeste 2 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 0          NP_031997.1 enhancer of zeste homolog 2 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Gg ---- 0          XP_418879.2 PREDICTED: similar to Enhancer of zeste homolog 2 (Drosophila) [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 0          NP_001083886.1 enhancer of zeste [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 0          AAH84193.1 Ezh2 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          CAJ83863.1 enhancer of zeste homolog 2 (Drosophila) [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-THdA010g07.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAG------------------------------------------------------------------------------TAG------------ATG------------------------------------------------------------------ATG------------------------------------------------ATG------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------ATG---------TGA---TAG---------------------------------------------------------TAG------------------ATG------------------------------TAA---TAA------------TGA---TAATGA---------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   1         - TpA  5g                       TTpA049c09.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGGCTGAAAGCTGCGAGAGGTGGAGGTTTATCTGGGAGATTTAGTTTGGCGCCTGGGGCTGGCGGTAGTGCAATAGGGATTCCATCGGTAAGGAGATTCGGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCGTTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCTAGATGATGAGAGGGATGACGCTGCCAAGGATCAAGATGAT
  5   1   1       chi Tad5 5g                              XZT22828.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTCCAAGGGCTGTATGACAGCAGCTCCACGGTCAGCTGTTTTTGTGCTGTATCCGGCTGCTGCTTTAAGAAGTCATTTTGTGCATGACAAAGTTGTGTCAGTCGTCGGATGATATTGTGTGACAGATCATCATCACTTGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGNAGGACCAAGAAACTCAGCCTCTCAGGAAG
  5   1   1   14    - Te4  5g3  in                         CAAN5326.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGGAGGTTTATCTGGGAGATTTAGTTTGGCGCCTGGGGCTGGCGGTAGTGCAATAGGGATTCCATCGGTAAGGAGATTCGGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAG
  5   1   1         - Ova1      in                        CABE10433.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGGCGCCTGGGGCTGGCGGTAGTGCAATAGGGATTCCATCGGTAAGGAGATTCGGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAGGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGTAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGNNATGACATCAGATGATGAGAGGGATGACACT
  5   1   1   14    - Te4  5g3  in                        CAAN10413.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTGGCGGTAGTGCAATAGGGATTCCATCGGTAAGGAGATTCGGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGGTATTTGTTGTATTGCAGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACA
  5   1   1   22    - Tad5 5g                              XZT64319.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTGGCGGTAGTGCAATAGGGATTCCATCGGTAAGGAGATTCGGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATNCAGATGANTACATGGAGGACCTAGAAACTCAGCCTCTCAGGAAGTTCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACNAGGGTA
  5   1   1         - Neu  5g3  in                   TNeu106a17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGCGGTAGTGCAATAGGGATTCCATCGGTAAGGAGATTCGGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAG
  5   1   1       chi TbA                            TTbA068j10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCTGTTCTTGATGTCCAGGAGCTTGGAACAGAGGGACTACGCAGAGAACCGGAGCGACACAGCAGAGAGATCGCGACTCAGGGTGATCGGAGGAACTATACGTCGGTTATCTTAGCGGGTAGACAGTAGAAGTCGGATAGGTAGTAATAGAAAAATATTAAGAAAAAGGTTCGCAAGAAATATAGGAAAGCAGTACAGAGGGTTCAGGGGGGAGGGCGGTCATCTTTAACACAAATTCCCGACCCATTCTCGCTCGATCCGACATACTAGCTCTTGAGTGGAACCGTCCCGTAATCCAACCAGTGCGGATAATGACGACGTGCAATTCTTTGCTAGGGACCCTACAGTGCTCTGTGACCGTAGACTTTGATTTTCGGAGTCAACTTATGCCTTTCATAACACTTACTGCTGTCTCCTCCGTGCCCATTACGCATTCCTGGTCTCCTCTCCAGCACAATTTCTTGGTGAAGGATGATTCTGTTCTGCCTAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTATAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCAGTTTCATTAACTATGACATATTTGTGGAGTTACTCAATGCATTGGCACAGTATAGTGATTATGA
  5   1   1         - Te4       in                        CAAN12002.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGGTAGTGCAATAGGGATTCCATCGGTAAGGAGATTCGGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATNCAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCTCTCTGATAAAATTTTTGAAAGCATATCCCCTCATGT
  5   1   1         - Gas  FL   in                  TGas092f05.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTAGTGCAATAGGGATTCCATCGGTAAGGAGATTCGGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAG
  5   1   1         - Neu  5g                        TNeu034n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCAATAGGGATTCCATCGGTAAGGAGATTCGGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATG
  5   1   1         - TpA       in                   TTpA011f09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAATAGGGATTCCATCGGTAAGGAGATTCTGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATTGGAAGAACTGANAGANNAAATACAGGAAATTACAGANACACAGCTTCCAGGGGCACTTC
  5   1   1         - TbA  5g3  in                   TTbA068j05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAATAGGGATTCCATCGGTAAGGAGATTCGGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTCGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATTGGAAGAACTGANAGAAAAATACAAGGAATTTACAGAACAACAG
  5   1   1         - HdA  5g3  in                  THdA009n17.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAATAGGGATTCCATCGGTAAGGAGATTCGGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACA
  5   1   1   22    - Gas7 5g                              XZG42541.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGAGATTCGGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGGTATTTGTTGTATTGCAGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATT
  5   1   1   12    - Gas7 5g3  in                         XZG27262.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGTAGTAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGAC
  5   1   1   10    - Ovi1 5g3  in                         CABI3895.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAAGAACGGAAGAGGAGAGCCAGGCGAAGGGGAGACGGTCATAGACACGGATAATCATGGGCCAGACGGGCAAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATTGGAAGAACT
  5   1   1         - Te4       in                         CAAN7789.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGAAATCTGAGAAGGGACCGGTGTGTTGGCGTAAGCGGGTGAAATCGGAGTACATGCGCTTGCGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGGCAAAAGATTATGGAACGAACAGAGATACTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCAGTGCATATAATGACTACAGTCAGTTCTTTGCGAGGGACCAGAGAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGGTATTTGTTGTATTGCAGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATTGGAAGAACTGANAGAAAAATACAAGGAATTAACAGAACAACAGCTTC
  5   1   1         - Gas       in                   TGas060f14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGTGCTCTGTGACCAGTGATTTAGATTTTCCAAAGCAAGTTATACCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATTGGAAGAACTGAAAGAAAAATACAAGGAATTAACAGAACAACAGCTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTGTAGGCGATGTTTT
  5   1   1         - TpA       in                   TTpA013a01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTTCCAAGCAAGTTATACNCTTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATTGGAAGAACTGAAAGAAAAATACAAGGAATTAACAGAACAACAGCTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCT
  5   1   1         - Te1       in                        CBWN10358.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCTTAAAAACACTTACTGCTGTAGCCTCTGTGCCTATTATGTATTCATGGTCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTCCAGACAAGGGTACATTGGAAGAACTGAAAGAAAAATACAAGGAATTAACAGAACAACAGCTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGAT
  5   1   1         - In63                            IMAGE:8959423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCCTCCTCTCCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATTGGAAGAACTGAAAGAAAAATACAAGGAATTAACAGAACAACAGCTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACAAAGCGCCCTAGTGTCGCGAAGAGGTAGACTTCCCACACACAGCAGACAGCACACACTGTAAATGTGTAGAGCAGACACTGATATGACGAGAGCCGGACTGACCTGGAGAAGCATGATAGAGAGAAGAGAAAGATGAAACCTCAGCTCCCTCTGA
  5   1   1         - TbA       in                   TTbA023g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTGCATAATATTCCATATATGGGAGAAGAGGTTTTGGACCAAGATGGGACATTTATCGAAGAACTCATTAAAAACTATGATGGAAAAGTTCACGGAGATAGGGAATGCGGTTTCATTAACGATGAGATATTCGTGGAGTTAGTCAATGCATCGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATTGGAAGAACTGAAAGAAAAATACAAGGAATTAACAGAACAACAGCTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATA
  5   1   1         - Gas       in                   TGas137a18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTTTTGGACCAAAATGGGACATTTATTGAAAAACTCTTTAAAAACTATGATGGAAAAGTTCATGGAAATAGGGGTATTTGTTGTATTGCAAAATGCGGTTTCATTAACAATGAAATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGGGATTATGAAAACAATGAAAATGGAGATGACAATCAAAATGATGAGAGGGATGACCCTGCAAAAAATCAAAATGATAACTTGGAGGACCAAAAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAAACAAGGGTACATTGGAAAAACTGAA
  5   1   1         - Gas7      in                         XZG64286.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACGATGAGATATTTGTGGAGTTAGTCAATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATTGGAAGAACTGAAAGAAAAATACAAGGAATTAACAGAACAACAGCTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCANACTCTCGGTGCCAGACACCNATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGNAATGGAGTGGTGC
  5   1   1         - Tad5      in                          XZT5215.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATTGGAAGAACTGAAAGAAAAATACAAGGAATTAACAGAACAACAGCTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGGACCTATTATGANCACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAG
  5   1   1         - HdA       in                  THdA010g07.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACCAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATTGGAAGAACTGAAAGAAAAATACAAGGAATTAACAGAACAACAGCTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAANATGTNGGAATGGNNAGTGGTGCAGAGGCCTNCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAT
  5   1   1         - Gas8      in                          st83i08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCAAAAGATCAAGATGATAACATGGAGGACAAGGGTACATTGGAAGAACTGAAAGAAAAATACAAGGAATTAACAGAACAACAGCTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATNAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCNAATATCGAGCCACCTGAAAATGTGGAATGG
  5   1   1         - Gas8      in                          st84i08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGCATTGGCACAATATAGTGATTATGAAGACGATGAAGATGGAGATGACAATCAAGATGATGAGAGGGATGACACTGCANAAGATCAAGATGATAACATGGAGGACAAGGGTACATTGGAAGAACTGAAAGAAAAATACAAGGAATTAACAGAACAACAGCTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATGAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAGCTCCTCTGAAGCAAACTCTCGGTGCCAG
  3   1   1         - Ova1      in                        CABE10433.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGAAACTCAGCCTCTCAGGAAGTTCCCCTCTGATAAAATTTTTGAAGCAATATCCTCAATGTTTCCAGACAAGGGTACATTGGAAGAACTGAAAGAAAAATACAAGGAATTAACAGAACAACAGCTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCG
  5   1   1         - In62                            IMAGE:8956502.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATCGTTTCCAGACAAGGGTACATTGGAAGAACTGAAAGAAAAATACAAGGAATTAACAGAACAACAGCTTCCAGGGGCACTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAAACTATTATGACACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAGTCTATGAGTTTAGAGTAAGGATTCAGTATTATTGCTTCTGTTATTGCTGAGATGTCGACACTCCTCGAGAGAAAGAGAACACGACTTTGGGCATGCACTGCAGAAATACAGCTGAAAGATGTTCTTCAACATGTTTACATTTACAG
  5   1   1         - Gas7      in                         XZG15444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGACGCGTGGGCCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTANAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAGAGGAACACAGACTTTGGGCAGCGCACTGC
  5   1   1         - Gas       in                   TGas140o20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTCCACCAGAGTGCACCCCAAATATAGATGGGCCAAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAG
  3   1   1         - TpA       in                    TTpA011f09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAATGCAAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTTCCCATACCCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAAAAAAAAAA
  5   1   1         - Te1       in                         CBWN1105.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAATCTGTGCAACGAGAGCAGAGTCTTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAG
  5   1   1         - Neu       in                   TNeu097m19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCATTCATTCCATACCCTGTTTTGTAGGCGATGTTTTAAGTATGATTGTTTTCTGCACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAA
  5   1   1         - HdA                            THdA008o08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACCCATTTCATGCTACTCCTAATACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAAAGGAAACACAGACTTTGGGCAGCGCACTGCAGGANAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGT
  5   1   1         - Gas7      in                         XZG47789.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACTTACAAACGGAAGAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGCTGCGGATCACT
  5   1   1         - In63                            IMAGE:8961173.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAAACAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGAGTGTGACCAGACTGTGTTTACTTGTGGGCTGCGGATCACTGGACAGTAGATGTATCTGCAAGACTGCAGCATCACGCGTCAGAGCATTGCTGTGTCTTCTGACGTGGCTGTGGGATCTCATCAGACTGTCGAAACGAGTCATCTGGATCTGGAAGATCTATCAGATGACTGATCGAAGGACGTTTGTAAATCTGTGTGACTTCTCTCTTCCTGGACATGAT
  5   1   1         - TpA       in                   TTpA063i13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAATGAAGCAGCAAATGATGGAAAACCTTGTGGACCACACTGCTACCAGCTTTTGGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTA
  5   1   1         - Tad5      in                         XZT21368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAGGAGCACGGGAGTTTGCTGCAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAG
  5   1   1         - Gas                            TGas081m15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCTTTGACAGCAGAACGAATAAAGACACCACCAAAGCGCCCTAGTGGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAGAAAAGAGGAAACACAGACTTTGGGCAGCGCAATTGCAGGAAAATACAGCTGAAAAAGATGGTTCCTCAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCAGCCCTGTGACAGCTCATG
  5   1   1         - Ova1      in                         CABE6829.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTCGCCGAAGAGGTAGACTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAAAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGNCAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGNTGGGGGATCTTC
  5   1   1         - Gas7      in                         XZG29922.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCANNCGCGTCCGCTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCCGATCCCT
  5   1   1         - Tbd0                               IMAGE:6979742                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGGATCTTCCCAACAACACCAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAAAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTTACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCCAGAACTGCAGCATTCACCGCGGTTCAAAAAACATTTGCTGTTGGCTCTTCTGACGTGCTGGTGGGGGACTCTTCAAAACCTGTT
  5   1   1         - Gas7      in                         XZG44442.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCAGACCAAGCACACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGA
  5   1   1         - Gas0                                 dad24b11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGGACCAACTGTAAATGTGTTAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAAAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGC
  5   1   1         - Spl2      in                        CBSS7496.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGAAGCCAAGGACACTGATAGTGACAGAGAAGCCGGCACTGAAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAG
  5   1   1         - Te5       in                         CAAO9044.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACTGGAGGGGAAAGCAATGATAAGGAGGAAGAAGAGAAAAAAGATGAGACCTCAAGCTCCTCTGAAGCAAACTCTCGGTGCCAGACACCAATAAAAATGAAGCCAAATATCGAGCCACCTGAAAATGTGGAATGGAGTGGTGCAGAGGCCTCCCTATTTAGAGTGCTAATTGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGAT
  5   1   1         - Tail      in                        CBSW11855.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGCGTCCGGGAACCTATTATGACAACTTCTGTGCAATTGCAAGGTTGATTGGTACCAAGACATGCCGGCAAGTCTATGAGTTTAGAGTAAAGGAATCCAGTATTATTGCTCCTGTTATTGCTGAGGATGTCGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCANG
  5   1   1         - Gas7                                 XZG10947.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTTCTGAACCCATGCCTTACCTTTCTC
  5   1   1         - Gas7      in                         XZG54384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGNAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATT
  5   1   1         - Ovi1      in                         CABI5790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCACTGCAGGAAAATACAGCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGA
  5   1   1         - Thy1      in                        CBST4387.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGAAAAAAGATGGTTCCTCAAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAG
  5   1   1         - Gas                            TGas029l09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAACCATGTTTACAATTACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGG
  5   1   1         - Gas8      in                          st12e03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCAGCCATGTGATCACCCCCGCCAGCCCTGTGACAGCTCATGCCCCTGTGTCATAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCCTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGA
  5   1   1         - Tad0      in                     NISC_no06g11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTCGACACTCCTCCGAGAAAGAAAAAGAGGAAACACAGACTTTGGGCAGCGCACTGCAGGAAAATACAGCTGAAAAAAGGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCTAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGA
  3   1   1         - Gas       in                    TGas140o20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTTCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTGAACTTCAAAAAAAAAAAAAAAAAA
  3   1   1         - HdA       in                    THdA010g07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTAACAAAAAAAAAAAAAAAAAAAGCG
  3   1   1         - Gas  FL   in                    TGas092f05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCCAGAACTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCGAATAAAATATACTTGAACTTCTGTAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1         - Neu5                                 ANHP1158.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTTGTGAGAAGTTCTGTCAGTGCAGCTCTGAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTA
  3   1   1         - Ova1      in                         CABE6829.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTCAGTGCAGCTCTGATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGAAAAAAAAAAAA
  3   1   1         - Gas8      in                          st12e03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGTGCAGCTCTGAATGCCAAANCAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCNTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTGGCAATAATGT
  3   1   1         - Neu       in                    TNeu097m19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTGAACTCAAAAAAAAAAAAAAAAAA
  3   1   1         - Neu  5g3  in                    TNeu106a17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCATTCATTTTATGCTTTAGATATTAAATAGATATAAAAACCCAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7      in                         XZG54384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGCCAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTAAAAAAAAAAAAAAAGG
  3   1   1         - Gas       in                    TGas137a18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGTTTTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTTTGAAACCCATGCCTTACCTTTTTCAGGAATTTTTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTTTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAAATATACTTGAACTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Te4  5g3  in                        CAAN10413.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGTACCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGT
  3   1   1         - Gas7                                 XZG21985.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGGTTTCCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTAAAAAAAAAAAAAAAGG
  3   1   1         - Ovi1      in                         CABI5790.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTGGATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGT
  3   1   1       chi TbA       in                    TTbA009d05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAGGGGTATAGATTGAACTTTGATTCTGATAGGACATTGGCTAAAATGAATTACATTGCTTGTCTAGGGTTGGGCATTTATGGCCAGCTGAAGCCTACTCCAGTTTGATCCCTGTACAATTTAAGGGATAAGTAGCGCAGAAATCCAAGGATTATTTTAAAAGGAGCATGCAAAGTTCATTTAATGGTGAACTTTATAATTCTAATTTACTTTATAAAGCTGCCAATTTACTTAGCTTAATTTTTCCTCTCTTTTCAGATCATATCCCAGGATGAAGCTGATTGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTTTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTTTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGGGAAGAACTTTTTTTTGATTACAGATACAGCCAAGCAGATGCTTTGAAATATGTGGGTATTGAGAGAGAAAAGGAAATCCCCTGATTTTAGCTACCTCCTTTTGAAACCCATGCCTTACCTTTTTCAGGAATTTTTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTTTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTTTGACCATAATGAAAAGACTTTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTTTGTAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   1         - Tad5      in                         XZT21368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGCCGCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCAAAAAAAAAAAAAAAGG
  3   1   1         - HdA  5g3  in                    THdA009n17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGCTGTAAAGCTCAGTGCAATATTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTGAACTTCAAAAAAAAAAAAAAAAAAG
  3   1   1         - Gas7      in                         XZG29922.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGTAAAGCTCAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGT
  3   1   1         - TpA       in                    TTpA013a01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTGCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCATTCATTTTATGCTTTAGATATTAAATAGATATAAAAACCCAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7      in                         XZG44442.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAATACTAAGCAGTGCCCTTGCTACCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCAAAAAAAAAAAAAAAAGG
  3   1   1         - Te4       in                        CAAN12002.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAGTGCCCTTGCTACCGGGCTGTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACTAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTC
  3   1   1         - Gas       in                    TGas060f14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGGCTGTACGGGAGTGTGACCCAGACCTGTGTNTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGTTCTTCATTCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCNCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGTTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCATTCATTTTATGCTTTAGATATTAAATAGATTAAAAACCAAAAAAAAAAAAAAAAAA
  5   1   1         - Te1       in                        CBWN13593.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGAGACCCCATTCAGTGCCCTTGTAATTACTGGCGTTGCACTCTAAAGAATGTATTTAAAAAAAAAAAAAAAAAAAGCTTTTTTGCATTGACAACAAATCTCTGTTGCCTTCCTAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGGTGAGGTCAATAGTGTGTATATTGTTCTCTAACACAAAGGCAAGTTCTTGCAGTGCATGTGAGTAATGCTTCCGCTCAGTTTGTATGGCTTCTGGAAAAACACTCAAGTGCAGAAATCCACATCTTTGCTTTTCTAATGTTAAAGGGATAAATTAAGAGCTGTAAGGGTTTAATCCGTTTACAGTTCCTACTATTAAGTACTGTTAAACAGGGGACGCTGTGCTTCCTGATCCTTTTTTGATTTATTAGATCAGTGCTGCCCAACTTTTAGGGCAGTGACTGATGGAAAGTTTTGCTGCCCACAAGAAAAAGTCTCTCTCACAAGCAAGTGACTGAAAATAGATTTTTAACTGAAAGAATGGAGATCGACATACGTGAGACACTCTAAATGTGGCACAATTCTACTCTGGTACAATTGCAGAATACAGAGGGCAGCATTTTCCATGATAGTCCCTCCAGATTGGAGCTGGTCTGAGTGCCAGGATGTCCATG
  3   1   1         - TbA  5g3  in                    TTbA068j05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTACGGGAGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCACAATAAAATATACTTGAACTTCTAAAAAAAAAAAAAAAAAAGC
  3   1   1         - Te4       in                         CAAN7789.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTACGGGAGTGTGACCCAGACCTGTGTTTACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCATTCATTTTATGCTTTAGATATTAAATAGATATAAAAACCC
  3   1   1         - TbA       in                    TTbA023g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTGTGACCCAGACCTGTGTTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGTTTTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTTTGAAACCCATGCCTTACCTTTTTCAGGAATTTTTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTTTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCATTCATTTTATGCTTTAGATATTAAATAGATATAAAAACCCAAAAAAAAAAAAAAAAAAAGCGCC
  5   1   1         - HdA                            THdA027o21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCCAGACCTGTGTTAACTTGTGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGT
  5  -1   1         - Gas1                               IMAGE:6990803                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGACCTGTGTTAACTTGTGGGGCTGCGGATCACTGGACCAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGNTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCATTCATTTATGCGGN
  3   1   1       chi Te1       in                        CBWN13593.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTGGGATTCTTGCTGAGCATGCTCACATAGCCATAATGATGCATTCCTGTTTAAAGTAGAGCGTGTCGGTATCCCTTTAAATATTTAGTTTTTAGATTTGTTGTACATATTTTATCATATAATAAGTTGATTTCTCTAAATTTAAATTAAATCTTGCAGCAACGCCAATAACAAGTGGTTTTTTAGTATTGTCTTAGGCAGCGTCCAGTGCTGCAGCCAGCTCATTCTAATCTAATCTGGGAATCTCTCGCCTTTTACGCCTTTTTTTGTATAAGACTTAATAAAGAACAGCGTCAATGGATGGCTTATTAATGTTTTGCTCTTCTCTCTTCAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCAAAAAAAAAAAAAAA
  3   1   1         - Te5       in                         CAAO9044.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTGGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCATTCATTTTATCCTTTAGATATTAAATAGATATAAAAACCC
  3   1   1         - Tad5      in                         XZT50568.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCAAAAAAAAAAAAAAAAGG
  3   1   1         - Thy1      in                        CBST4387.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGGGCTGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGT
  3   1   1         - Te1       in                         CBWN1105.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCGGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTAAAAAAAAAAAAAAA
  5   1   1         - Tad5      in                         XZT50568.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCAAAAAAAAAAAAAAAGG
  3   1   1         - Gas7      in                         XZG47789.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAAAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCATTCATTTTATGCTTTAGATATTAAATAGATATAAAAACCCAAAAAAAAAAAAAAAGGGCGGCCGCAAGGCCTGATTC
  3   1   1         - Tad5      in                          XZT5215.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACTGGGACAGTAAGAATGTATCCTGCAAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTTAAAAAAAAAAAAAAAAGGG
  3   1   1         - Gas8      in                          st83i08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAACTGCAGCATTCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCAT
  5  -1   1         - Gas       in                   TGas136f13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCATTCGGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAG
  3   1   1         - Spl2      in                        CBSS7496.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAGCGCGGTTCCAAGAAGCATTTGCTGTTGGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGT
  3   1   1         - Gas7      in                         XZG15444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCTCCTTCTGACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTGGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGT
  3   1   1         - Tad0      in                     NISC_no06g11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACGTTGCTGGTTGGGGGATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGTAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCAAAAAAAAAAAAAAAAAAAG
  3   1   1         - Gas7      in                         XZG64286.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCTTCATCAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCATTCATTTTATGCTTTAGATATTAAATAGATATAAAAACCC
  5   1   1         - TbA       in                   TTbA009d05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAAGACCCTGTACAGAAAAACGAGTTCATCTCTGAGTACTGTGGAGAGGTGAGGTCAATAGTGTGTATATTGTTCTCTAACACAAAGGCAAGTTCTTGCAGTGCATGTGAGTAATGCTTCCGCTCAGTTTGTATGGCTTCTGGAAAAACACTCAAGTGCAGAAATCCACATCTTTGCTTTTCTAATGTTAAAGGGATAAATTAAGAGCTGTAAGGGTTTAATCCGTTTACAGTTCCTACTATTAAGTACTGTTAAACAGGGGACGCTGTGCTTCCTGATCCTTTTTTGATTTATTAGATCAGTGCTGCCCAACTTTTAGGGCAGTGACTGATGGAAAGTTTTGCTGCCCACAAGAAAAAGTCTCTCTCACAAGCAAGTGACTGAAAATAGATTTTTAACTGAAAGAATGGAGATCGACATACGTGAGACACTCTAAATGTGGCACAATTCTACTCTGGTACAATTGCAGAAATACAGAGGGCAGCATTTTCCATGATAGTCCCTCCAGATTGGAGCTGGTCTGAGTGCCAGGATGTCCATGACACCCTATGTTAAGCTGTAAAATTTATACAAAGCAACTGTGGCTCCTTTTCACCTTTTTCCTGACTGTGGGTAGATGCTGCTGCCAGCTCAGTCTCTGAGTCTTTAATGTTTAGGGATTGTTTTCCAGACACAAGCCTAAGTAGGAGGGTTAATGTTCTCCCTCAGGAGAGCAGGATGAACTATCCCTGTTGTTCCTCTCCTTCATTCCAGAGCCGATGATCATTTGTGTCCCTGAGAGTATGGTGTAAACTTCACATTGCTTCTCTGTGATGCAGACAATTCCCTCACTTCGTACATACCTACATGTACTGTGC
  3   1   1         - Gas7      in                         XZG44838.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCACGCGTCCGGTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTAAAAAAAACTAAAAAAAAAAG
  5   1   1         - Gas7      in                         XZG44838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTCATCTCTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTaaaaaaaactaaaaaaaaaagaaaaaaaaaaaaaaaaaaaaGG
  3   1   1         - Gas8      in                          st84i08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTNTGAGTNCTGTGGAGAGNTCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGANCAATGATTCTGTAGTNGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAANNTGCTATGCAAAAGTAATGANGGTAAATGGAGACCATAGAATAGGGATTTNTGCGNAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTNGATTNCAGATACAGCCAAGCAGATGCTNTGAAATATGTGGGTANTGAGAGAGAAATGGAAATCC
  3   1   1         - Te1       in                        CBWN10358.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAGTACTGTGGAGAGATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTTTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGGAAAAAAAAAAAAAAA
  3   1   1         - Ovi1 5g3  in                         CABI3895.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCATATCCCAGGATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGGGTAGCTTCCTTTTCAACTTGAACAATGATTTTGTGGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTTTGGGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGGGCCCATAGAATAGGGATTTTTGGGAAGAGAGCCATTCAAACGGGGGAAGAATTTTTTTTTGATTACAGATACAGCCAAGCAGATGTTTTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTTTGAAACCCATGCCTTACCTTTTTCAGGAATTTTTTACGCGCAATTTTAGATCCAAGGGGGGAAGAAAATGCAAGCTGAAGTTTTGAGTTACCGAGTACTGTAACAGTAATTTATAGGGGTCTGACCATAATGAAACGACTTTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCCCCTCAAATAAAATATACTTGACCTTC
  3   1   1         - Ova1      in                        CABE10193.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGT
  5   1   1         - Ova1      in                        CABE10193.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGAAGCTGATCGAAGAGGAAAGGTGTATGATAAATACATGTGTAGCTTCCTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7 5g3  in                         XZG27262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAGGAAAGGTGTATGATAAATACAGGTGTAGCTTCCTCTTCAACTGGAACAATGATTTTGTAGTGGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGGGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGCCCATAGAATAGGGATTTTTGGGAAGAGAGCCATTCAAACGGGGGAAGAATTTTTTTTTGATTACAGATACAGCCAAGCAGATGTTTTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCGGATTCTAGCTACCTCCTTTTGAAACCCATGCCTTACCTTTTTCAGGAATTTTTTCCGCGCAATTTTGGATCCAAGGGGGGAAGAAAATGCAAGCTGAAGTTTTGAGTTACCGAGTACTGTAACAGTAATTTATAGGGGTCGGACCATAAGGAAAGGACTTTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCCCCTCAAATAAAATATA
  3   1   1         - Gas8      in                          st70f17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGT
  3   1   1         - Gas8      in                          st71f17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTAT
  3   1   1         - Tail      in                        CBSW11855.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTTCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTAAAAAAAAAAAAAAA
  3   1   1         - TpA       in                    TTpA063i13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCAACTTGAACAATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTTTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGGGAAGAGAGCCATTCAAACGGGGGAAGAACTTTTTTTTGATTACAGATACAGCCAAGCAGATGTTTTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTTTAGCTACCTCCTTTTGAAACCCATGCCTTACCTTTTTCAGGAATTTTTTACGGGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTTTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTTTGACCATAATGAAAAGATTTTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCCCCTCAAATAAAATATACTTGAACTTTCTGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1         - Gas8      in                          st70f17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTAANANAAANA
  5   1   1         - Gas8      in                          st71f17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGATTTTGTAGTAGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCNAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTAAAAAAAAAGAA
  3   1   1         - Gas       in                    TGas136f13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGATGCAACAAGAAAAGGCAACAAAATCCGATTTGCAAACCATTCTGTGAATCCAAACTGCTATGCAAAAGTAATGATGGTAAATGGAGACCATAGAATAGGGATTTTTGCGAAGAGAGCCATTCAAACGGGTGAAGAACTCTTCTTTGATTACAGATACAGCCAAGCAGATGCTCTGAAATATGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCCATTCATTTTATGCTTTAGATATTAAATAAAAAAAAAAAAAAAAAA
  3   1   1         - TpA                             TTpA023m08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAACAAAATCCGATTGGCAAACCATTCTGTGAATCCAACCGGCTATGCAAAGGTAACGATGGAAAAGGGAGACCTTAGAACAGGGTTTTTTGTGAAGAGAGCCATTCAAACGGGTGGGGAACTCTTTTTGGATTTCAGATCCAGCCAGGCAGGTGTTCTGAAATTTGGGGGTGCTGAGAGAGAAAAGGAAATCCCCTGATTATGGTGGCGTCTTTGTGAAACCCAACCCTTACTTTTTTCAGGAATTTTTTACGCCCAATTTTAGATACAAGCGGGGAAGAAAATGCAAGGAGAAGTTTTGAGTTCCCCAGTCCTGTACCAATAATTAATAGTGGTGTGACCATAATAAAACCACTCTTTCCTTTACCACTTCCATTGTATTTTGTATCTTAGGAACGTTTGGCAATAATGTTATTCAGGCACAGGTCCCACCTCAAATAAAATATCCTTGCACTTCAACAAAGATATGAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1         - Gas                            TGas049l05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTGTTCCTATGATCAGCCAACAGTGCTCTGAAATTGTGGGTATTGAGAGAGAAATGGAAATCCCCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGT
  3   1   1         - Neu       in                    TNeu114e21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGGGCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTGAACTTCTAAAAAAAAAAAA
  5   1   1         - Neu       in                   TNeu114e21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGGGCTGATTCTAGCTACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCT
  5   1   1         - Neu                            TNeu142i24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TACCTCCTTCTGAAACCCATGCCTTACCTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGT
  5  -1   1         - Gas                            TGas005g15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAAACCCATGCCTTACTTCTTCAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCANGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTCTCTACTGTTCTTTGGCAAACTACACCATTCATTTTATGCTTTAGATATTAAATAG
  5   1   1         - Neu       in                   TNeu118k21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCATTCATTTTATGCTTTAGATATTAAATAGATATAAAAACCC
  3   1   1         - Neu       in                    TNeu118k21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGAATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCATTCATTTTATGCTTTAGATATTAAATAGATATAAAAACCCAAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas       ?                     TGas135d22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCGTAAAAAAAAAAAAAAAAAA
  5   1   1         - Gas                            TGas045c01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTCTTACGCGCAATTTTAGATACAAGAGGGGAAGAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGT
  3   1   1         - Te4  5g3  in                         CAAN5326.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGATACAAGAGGGGAAGAAAATGCAAGCTGAAGTTCTGAGTTACCGAGTACTGTAACAGTAATTTATAGTGGTCTGACCATAATGAAACGACTCTTTCCTTTGCCACTTGCATTGTATTTTGTACCTAGGAACGTTTGGCAATAATGTTATTCAGGTACATGTCCCACCTCAAATAAAATATACTTGAACTTCTGTATTTTCTCTACTGTTCATTTGGCAAACTACACCATTCATTTTATGCTTTAGATATTAAATAGATATAAAAACCC

In case of problems mail me! (