Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI4189.5.5                         88 END     1           1        1                Sperm-Specific family, class Q SSQ-2, erythrocyte membrane protein 3 like familymember (ssq-2) [Caenorhabditis elegans]
     2   2.0    0Xt7.1-CAAJ14748.5                          20 END     17         19       85                kinase D-interacting substance of 220 kDa [Homo sapiens]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     3  36.0    0(repeat)                                    0 REP     82       4124     4417                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012153413 Xt7.1-CABD2373.3.5 - 87 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470......5480......5490......5500......5510......5520......5530......5540......5550......5560......5570......5580......5590......5600......5610......5620......5630......5640......5650......5660......5670......5680......5690......5700......5710......5720......5730......5740......5750......5760......5770......5780......5790......5800......5810
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABD2373.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTGGGGAAGTGGAAAATCATTCCTGCTTAAAAAGCTTGAAGATGAGATGAAGACTTTTGCAGGCCAGCAGATAGAACCTCTGTTCCAGTTCTCTTGGCTCATTGTGTTTCTTATCCTGATGCTCTGCAGTACCATAGGATTGCTGCTTTCATTTACAGTTGATCCAAAACTGGGCATATCTGTGGCTCTCAGCTTGTTGACTGTACTCTACATATTCTTTGCTGCTGTCTACTTTGGAGGAAGACGAGAAGGAGAAAACTGGAACTGGGCTTGGGTGCTAAGTACTAGACTGGCAAGACAGATCGGATACCTTGAACTACTTCTAAAACTCATGTTCGTAAATCCACCAGAACTTCCTGAGCAAACCACTAAAGCTTTGCCAGTTCGGTTCCTTTTCACTGACTACAATCGACTCTCTAGTGTAGGGGGAGAAACATCCATGGCTGAAATGATAGCCACGCTCTCTGATGCATGTGAGAGGGAGTTTGGTTTCTTAGCCACACGGCTCTTCAGAGTGTTTAAGACAGAGGAAACACAAGGAAAGAAGAAATGGAAGAAGACTTGTTGTCTCCCCTCCTTTGTAATCTTCATTTTCATTATGCTGTGTATCTTTGCCGGCGTTCTCCTGCTGGCGATCTTTAAAGTGGATCCCAAGAATATGACTGTGAATGCCATCCTTATTGCTGTGGCTTGTGTGGTGGGCCTAGTGTTTGTGCTAAATTGCCGCACGTGGTGGCAAGTGATGGATTCTATACTTAACTCTCAGCGCAAACGGCTCCACGGTGCCGCTTCCAAACTGCACAAACTGAAAAGCGAAGGATTTATGAAGGTTTTGAAATGGGAAGTAGAGTTGATGGCTAAAATGGCAAAAACCATAGATAGTTTCACCCAAAACCAGACCAGGCTTGTGGTGATAATTGATGGGCTGGATGCCTGTGAGCAGGATAAAGTTCTGCATATGCTAGACACGGTTCGGATCCTGTTTTCCAAGGGGCCATTTATTGCTATTTTTGCAAGTGACCCTCACATTATTATCAAGGCCATCAATCAAAATCTCAACAGCGTGTTGAGAGATTCTAACATTAATGGGCACGACTATATGCGCAACATTGTCCACCTGCCCGTCTTTCTCAACAGTCGTGGTCTCAGCAATGCCAAAAAGCTGTGCTCGATATCTGCCACCAATGGAGATGTGGGGTGTATGGAGAGTGGTTCAGGAGGGCATGAAGACCTTGATAGAAGGGTCTCCCAGCACAGCTTGGCAGAGGCTTCAAAACTTGGCAGCAAAACTGCTCTGAACAGAAGAGATACCTATAGAAGAAGGCAGATGCAGCGCACCATAACACGACAGATGTCCTTTGACCTAACCAAGCTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACTAAAGAAAGAAATGAACATGAACTTTGGCGACTGGCACCTATTCAAGAGCGCACTTCACGAAATGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGATGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACACCCCTCTCCTTAAGGATGGAAAAGAAAAAAAGACTGACTGCAGTCTGGATAAGAAAGCAGGAGAGCTTGCCTCTGAGCCCATAATGGCCTACAGTAAAGCAAAGGAGTACCTTTCAGATGCCATCCTGAACAAGAAAGATTCTTCTGACTCCGGCATGAGATCCAATGAAAGTTCTCCCAATCACTCTCTCAATAATGAAGGCGGTGACGATTCCCAGCTTGAAAAGACAAATCTTATTGAGCTGGAAGATGGGCGCTTACGAGGAAAGAGAGGAATACCCAACAGTCTGAGTGGCCTCCAGGACTCGGAAATCGCACGCATGTCAATCTGCTCCGACAAGAAAAGTCCTTCAGAAAGTAGTCTGATTGCCAGCAGCCCTGAGGAGAACTGGCCTTCAAGTCAGAAGTCCTTCAATCTGAACCGTACGCCAAGTACAGTCACGCTCAACAACAATACCGCCAACCAAAACTTTGAAGAGACAGAAGATGCTAAAAACGATTCTCCAATCATAGTAGTTCCTGGGTCAAGTCCTGTTCAAAACGAGAACCTGAAGCGTTTGACTCACAAGCGAGGTCAGCGTGCAGGGTACAGCCGTCTGGCCAAAGAAGCTTCAGAGCTAAACACTGTGGCTTCCTCTGATGCATCCGGCTTTGCAGAAGAAAGACTAGAAAGTATTCAGATAAAAGAATAAATCTGGAAAAAAAAAGGGTTGTAACTGGCTGTAGCTTAGCGTCCCACTGAAGCCTGGGAGAGAAGAATGAAGAGCAGCTTCAGCATGACGAGAAGGAACCACGGACTCATCATTCTCTAGGCAGAGCTTCAGAGGATATAACTATAAACTCTAATACCCAAACTTTAAAATGATATTTAATATCTGGTTGCCAAAATGTAGGAGCTCTCCTTTGGGTTGGGCTTGGATATTTTCTCCATCCCTATGAAATACAGGGAGGTAGACTGACTTTGAAATCAATTAATCTGACAATTCTAAACTGATCAAATTGGATTGCATTTAGAAAGACTCTAAATTACTTGAATTAGATCAATATTGATTGACGGCACTGGAAAAACATGTCCACCGCCTTCATACCCTAAACCAGTAAACTCAGGAGCAATATGTTGCTCACCGCCCCATTTGATGTTTCTCCCAGTGGCCTCAAAGCAGGTGCCCATTTTTAAGTCTCTGGCTTGGAGGCAAGTTTTAGAAGAGACACCGTTTTCTCCAATCAGAGCCTCCTGCAGGCCAGCAGTCCACATGGGGTACCAACTAGCCAATCACAGCCCTTATTCAGCATCCACAAAATATGTTTTCATGCTTGTGTGGCTCCCCAACACTTTCTACAGCTGAGTGTAGCTCATGAGTACAAAAGGTTGGGGATCTCTGTCTTTGGCCTGTAGTTCTGAGATGACAAATAAGCTATTGACAATGATACGTACTGATTTGTGACCCTCCCCTGGAGGATTCTTCATTCAACCTTTGCTAAGTCTGCCCCTAATTCTTTCATTAAGCTAGTAGTCGTGTTCACTTCCCATTTTGCTTTGTCTAGACTGCCTTGACATTTGTATCCCCTGGATTACAGAGGTTCTGTTTCATTGATGTTCTCTTCGGTTTCACCTGCTGACAAGCATTTAAACACAGTTCAGGAACATTGTATCTCTAACCTGAGAGAATAATTGCCATTATGCGTGTAAGGCTGATGGCTTGATACAACAGCCCGGTTCATTTCAACACCAAAAACTGCTGGCTGTGGCTTCTTTGCACCTGAAACCTCTTCTGAGCTTGCCATTCAAAAAAATGGGAGGCAGTTGGTGGAACGTTCCAGGTAGCCTAGAAGTGCCCTGTGTGTCATAGCNCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008264855                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGTGGAAAATCATTCCTGCTTAAAAAGCTTGAAGATGAGATGAAGACTTTTGCAGGCCAGCAGATAGAACCTCTGTTCCAGTTCTCTTGGCTCATTGTGTTTCTTATCCTGATGCTCTGCAGTACCATAGGATTGCTGCTTTCATTTACAGTTGATCCAAAACTGGGCATATCTGTGGCTCTCAGCTTGTTGACTGTACTCTACATATTCTTTGCTGCTGTCTACTTTGGAGGAAGACGAGAAGGAGAAAACTGGAACTGGGCTTGGGTGCTAAGTACTAGACTGGCAAGACAGATCGGATACCTTGAACTACTTCTAAAACTCATGTTCGTAAATCCACCAGAACTTCCTGAGCAAACCACTAAAGCTTTGCCAGTTCGGTTCCTTTTCACTGACTACAATCGACTCTCTAGTGTAGGGGGAGAAACATCCATGGCTGAAATGATAGCCACGCTCTCTGATGCATGTGAGAGGGAGTTTGGTTTCTTAGCCACACGGCTCTTCAGAGTGTTTAAGACAGAGGAAACACAAGGAAAGAAGAAATGGAAGAAGACTTGTTGTCTCCCCTCCTTTGTAATCTTCATTTTCATTATGCTGTGTATCTTTGCCGGCGTTCTCCTGCTGGCGATCTTTAAAGTGGATCCCAAGAATATGACTGTGAATGCCATCCTTATTGCTGTGGCTTGTGTGGTGGGCCTAGTGTTTGTGCTAAATTGCCGCACGTGGTGGCAAGTGATGGATTCTATACTTAACTCTCAGCGCAAACGGCTCCACGGTGCCGCTTCCAAACTGCACAAACTGAAAAGCGAAGGATTTATGAAGGTTTTGAAATGGGAAGTAGAGTTGATGGCTAAAATGGCAAAAACCATAGATAGTTTCACCCAAAACCAGACCAGGCTTGTGGTGATAATTGATGGGCTGGATGCCTGTGAGCAGGATAAAGTTCTGCATATGCTAGACACGGTTCGGATCCTGTTTTCCAAGGGGCCATTTATTGCTATTTTTGCAAGTGACCCTCACATTATTATCAAGGCCATCAATCAAAATCTCAACAGCGTGTTGAGAGATTCTAACATTAATGGGCACGACTATATGCGCAACATTGTCCACCTGCCCGTCTTTCTCAACAGTCGTGGTCTCAGCAATGCCAAAAAGCTGTGCTCGATATCTGCCACCAATGGAGATGTGGGGTGTATGGAGAGTGGTTCAGGAGGGCATGAAGACCTTGATAGAAGGGTCTCCCAGCACAGCTTGGCAGAGGCTTCAAAACTTGGCAGCAAAACTGCTCTGAACAGAAGAGATACCTATAGAAGAAGGCAGATGCAGCGCACCATAACACGACAGATGTCCTTTGACCTAACCAAGCTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACTAAAGAAAGAAATGAACATGAACTTTGGCGACTGGCACCTATTCAAGAGCGCACTTCACGAAATGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGATGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACACCCCTCTCCTTAAGGATGGAAAAGAAAAAAAGACTGACTGCAGTCTGGATAAGAAAGCAGGAGAGCTTGCCTCTGAGCCCATAATGGCCTACAGTAAAGCAAAGGAGTACCTTTCAGATGCCATCCTGAACAAGAAAGATTCTTCTGACTCCGGCATGAGATCCAATGAAAGTTCTCCCAATCACTCTCTCAATAATGAAGGCGGTGACGATTCCCAGCTTGAAAAGACAAATCTTATTGAGCTGGAAGATGGGCGCTTACGAGGAAAGAGAGGAATACCCAACAGTCTGAGTGGCCTCCAGGACTCGGAAATCGCACGCATGTCAATCTGCTCCGACAAGAAAAGTCCTTCAGAAAGTAGTCTGATTGCCAGCAGCCCTGAGGAGAACTGGCCTTCAAGTCAGAAGTCCTTCAATCTGAACCGTACGCCAAGTACAGTCACGCTCAACAACAATACCGCCAACCAAAACTTTGAAGAGACAGAAGATGCTAAAAACGATTCTCCAATCATAGTAGTTCCTGGGTCAAGTCCTGTTCAAAACGAGAACCTGAAGCGTTTGACTCACAAGCGAGGTCAGCGTGCAGGGTACAGCCGTCTGGCCAAAGAAGCTTCAGAGCTAAACACTGTGGCTTCCTCTGATGCATCCGGCTTTGCAGAAGAAAGAxxxxAAAGTATTCAGATAAAAGAATAAATCTGGAAAAAAAAAGGGTTGTAACTGGCTGTAGCTTAGCGTCCCACTGAAGCCTGGGAGAGAAGAATGAAGAGCAGCTTCAGCATGACGAGAAGGAACCACGGACTCATCATTCTCTAGGCAGAGCTTCAGAGGATATAACTATAAACTCTAATACCCAAACTTTAAAATGATATTTAATATCTGGTTGCCAAAATGTAGGAGCTCTCCTTTGGGTTGGGCTTGGATATTTTCTCCATCCCTATGAAATACAGGGAGGTAGACTGACTTTGAAATCAATTAATCTGACAATTCTAAACTGATCAAATTGGATTGCATTTAGAAAGACTCTAAATTACTTGAATTAGATCAATATTGATTGACGGCACTGGAAAAACATGTCCACCGCCTTCATACCCTAAACCAGTAAACTCAGGAGCAATATGTTGCTCACCGCCCCATTTGATGTTTCTCCCAGTGGCCTCAAAGCAGGTGCCCATTTTTAAGTCTCTGGCTTGGAGGCAAGTTTTAGAAGAGACACCGTTTTCTCCAATCAGAGCCTCCTGCAGGCCAGCAGTCCACATGGGGTACCAACTAGCCAATCACAGCCCTTATTCAGCATCCACAAAATATGTTTTCATGCTTGTGTGGCTCCCCAACACTTTCTACAGCTGAGTGTAGCTCATGAGTACAAAAGGTTGGGGATCTCTGTCTTTGGCCTGTAGTTCTGAGATGACAAATAAGCTATTGACAATGATACGTACTGATTTGTGACCCTCCCCTGGAGGATTCTTCATTCAACCTTTGCTAAGTCTGCCCCTAATTCTTTCATTAAGCTAGTAGTCGTGTTCACTTCCCATTTTGCTTTGTCTAGACTGCCTTGACATTTGTATCCCCTGGATTACAGAGGTTCTGTTTCATTGATGTTCTCTTCGGTTTCACCTGCTGACAAGCATTTAAACACAGTTCAGGAACATTGTATCTCTAACCTGAGAGAATAATTGCCATTATGCGTGTAAGGCTGATGGCTTGATACAACAGCCCGGTTCATTTCAACACCAAAAACTGCTGGCTGTGGCTTCTTTGCACCTGAAACCTCTTCTGAGCTTGCCATTCAAAAAAATGGGAGGCAGTTGGTGGAACGTTCCAGGTAGCCTAGAAGTGCCCTGTGTGTCATAGCNCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     7     6     7     6     7     6     7     6     7     6     7     5     6     5     6     5     6     3     6     6     8     6     8     6     8     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7    10     7    10     8    11     8    11     9    12     9    12     9    12     9    12     9    12     9    12     8    11     8    11     8    11     8    11     8    11     8    11     8    11     8    11     8    11     8    11     7    10     7    10     7    10     7    10     7    10     8    11     8    11     8    11     8    11     8    11     8    11     8    11     8    11     8    11     8    10     9    11     9    10     9    10     9    10     9    11     9    11     9    11     9    11     8    11     8    11     8    11     8    11     8    11     8    10     8    10     8    10     8    10     8    10     8    11     8    11     9    11     9    10     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     8     8     8     8     8     8     7     7     7     7     7     7     8     8     8     8     8     8     9     9     9     9     9     9    10    10    10    10    10    10    10    10    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10     9    10     9     9     9     9     9     9     8     8     8     8     8     8     8     8    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     7     7     7     7     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     6     3     6     2     7     4     7     4     7     5     7     5     7     5     7     4     6     4     6     4     6     4     6     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     5     4     5     4     5     4     4     4     4     4     4     3     5     3     5     4     4     6     6     6     7     7     8     7     8     7     8    11    13    13    15    14    15    30    33    30    33    35    39    40    40    40    40    40    40    41    41    41    41    41    41    41    41    41    41    41    42    44    44    46    46    46    46    45    45    45    45    45    45    45    45    46    46    45    46    46    47    46    46    46    46    46    46    46    46    46    46    45    46    46    46    45    46    46    46    46    46    46    46    45    46    45    46    44    46    45    46    45    46    45    46    43    46    43    46    43    46    42    45    43    45    42    44    42    44    42    44    42    43    42    43    42    43    42    43    42    43    42    43    42    43    42    43    41    42    41    42    40    41    38    41    38    41    38    41    38    41     3     5     3     3
  5   1   2      ests                                 Xt7.1-CABD8556.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTGGGGAAGTGGAAAATCATTCCTGCTTAAAAAGCTTGAAGATGAGATGAAGACTTTTGCAGGCCAGCAGATAGAACCTCTGTTCCAGTTCTCTTGGCTCATTGTGTTTCTTATCCTGATGCTCTGCAGTACCATAGGATTGCTGCTTTCATTTACAGTTGATCCAAAACTGGGCATATCTGTGGCTCTCAGCTTGTTGACTGTACTCTACATATTCTTTGCTGCTGTCTACTTTGGAGGAAGACGAGAAGGAGAAAACTGGAACTGGGCTTGGGTGCTAAGTACTAGACTGGCAAGACAGATCGGATACCTTGAACTACTTCTAAAACTCATGTTCGTAAATCCACCAGAACTTCCTGAGCAAACCACTAAAGCTTTGCCAGTTCGGTTCCTTTTCACTGACTACAATCGACTCTCTAGTGTAGGGGGAGAAACATCCATGGCTGAAATGATAGCCACGCTCTCTGATGCATGTGAGAGGGAGTTTGGTTTCTTAGCCACACGGCTCTTCAGAGTGTTTAAGACAGAGGAAACACAAGGAAAGAAGAAATGGAAGAAGACTTGTTGTCTCCCCTCCTTTGTAATCTTCATTTTCATTATGCTGTGTATCTTTGCCGGCGTTCTCCTGCTGGCGATCTTTAAAGTGGATCCCAAGAATATGACTGTGAATGCCATCCTTATTGCTGTGGCTTGTGTGGTGGGCCTAGTGTTTGTGCTAAATTGCCGCACGTGGTGGCAAGTGATGGATTCTATACTTAACTCTCAGCGCAAACGGCTCCACGGTGCCGCTTCCAAACTGCACAAACTGAAAAGCGAAGGATTTATGAAGGTTTTGAAATGGGAAGTAGAGTTGATGGCTAAAATGGCAAAAACCATAGATAGTTTCACCCAAAACCAGACCAGGCTTGTGGTGATAATTGATGGGCTGGATGCCTGTGAGCAGGATAAAGTTCTGCATATGCTAGACACGGTTCGGATCCTGTTTTCCAAGGGGCCATTTATTGCTATTTTTGCAAGTGACCCTCACATTATTATCAAGGCCATCAATCAAAATCTCAACAGCGTGTTGAGAGATTCTAACATTAATGGGCACGACTATATGCGCAACATTGTCCACCTGCCCGTCTTTCTCAACAGTCGTGGTCTCAGCAATGCCAAAAAGCTGTGCTCGATATCTGCCACCAATGGAGATGTGGGGTGTATGGAGAGTGGTTCAGGAGGGCATGAAGACCTTGATAGAAGGGTCTCCCAGCACAGCTTGGCAGAGGCTTCAAAACTTGGCAGCAAAACTGCTCTGAACAGAAGAGATACCTATAGAAGAAGGCAGATGCAGCGCACCATAACACGACAGATGTCCTTTGACCTAACCAAGCTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACTAAAGAAAGAAATGAACATGAACTTTGGCGACTGGCACCTATTCAAGAGCGCACTTCACGAAATGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGATGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACACCCCTCTCCTTAAGGATGGAAAAGAAAAAAAGACTGACTGCAGTCTGGATAAGAAAGCAGGAGAGCTTGCCTCTGAGCCCATAATGGCCTACAGTAAAGCAAAGGAGTACCTTTCAGATGCCATCCTGAACAAGAAAGATTCTTCTGACTCCGGCATGAGATCCAATGAAAGTTCTCCCAATCACTCTCTCAATAATGAAGGCGGTGACGATTCCCAGCTTGAAAAGACAAATCTTATTGAGCTGGAAGATGGGCGCTTACGAGGAAAGAGAGGAATACCCAACAGTCTGAGTGGCCTCCAGGACTCGGAAATCGCACGCATGTCAATCTGCTCCGACAAGAAAAGTCCTTCAGAAAGTAGTCTGATTGCCAGCAGCCCTGAGGAGAACTGGCCTTCAAGTCAGAAGTCCTTCAATCTGAACCGTACGCCAAGTACAGTCACGCTCAACAACAATACCGCCAACCAAAACTTTGAAGAGACAGAAGATGCTAAAAACGATTCTCCAATCATAGTAGTTCCTGGGTCAAGTCCTGTTCAAAACGAGAACCTGAAGCGTTTGACTCCCAAGCGAGGTCAGCGTGCAGGGTACAGCCGTTTGGCCAAAGAAGCTTCAGAGCTAAACCCTGTGGCTTCCTTTGATGCATCCGGCTTTGCAGAAGAAAGA
  5   1   2      ests                                 Xt7.1-CABD2373.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTTTTTGCAATGAACTAGAAAGTATTCAGATAAAAGAATAAATCTGGAAAAAAAAAGGGTTGTAACTGGCTGTAGCTTAGCGTCCCACTGAAGCCTGGGAGAGAAGAATGAAGAGCAGCTTCAGCATGACGAGAAGGAACCACGGACTCATCATTCTCTAGGCAGAGCTTCAGAGGATATAACTATAAACTCTAATACCCAAACTTTAAAATGATATTTAATATCTGGTTGCCAAAATGTAGGAGCTCTCCTTTGGGTTGGGCTTGGATATTTTCTCCATCCCTATGAAATACAGGGAGGTAGACTGACTTTGAAATCAATTAATCTGACAATTCTAAACTGATCAAATTGGATTGCATTTAGAAAGACTCTAAATTACTTGAATTAGATCAATATTGATTGACGGCACTGGAAAAACATGTCCACCGCCTTCATACCCTAAACCAGTAAACTCAGGAGCAATATGTTGCTCACCGCCCCATTTGATGTTTCTCCCAGTGGCCTCAAAGCAGGTGCCCATTTTTAAGTCTCTGGCTTGGAGGCAAGTTTTAGAAGAGACACCGTTTTCTCCAATCAGAGCCTCCTGCAGGCCAGCAGTCCACATGGGGTACCAACTAGCCAATCACAGCCCTTATTCAGCATCCACAAAATATGTTTTCATGCTTGTGTGGCTCCCCAACACTTTCTACAGCTGAGTGTAGCTCATGAGTACAAAAGGTTGGGGATCTCTGTCTTTGGCCTGTAGTTCTGAGATGACAAATAAGCTATTGACAATGATACGTACTGATTTGTGACCCTCCCCTGGAGGATTCTTCATTCAACCTTTGCTAAGTCTGCCCCTAATTCTTTCATTAAGCTAGTAGTCGTGTTCACTTCCCATTTTGCTTTGTCTAGACTGCCTTGACATTTGTATCCCCTGGATTACAGAGGTTCTGTTTCATTGATGTTCTCTTCGGTTTCACCTGCTGACAAGCATTTAAACACAGTTCAGGAACATTGTATCTCTAACCTGAGAGAATAATTGCCATTATGCGTGTAAGGCTGATGGCTTGATACAACAGCCCGGTTCATTTCAACACCAAAAACTGCTGGCTGTGGCTTCTTTGCACCTGAAACCTCTTCTGAGCTTGCCATTCAAAAAAATGGGAGGCAGTTGGTGGAACGTTCCAGGTAGCCTAGAAGTGCCCTGTGTGTCATAGCNCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCAAAAAAAAAA
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAACAATGGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -TA---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --T-T-------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 1e-018     XP_001180502.1 PREDICTED: similar to KIAA1250 protein, partial [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 1e-090     NP_001040942.1 Temporarily Assigned Gene name family member (tag-144) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-108     NP_726060.2 CG30387-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 0          XP_699336.1 PREDICTED: similar to kinase D-interacting substance of 220 kDa [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 0          XP_702182.1 PREDICTED: hypothetical protein XP_697090 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_065789.1 kinase D-interacting substance of 220 kDa [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_419939.2 PREDICTED: similar to KIAA1250 protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 0          XP_001004865.1 PREDICTED: kinase D-interacting substance of 220 kDa isoform 16 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABD2373.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------ATG------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------ATG------------------ATG---ATG------------------------------------------ATG---------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------TAA------------TAG---------------------------ATG---------------ATG------------------------------TAG------------------TAA---TAA------------------TAA---------TAA---------------ATGTAG------------------------------------------ATG------------------TGA---TGA------------TGA------TAA---------------------------------TAA------TGA------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------TGA---TAG---ATG---------------------------------------------ATG------------------ATG---------------TGA---------------------------------------------------------------TAGTAG------------------------------------------------------------------------------TGA---------------------------------TAA------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------TAG---------TGA---------------------------------------------------------------------------------------ATG------------------------------------------TAG---------TAG------------------------------------------------------TGA---TAG---------------------------TAG---------------TGATAG---------------ATG---------------------------------------------------------------------------------------TGA---------------------------TAG------------TAG------------------------------------------ATG---------------------TAA------------------------------------------------------------------------------------------------------TAG---------------------------TGA---TAA------TAG---------------TAATGA------------------------TAG------------------------------TGA------ATG---------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2      ests                                 Xt7.1-CABD8556.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTGGGGAAGTGGAAAATCATTCCTGCTTAAAAAGCTTGAAGATGAGATGAAGACTTTTGCAGGCCAGCAGATAGAACCTCTGTTCCAGTTCTCTTGGCTCATTGTGTTTCTTATCCTGATGCTCTGCAGTACCATAGGATTGCTGCTTTCATTTACAGTTGATCCAAAACTGGGCATATCTGTGGCTCTCAGCTTGTTGACTGTACTCTACATATTCTTTGCTGCTGTCTACTTTGGAGGAAGACGAGAAGGAGAAAACTGGAACTGGGCTTGGGTGCTAAGTACTAGACTGGCAAGACAGATCGGATACCTTGAACTACTTCTAAAACTCATGTTCGTAAATCCACCAGAACTTCCTGAGCAAACCACTAAAGCTTTGCCAGTTCGGTTCCTTTTCACTGACTACAATCGACTCTCTAGTGTAGGGGGAGAAACATCCATGGCTGAAATGATAGCCACGCTCTCTGATGCATGTGAGAGGGAGTTTGGTTTCTTAGCCACACGGCTCTTCAGAGTGTTTAAGACAGAGGAAACACAAGGAAAGAAGAAATGGAAGAAGACTTGTTGTCTCCCCTCCTTTGTAATCTTCATTTTCATTATGCTGTGTATCTTTGCCGGCGTTCTCCTGCTGGCGATCTTTAAAGTGGATCCCAAGAATATGACTGTGAATGCCATCCTTATTGCTGTGGCTTGTGTGGTGGGCCTAGTGTTTGTGCTAAATTGCCGCACGTGGTGGCAAGTGATGGATTCTATACTTAACTCTCAGCGCAAACGGCTCCACGGTGCCGCTTCCAAACTGCACAAACTGAAAAGCGAAGGATTTATGAAGGTTTTGAAATGGGAAGTAGAGTTGATGGCTAAAATGGCAAAAACCATAGATAGTTTCACCCAAAACCAGACCAGGCTTGTGGTGATAATTGATGGGCTGGATGCCTGTGAGCAGGATAAAGTTCTGCATATGCTAGACACGGTTCGGATCCTGTTTTCCAAGGGGCCATTTATTGCTATTTTTGCAAGTGACCCTCACATTATTATCAAGGCCATCAATCAAAATCTCAACAGCGTGTTGAGAGATTCTAACATTAATGGGCACGACTATATGCGCAACATTGTCCACCTGCCCGTCTTTCTCAACAGTCGTGGTCTCAGCAATGCCAAAAAGCTGTGCTCGATATCTGCCACCAATGGAGATGTGGGGTGTATGGAGAGTGGTTCAGGAGGGCATGAAGACCTTGATAGAAGGGTCTCCCAGCACAGCTTGGCAGAGGCTTCAAAACTTGGCAGCAAAACTGCTCTGAACAGAAGAGATACCTATAGAAGAAGGCAGATGCAGCGCACCATAACACGACAGATGTCCTTTGACCTAACCAAGCTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACTAAAGAAAGAAATGAACATGAACTTTGGCGACTGGCACCTATTCAAGAGCGCACTTCACGAAATGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGATGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACACCCCTCTCCTTAAGGATGGAAAAGAAAAAAAGACTGACTGCAGTCTGGATAAGAAAGCAGGAGAGCTTGCCTCTGAGCCCATAATGGCCTACAGTAAAGCAAAGGAGTACCTTTCAGATGCCATCCTGAACAAGAAAGATTCTTCTGACTCCGGCATGAGATCCAATGAAAGTTCTCCCAATCACTCTCTCAATAATGAAGGCGGTGACGATTCCCAGCTTGAAAAGACAAATCTTATTGAGCTGGAAGATGGGCGCTTACGAGGAAAGAGAGGAATACCCAACAGTCTGAGTGGCCTCCAGGACTCGGAAATCGCACGCATGTCAATCTGCTCCGACAAGAAAAGTCCTTCAGAAAGTAGTCTGATTGCCAGCAGCCCTGAGGAGAACTGGCCTTCAAGTCAGAAGTCCTTCAATCTGAACCGTACGCCAAGTACAGTCACGCTCAACAACAATACCGCCAACCAAAACTTTGAAGAGACAGAAGATGCTAAAAACGATTCTCCAATCATAGTAGTTCCTGGGTCAAGTCCTGTTCAAAACGAGAACCTGAAGCGTTTGACTCCCAAGCGAGGTCAGCGTGCAGGGTACAGCCGTTTGGCCAAAGAAGCTTCAGAGCTAAACCCTGTGGCTTCCTTTGATGCATCCGGCTTTGCAGAAGAAAGA
                                                  Xt7.1-CHK-1008227925                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGTGGAAAATCATTCCTGCTTAAAAAGCTTGAAGATGAGATGAAGACTTTTGCAGGCCAGCAGATAGAACCTCTGTTCCAGTTCTCTTGGCTCATTGTGTTTCTTATCCTGATGCTCTGCAGTACCATAGGATTGCTGCTTTCATTTACAGTTGATCCAAAACTGGGCATATCTGTGGCTCTCAGCTTGTTGACTGTACTCTACATATTCTTTGCTGCTGTCTACTTTGGAGGAAGACGAGAAGGAGAAAACTGGAACTGGGCTTGGGTGCTAAGTACTAGACTGGCAAGACAGATCGGATACCTTGAACTACTTCTAAAACTCATGTTCGTAAATCCACCAGAACTTCCTGAGCAAACCACTAAAGCTTTGCCAGTTCGGTTCCTTTTCACTGACTACAATCGACTCTCTAGTGTAGGGGGAGAAACATCCATGGCTGAAATGATAGCCACGCTCTCTGATGCATGTGAGAGGGAGTTTGGTTTCTTAGCCACACGGCTCTTCAGAGTGTTTAAGACAGAGGAAACACAAGGAAAGAAGAAATGGAAGAAGACTTGTTGTCTCCCCTCCTTTGTAATCTTCATTTTCATTATGCTGTGTATCTTTGCCGGCGTTCTCCTGCTGGCGATCTTTAAAGTGGATCCCAAGAATATGACTGTGAATGCCATCCTTATTGCTGTGGCTTGTGTGGTGGGCCTAGTGTTTGTGCTAAATTGCCGCACGTGGTGGCAAGTGATGGATTCTATACTTAACTCTCAGCGCAAACGGCTCCACGGTGCCGCTTCCAAACTGCACAAACTGAAAAGCGAAGGATTTATGAAGGTTTTGAAATGGGAAGTAGAGTTGATGGCTAAAATGGCAAAAACCATAGATAGTTTCACCCAAAACCAGACCAGGCTTGTGGTGATAATTGATGGGCTGGATGCCTGTGAGCAGGATAAAGTTCTGCATATGCTAGACACGGTTCGGATCCTGTTTTCCAAGGGGCCATTTATTGCTATTTTTGCAAGTGACCCTCACATTATTATCAAGGCCATCAATCAAAATCTCAACAGCGTGTTGAGAGATTCTAACATTAATGGGCACGACTATATGCGCAACATTGTCCACCTGCCCGTCTTTCTCAACAGTCGTGGTCTCAGCAATGCCAAAAAGCTGTGCTCGATATCTGCCACCAATGGAGATGTGGGGTGTATGGAGAGTGGTTCAGGAGGGCATGAAGACCTTGATAGAAGGGTCTCCCAGCACAGCTTGGCAGAGGCTTCAAAACTTGGCAGCAAAACTGCTCTGAACAGAAGAGATACCTATAGAAGAAGGCAGATGCAGCGCACCATAACACGACAGATGTCCTTTGACCTAACCAAGCTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACTAAAGAAAGAAATGAACATGAACTTTGGCGACTGGCACCTATTCAAGAGCGCACTTCACGAAATGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGATGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACACCCCTCTCCTTAAGGATGGAAAAGAAAAAAAGACTGACTGCAGTCTGGATAAGAAAGCAGGAGAGCTTGCCTCTGAGCCCATAATGGCCTACAGTAAAGCAAAGGAGTACCTTTCAGATGCCATCCTGAACAAGAAAGATTCTTCTGACTCCGGCATGAGATCCAATGAAAGTTCTCCCAATCACTCTCTCAATAATGAAGGCGGTGACGATTCCCAGCTTGAAAAGACAAATCTTATTGAGCTGGAAGATGGGCGCTTACGAGGAAAGAGAGGAATACCCAACAGTCTGAGTGGCCTCCAGGACTCGGAAATCGCACGCATGTCAATCTGCTCCGACAAGAAAAGTCCTTCAGAAAGTAGTCTGATTGCCAGCAGCCCTGAGGAGAACTGGCCTTCAAGTCAGAAGTCCTTCAATCTGAACCGTACGCCAAGTACAGTCACGCTCAACAACAATACCGCCAACCAAAACTTTGAAGAGACAGAAGATGCTAAAAACGATTCTCCAATCATAGTAGTTCCTGGGTCAAGTCCTGTTCAAAACGAGAACCTGAAGCGTTTGACTCCCAAGCGAGGTCAGCGTGCAGGGTACAGCCGTTTGGCCAAAGAAGCTTCAGAGCTAAACCCTGTGGCTTCCTTTGATGCATCCGGCTTTGCAGAAGAAAGAGAGAGT
  5   1   2       bld Brn2      in                        CAAJ20010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGATTGCTGTACAGGCCTAACAAGGCAGGAGAGACCCCTTACAATATAGATTGCAGCCATCAAAAGAGCATCCTGACTCAGATATTTGGTGCTAGACACCTTTCCCCCACAGAGTCTGATGGCGATATGCTTGGGTACGATCTGTACAGCAGTGCTCTTGCTGATATTCTCAGTGAGCCCACAATGCAGCCCCCAATCTGTGTTGGATTGTACGCTCAGTGGGGAAGTGGAAAATCATTCCTGCTTAAAAAGCTTGAAGATGAGATGAAGACTTTTGCAGGCCAGCAGATAGAACCTCTGTTCCAGTTCTCTTGGCTCATTGTGTTTCTTATCCTGATGCTCTGCAGTACCATTGGATTGCTGCTTTCATTTACAGTTGATCCAAAACTGGGCATATCTGTGGCTCTCAGCTTGTTGACTGTACTCTACATATTCTTTGCTGCTGTCTACTTTGGAGGAAGACGAGAAGGAGAAAACTGGAACTGGGCTTGGGTGCTAAGTACTAGACTGGCAAGACAGATCGGATACCTTGAACTACTTCTAAAACTCATGTTCGTAAATCCACCAGAACTTCCTGAGCAAACCACTAAAGCTTTGCCAGTTCGGTTCCTTTTCACTGACTACAATCGACTCTCTAGTGTAGGGGGAGAAACATCCATGGCTGANATGATAGCCACGCTCTCTGATGCATGTGAGAGGGAGTTTGGGTTCTTAGCCACACGGCTCTTCAGAGTGTTTAAGACAGAGGAAACACAAGGAAAGAAGAAATGGAAGAAGACTTGTTGTCTCCC
  5   1   2       bld Brn2      in                        CAAJ11666.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTGGGGAAGTGGAAAATCATTTCTGCTTAAAAAGCTTGAAGATGAGATGAAGACTTTTGCAGGCCAGCAGATAGAACCTCTGTTCCAGTTCTCTTGGCTCATTGTGTTTCTTATCCTGATGCTCTGCAGTACCATAGGATTGCTGCTTTCATTTACAGTTGATCCAAAACTGGGCATATCTGTGGCTCTCAGCTTGTTGACTGTACTCTACATATTCTTTGCTGCTGTCTACTTTGGAGGAAGACGAGAAGGAGAAAACTGGAACTGGGCTTGGGTGCTAAGTACTAGACTGGCAAGACAGATCGGATACCTTGAACTACTTCTAAAACTCATGTTCGTAAATCCACCAGAACTTCCTGAGCAAACCACTAAAGCTTTGCCAGTTCGGTTCCTTTTCACTGACTACAATCGACTCTCTAGTGTAGGGGGAGAAACATCCATGGCTGAAATGATAGCCACGCTCTCTGATGCATGTGAGAGGGAGTTTGGTTTCTTAGCCACACGGCTCTTCAGAGTGTTTAAGACAGAGGAAACACAAGGAAAGAAGAAATGGAAGAAGACTTGTTGTCTCCCCTCCTTTGTAATCTTCATTTTCATTATGCTGTGTATCTTTGCCGGCGTTCTCCTGCTGGCGATCTTTAAAGTGGATCCCAAGAATATGACTGTGAATGCCATCCTTATTGCTGTGGCTTGTGTGGTGGGCCTAGTGTTTGTGCTAAATTGCCGCACGTGGTGGCAAGTGATGGATTCTATACTTAACTCTCAGCGCANACGGCTCCACGGTGCCGCTTCCAAACTGCACAAACTGAAAAGCGAAGGATTTATGAAGGTTTTGAAATGGGAAGTAGAGTTAATGGCTAAAATGGC
  5   1   2       bld Te1       in                         CBWN3670.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTCATTGTGTTTCTTATCCTGATGCTCTGCAGTACCATAGGATTGCTGCTTTCATTTACAGTTGATCCAAAACTGGGCATATCTGTGGCTCTCAGCTTGTTGACTGTACTCTACATATTCTTTGCTGCTGTCTACTTTGGAGGAAGACGAGAAGGAGAAAACTGGAACTGGGCTTGGGTGCTAAGTACTAGACTGGCAAGACAGATCGGATACCTTGAACTACTTCTAAAACTCATGTTCGTAAATCCACCAGAACTTCCTGAGCAAACCACTAAAGCTTTGCCAGTTCGGTTCCTTTTCACTGACTACAATCGACTCTCTAGTGTAGGGGGAGAAACATCCATGGCTGAAATGATAGCCACGCTCTCTGATGCATGTGAGAGGGAGTTTGGTTTCTTAGCCACACGGCTCTTCAGAGTGTTTAAGACAGAGGAAACACAAGGAAAGAAGAAATGGAAGAAGACTTGTTGTCTCCCCTCCTTTGTAATCTTCATTTTCATTATGCTGTGTATCTTTGCCGGCGTTCTCCTGCTGGCGATCTTTAAAGTGGATCCCAAGAATATGACTGTGAATGCCATCCTTATTGCTGTGGCTTGTGTGGTGGGCCTAGTGTTTGTGCTAAATTGCCGCACGTGGTGGCAAGTGATGGATTCTATACTTAACTCTCAG
  5   1   2       bld Brn2      in                        CAAJ16561.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTTTTCACTGACTACAATCGACTCTCTAGTGTAGGGGGAGAAACATCCATGGCTGAAATGATAGCCACGCTCTCTGATGCATGTGAGAGGGAGTTTGGGTTCTTAGCCACACGGCTCTTCAGAGTGTTTAAGACAGAGGAAACACAAGGAAAGAAGAAATGGAAGAAGACTTGTTGTCTCCCCTCCTTTGTAATCTTCATTTTCATTATGCTGTGTATCTTTGCCGGCGTTCTCCTGCTGGCGATCTTTAAAGTGGATCCCAAGAATATGACTGTGAATGCCATCCTTATTGCTGTGGCTTGTGTGGTGGGCCTAGTGTTTGTGCTAAATTGCCGCACGTGGTGGCAAGTGATGGATTCTATACTTAACTCTCAGCGCAAACGGCTCCACGGTGCCGCTTCCAAACTGCACAAACTGAAAAGCGAAGGATTTATGAAGGTTTTGAAATGGGAAGTAGAGTTGATGGCTAAAATGGCAAAAACCATAGATAGTTTCACCCAAAACCAGACCAGGCTTGTGGTGATAATTGATGGGCTGGATGCCTGTGAGCAGGATAAAGTTCTGCATATGCTAGACACGGTTCGGATCCTGTTTTCCAAGGGGCCATTTATTGCTATTTTTGCAAGTGACCCTCACATTATTATCAAGGCCATCAATCAAAATCTCAACAGCGTGTTGAGAGATTCTAACATTAATGGGCACGACTATATGCGCAACATTGTCCACCTGCCCGTCTTTCTNCACAGTCGTGGTCTCAGCAATGCCAAAAAGCTGTGCTCGATATCTGC
  5   1   2       bld Brn2      in                        CAAJ13801.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATTCTATACTTAACTCTCAGCGCAAACGGCTCCACGGTGCCGCTTCCAAACTGCACAAACTGAAAAGCGAAGGATTTATGAAGGTTTTGAAATGGGAAGTAGAGTTGATGGCTAAAATGGCAAAAACCATAGATAGTTTCACCCAAAACCAGACCAGGCTTGTGGTGATAATTGATGGGCTGGATGCCTGTGAGCAGGATAAAGTTCTGCATATGCTAGACACGGTTCGGATCCTGTTTTCCAAGGGGCCATTTATTGCTATTTTTGCAAGTGACCCTCACATTATTATCAAGGCCATCAATCAAAATCTCAACAGCGTGTTGAGAGATTCTAACATTAATGGGCACGACTATATGCGCAACATTGTCCACCTGCCCGTCTTTCTCAACAGTCGTGGTCTCAGCAATGCCAAAAAGCTGTGCTCGATATCTGCCACCAATGGAGATGTGGGGTGTATGGAGAGTGGTTCAGGAGGGCATGAAGACCTTGATAGAAGGGTCTCCCAGCACAGCTTGGCAGAGGCTTCAAAACTTGGCAGCAAAACTGCTCTGAACAGAAGAGATACCTATAGAAGAAGGCAGATGCAGCGCACCATAACACGACAGATGTCCTTTGACCTAACCAAGCTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGA
  5   1   2       bld Te3       in                         CAAM4440.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGGCTCCACGGTGCCGCTTCCAAACTGCACAAACTGAAAAGCGAAGGATTTATGAAGGTTTTGAAATGGGAAGTAGAGTTGATGGCTAAAATGGCAAAAACCATAGATAGTTTCACCCAAAACCAGACCAGGCTTGTGGTGATAATTGATGGGCTGGATGCCTGTGAGCAGGATAAAGTTCTGCATATGCTAGACACGGTTCGGATCCTGTTTTCCAAGGGGCCATTTATTGCTATTTTTGCAAGTGACCCTCACATTATTATCAAGGCCATCAATCAAAATCTCAACAGCGTGTTGAGAGATTCTAACATTAATGGGCACGACTATATGCGCAACATTGTCCACCTGCCCGTCTTTCTCAACAGTCGTGGTCTCAGCAATGCCAAAAAGCTGTGCTCGATATCTGCCACCAATGGAGATGTGGGGTGTATGGAGAGTGGTTCAGGAGGGCATGAAGACCTTGATAGAAGGGTCTCCCAGCACAGCTTGGCAGAGGCTTCAAAACTTGGCAGCAAAACTGCTCTGAACAGAAGAGATACCTATAGAAGAAGGCAGATGCAGCGCACCATAACACGACAGATGTCCTTTGACCTAACCAAGCTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACT
  5   1   2       bld Brn2      in                        CAAJ17210.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGATGCCTGTGAGCAGGATAAAGTTCTGCATATGCTAGACACGGTTCGGATCCTGTTTTCCAAGGGGCCATTTATTGCTATTTTTGCAAGTGACCCTCACATTATTATCAAGGCCATCAATCAAAATCTCAACAGCGTGTTGAGAGATTCTAACATTAATGGGCACGACTATATGCGCAACATTGTCCACCTGCCCGTCTTTCTCAACAGTCGTGGTCTCAGCAATGCCAAAAAGCTGTGCTCGATATCTGCCACCAATGGAGATGTGGGGTGTATGGAGAGTGGTTCAGGTTACCCATTGCCTTTCTTCTGATTCCTTGTTTTATACAGTATCTTGCTTTATTTACCCTTATTTTACACACACCCACAATGTATGTGCCAATGAGGAACTAATTATGTAATTGTGGGCAGTTTATGTACAAATGCCACTTAGCCTCTATTTCACATCATCTGATGCCATTCAGAGAGATATATGGAGCTCCTATGATGCTGGGGGCTGTAATAATCATTGTAGGGCCACTACCATGCTCCATTTGGAATTACCAGCTCTACATCATTGATTTTAGTTAACATATTCTcctcagagatcacctgacaggaaataaagcagctttaactgtgccaggaagaagcatgagcgtaaaaggctgagctctgggcattcattggccgacttaacctagcatgtatgtgtgcccttggattgtttgtgagcacagtgngcagcccttagtacttggcaactttttttatttgggattatatgatagcacatactactagaaaagtatatttttatgaaaatggtttatttagatgaagcagTGGGCTGTTTTATGTGATAT
  5   1   2       bld Brn4      in                         CAAL6845.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTCTGCATATGCTAGACACGGTTCGGATCCTGTTTTCCAAGGGGCCATTTATTGCTATTTTTGCAAGTGACCCTCACATTATTATCAAGGCCATCAATCAAAATCTCAACAGCGTGTTGAGAGATTCTAACATTAATGGGCACGACTATATGCGCAACATTGTCCACCTGCCCGTCTTTCTCAACAGTCGTGGTCTCAGCAATGCCAAAAAGCTGTGCTCGATATCTGCCACCAATGGAGATGTGGGGTGTATGGAGAGTGGTTCAGGTTACCCATTGCCTTTCTTCTGATTCCTTGTTTTATACAGTATCTTGCTTTATTTACCCTTATTTTACACACACCCACAATGTATGTGCCAATGAGGAACTAATTATGTAATTGTGGGCAGTTTATGTACAAATGCCACTTAGCCTCTATTTCACATCATCTGATGCCATTCAGAGAGATATATGGAGCTCCTATGATGCTGGGGGCTGTAATAATCATTGTAGGGCCACTACCATGCTCCATTTGGAATTACCAGCTCTACATCATTGATTTTAGTTAACATGTTCTcctcagagatcacctgacaggaaataaagcagctttaactgtgccaggaagaagcatgagcgtaaaaggctgagctctgggcattcattggccgacttaacctagcatgtatgtgtgcccttggattgtttgtgagcacagtgggcagcccttagtacttggcaactttttttatttgggattatatgatagcacatactactagaaaagtatatttttatgaaaatggtttatttagatgaagcagTGNGCTGTTTTATGTGATATATTTTTATGGAATGTTC
  5   1   2       bld Te3                                  CAAM5578.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   tagcacatactactagaaaagtatatttttatgaaaatggtttatttagatgaagcagTGGGCTGTTTTATGTGATATATTTTTATGGAATGTTCAGGGGTTTCTTTGTAGTAATGGGATTTTCTTTGTCTTACTAGGAGGGCATGAAGACCTTGATAGAAGGGTCTCCCAGCACAGCTTGGCAGAGGCTTCAAAACTTGGCAGCAAAACTGCTCTGAACAGAAGAGATACCTATAGAAGAAGGCAGATGCAGCGCACCATAACACGACAGATGTCCTTTGACCTAACCAAGCTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATNCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGAC
  5   1   2       bld Brn3      in                         CAAK5835.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGACTATATGCGCAACATTGTCCACCTGCCCGTCTTTCTCAACAGTCGTGGTCTCAGCAATGCCAAAAAGCTGTGCTCGATATCTGCCACCAATGGAGATGTGGGGTGTATGGAGAGTGGTTCAGGAGGGCATGAAGACCTTGATAGAAGGGTCTCCCAGCACAGCTTGGCAGAGGCTTCAAAACTTGGCAGCAAAACTGCTCTGAACAGAAGAGATACCTATAGAAGAAGGCAGATGCAGCGCACCATAACACGACAGATGTCCTTTGACCTAACCAAGCTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAAC
  5   1   2       bld Te4       in                          CAAN572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCATGAAGACCTTGATAGAAGGGTCTCCCAGCACAGCTTGGCAGAGGCTTCAAAACTTGGCAGCAAAACTGCTCTGAACAGAAGAGATACCTATAGAAGAAGGCAGATGCAGCGCACCATAACACGACAGATGTCCTTTGACCTAACCAAGCTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGCCATTCTTTGCCCTCATGTTTACCTGCC
  5   1   2       bld Brn2      in                        CAAJ11307.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATGAAGACCTTGATAGAAGGGTCTCCCAGCACAGCTTGGCAGAGGCTTCAAAACTTGGCAGCAAAACTGCTCTGAACAGAAGAGATACCTATAGAAGAAGGCAGATGCAGCGCACCATAACACGACAGATGTCCTTTGACCTAACCAAGCTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGGCTACCAGCAGCAGCGT
  5   1   2       bld Brn2      in                        CAAJ19023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCAGCACAGCTTGGCAGAGGCTTCAAAACTTGGCAGCAAAACTGCTCTGAACAGAAGAGATACCTATAGAAGAAGGCAGATGCAGCGCACCATAACACGACAGATGTCCTTTGACCTAACCAAGCTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTATCATCGGNCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTA
  5   1   2       bld Te3       in                        CAAM15722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGCCATTCTTTGCACCTCATGTTTACCTGCCAAGGTATTACTTTGGCAATCCCCAACATCCCATGTCACGCCCATCTTTTAAACACAGTGTGTCCAGAGATCAGAACAATGGCCTAGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGANAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGGTCTGACGCAGTGCACCATGGATGAACTANAGAAAGAAATGAACATGAACTTTGNCGACT
  3   1   2       bld Brn4      in                         CAAL6845.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGCTGGTTACAGAGGATTGGTTCAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACT
  3   1   2       bld Brn3 5g3  out                       CAAK11310.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTGACATCAGCCCTCAGACTATGAGAAGGCTATTGAATATTGTATCTGTCACAGGACGACTACTCAGGGCCAACCAGATTAGTTTTCACTGGGACAGACTGGCCTCCTGGATCAACCTGACAGAGCAGTGGCCATACAGAACATCATGGCTGATCCTGTACCTGGAGGAAACAGAGGGTGTTCCTGATCAGTCTACTTTGAAAACAATTTATGAAAGAATTTCGAAAAACATTCCCACAACTAAAGATGTGGAACCGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACT
  5   1   2       bld Brn3      in                         CAAK7569.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCTACTTGAAATTGACAGTGACATCAGAAGTTTTGAGGTCTTTTTGGCCTCTAGGACTCCAGTCCTCATAGCAAGAGATGTGAAAACCTTTCTGCCATGCACAGTCAATTTGGATCCCAAGCTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACTAAAGAAAGAAATGAACATGAACTTTGGCGACTGGCACCTATTCAAGAGCGCACTTCACGAAATGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGC
  5   1   2      seed Brn2      in                        CAAJ11296.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCAGAGAAATCATTGCAGATGTTCGGGCAGCAAGAGACCAGATGAATATTGGAGGTTTCCCTTATCCCACACTTCCCTTGCAAGATGCCCCACCCAGGGCAACCTCTGTGTTCAGCCAGCCATCCTCTGTCTGCTCCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACTAAAGAAAGAAATGAACATGAACTTTGGCGACTGGCACCTATTCAAGAGCGCACTTCACGAAATGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCAC
  5   1   2       bld TpA                            TTpA038j16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCGGGCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGCCATTCTTTGCACCTCATGTTTACCTGCCAAGGTATTACTTTGGCAATCCCCAACATCCCATGTCACGCCCATCTTTTAAACACAGTGTGTCCAGAGATCAGAACAATGGCCTAGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACTAAAGAAAGAAATGAACATGAACTTTGGCGACTGGCACCTATTCAAGAGCGCACTTCACGAAATGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGNCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCANNGTGGTACTACAT
  5   1   2       bld Brn2      in                        CAAJ24148.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCATCTTCATTTAACGGACCCTTCCCTGCTGGGGTAATGTCACCACAGCCACCAAGCAGCTATTACAGTGGGATGACTGGACCACAACATCCCTTTTACAATCGGGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACTAAAGAAAGAAATGAACATGAACTTTGGCGACTGGCACCTATTCAAGAGCGCACTTCACGAAATGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACANATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTT
  3  -1   2       bld Lun1      in                         CABD8556.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGGGCGAGAGGCAGAGATCAGAACAATGGCCTAGCTACCAGCAGCAGCGTAGCAGGAGCACACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACTAAAGAAAGAAATGAACATGAACTTTGGCGACTGGCACCTATTCAAGAGCGCACTTCACGAAATGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGACGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTAC
  5   1   2       bld Brn3      in                         CAAK6812.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACTCTTCTGCTTTAGCCGCCATGAACGTGGACGGTGTGTGCGAGAAGCTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACTAAAGAAAGAAATGAACATGAACTTTGGCGACTGGCACCTATTCAAGAGCGCACTTCACGAAATGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGATGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATG
  5   1   2       bld Brn2      in                        CAAJ16066.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGAAAGGCATAGACGGGATTGAACAAAGTATGCTGCCTCAGTACACTGCCACCATACGCAAGGCAAATATCAATGGGCGGGTTCTGACGCAGTGCACCATGGATGAACTAAAGAAAGAAATGAACATGAACTTTGGCGACTGGCACCTATTCAAGAGCGCACTTCACGAAATGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGATGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAAGGACTGGACTGCGTTA
  3   1   2       bld Te4       in                          CAAN572.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGGAGCTCTGATACCCAAATACAACCTGAGGAGGGCCCGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGATGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACACCCCTCTCCTTAAGGATGG
  5   1   2       bld Brn2      in                        CAAJ20556.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGATGGTAGGTGAGCCCAGCAGAATGGCGCCACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGATGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACACCCCTCTCCTTAAGGATGGAAAAG
  5   1   2       bld Tad5                                 XZT24235.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGCAGTGAGGTTACCAGACGCCCCGTTGCCACTACAGAGCTTCCTCATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGACGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACACCCCTCTCCTTAAGGATGGAAAAGA
  3   1   2       bld Te4       out                        CAAN8499.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATACCGAGTTGGCCGGGCAGAATTATGACTTCAGCTTCAGCTTTGAAGATCTAAACACACTTGGTTTTGAGGAGTCAAATCGCAACATGGCCTGGCAGGGACGGGCACACAGGACACCAAGCCTTTCCAGTATTAATTCCCAAGAATCTAGTAATGAAATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGATGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACACCCCTCTCCTTAAGGATGG
  5   1   2       bld Te3       in                        CAAM13960.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATCACAAGGCTCACAGATAAAGTGCAGGCAGAATATAGAGATGCCTATAGGGAGTACATTTCCCAGATGTCACAAATTGAGGGTGCTGTAAGCTCTGTCAGTGGTAGGTCTTCTCCATTAAGCTCAGGTGGTTACTACATAGGACAGAGCACATCGGTGAGTTCTATTCACTCTGCTTCAGAACAGGACAAAATGAAAGATGGAGAACTAAAGCATGAAGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACACCCCTCTCCTTAAGGATGGAAAAGAAAAAAAGACTGACTGCAGTCTGGATAAGAAAGCAGGAGAGCTTGCCTCTGAGCCCATAATGGCCTACAGTAAAGCAAAGGAGTACCTTTCAGATGCCATCCTGAACAAGAAAGATTCTTCTGACTCCGGCATGAGATCCAATGAAAGTTCTCCCAATCACTCTCTCAATAATGAAGGCGGTGACGATTCCCAGCTTGAAAAGACAAATCTTATTGAGCTGGAAGATGGGCGCTTACGAGGAAAGAGAGGAATACCCAACAGTCTGAGTGGCCTCCAGGACTCGGAAATCGCACGCATGTCAATCTGCTC
  3   1   2       bld BrSp      in                     EC2BBA20BE12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACAC
  5   1   2       bld BrSp      in                     EC2BBA20BE12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAGGGACGGAAGCCATTTTTGATGAAGAGAACGGATGTTGTTGACTATACGTCATCAACTGTTTCCACTACTGATGCTTCTCCGCTTGATCCTATTACTGAAGAAGATGAAAAATCAGATCAGTCGGGATCTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACACCCCTCTCCTTAAGGATGGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5      in                         XZT61496.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTAAGCTTCTGTCTACCAAGAAGCCAGCTGAAAGATCTAGCCTCTTCCAGGCAACAGATTTGAAACTGAAAGGAACTGGACTGCGTTACCAGAAACTTCCAAGTGATGAAGATGAGTCCGGGACAGAGGAGTCCGATAACACCCCTCTCCTTAAGGATGGAAAAGAAAAAAAGACTGACTGCAGTCTGGATAAGAAAGCAGGAGAGCTTGCCTCTGAGCCCATAATGGCCTACAGTAAAGCAAAGGAGTACCTTTCAGATGCCATCCTGAACAAGAAAGATTCTTCTGACTCCGGCATGAGATCCAATGAAAGTTCTCCCAATCACTCTCTCAATAATGAAGGCGGTGACGATTCCCAGCTTGAAAAGACAAATCTTATTGAGCTGGAAGATGGGCGCTTACGAGGAAAGAGAGGAATACCCAACAGTCTGAGTGGCCTCCAGGACTCGGAAATCGCACGCATGTCAATCTGCTCCGACAAGAAAAGTCCTTCAGAAAGTAGTCTGATTGCCAGCAGCCCTGAGGAGAACTGGCCTTCAAGTCAGAAGTCCTTCAATCTGAACCGTACGCCAAGTACAGTCACGCTCAACAACAATACCGCCAACCAAAACTTTGAAGAGACAGAAGATGCTAAAAACGATTCTCCAATCATAGTAGTTCCTGGGTCAAGTCCTGTTCAAAACGAGAACCTGAAGCGTTTGACTCACAAGCGAGGTCAGCGTGCAGGGTACAGCCGTCTGGCCAAAGAAGCTTCAGAGCTAAACACTGTGGCTTCCTCTGATGCATCCGGCTTTGCAGAAGAAAGAGAGAAAAGTATTCAGATAAAAGAATAAATCTGGAAAAAAAAAGGGGTGTAACTGGCTGTAGCTTAGCGTCCCACTG
  3   1   2       bld Brn2      in                        CAAJ16066.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGAAAGAGAGGAATACCCAACAGTCTGAGTGGCCTCCAGGACTCGGAAATCGCACGCATGTCAATTTGCTCCGACAAGAAAAGTCCTTCAGAAAGTAGTCTGATTGCCAGCAGCCCTGAGGAGAACTGGCCTTCAAGTCAGAAGTCCTTCAATTTGAACCGTACGCCAAGTACAGTCACGCTCAACAACAATACCGCCAACCAAAACTTTGAAGAGACCGAAGATGCTAAAAACGATTCTCCAATCATAGTAGTTCCTGGGTCAAGTCCTGTTCAAAACGAGAACCTGAAGCGTTTGACTCCCAAGCGAGGTCAGCGTGCAGGGTACAGCCGTTTGGCCAAAGAAGCTTCAGAGCTAAACCCTGTGGCTTCCTTTGATGCATCCGGCTTTGCAGAAGAAAGAGAGAGTTTCCTTTAAACGGGGAATCAGAAGTCCCTTTTTCTTCCTCCCCTCCATTTTTGCTTTTACTTTTATTCATCATTTATTTGCCAATCTCCCTCAAGCCTAAAAAATTTCCCCTATTGTGATCCTTAATTTTTTTTTTTTTTTTTTTTGCAATGAACTAGAAAGTATTCAGATAAAAGAATAAATCTGGAAAAAAAAAGGGTTGTAACTGGCTGTAGCTTAGCGTCCCCCTGAAGCCTGGGGGGG
  5   1   2      ests                                 Xt7.1-CABD2373.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTTTTTGCAATGAACTAGAAAGTATTCAGATAAAAGAATAAATCTGGAAAAAAAAAGGGTTGTAACTGGCTGTAGCTTAGCGTCCCACTGAAGCCTGGGAGAGAAGAATGAAGAGCAGCTTCAGCATGACGAGAAGGAACCACGGACTCATCATTCTCTAGGCAGAGCTTCAGAGGATATAACTATAAACTCTAATACCCAAACTTTAAAATGATATTTAATATCTGGTTGCCAAAATGTAGGAGCTCTCCTTTGGGTTGGGCTTGGATATTTTCTCCATCCCTATGAAATACAGGGAGGTAGACTGACTTTGAAATCAATTAATCTGACAATTCTAAACTGATCAAATTGGATTGCATTTAGAAAGACTCTAAATTACTTGAATTAGATCAATATTGATTGACGGCACTGGAAAAACATGTCCACCGCCTTCATACCCTAAACCAGTAAACTCAGGAGCAATATGTTGCTCACCGCCCCATTTGATGTTTCTCCCAGTGGCCTCAAAGCAGGTGCCCATTTTTAAGTCTCTGGCTTGGAGGCAAGTTTTAGAAGAGACACCGTTTTCTCCAATCAGAGCCTCCTGCAGGCCAGCAGTCCACATGGGGTACCAACTAGCCAATCACAGCCCTTATTCAGCATCCACAAAATATGTTTTCATGCTTGTGTGGCTCCCCAACACTTTCTACAGCTGAGTGTAGCTCATGAGTACAAAAGGTTGGGGATCTCTGTCTTTGGCCTGTAGTTCTGAGATGACAAATAAGCTATTGACAATGATACGTACTGATTTGTGACCCTCCCCTGGAGGATTCTTCATTCAACCTTTGCTAAGTCTGCCCCTAATTCTTTCATTAAGCTAGTAGTCGTGTTCACTTCCCATTTTGCTTTGTCTAGACTGCCTTGACATTTGTATCCCCTGGATTACAGAGGTTCTGTTTCATTGATGTTCTCTTCGGTTTCACCTGCTGACAAGCATTTAAACACAGTTCAGGAACATTGTATCTCTAACCTGAGAGAATAATTGCCATTATGCGTGTAAGGCTGATGGCTTGATACAACAGCCCGGTTCATTTCAACACCAAAAACTGCTGGCTGTGGCTTCTTTGCACCTGAAACCTCTTCTGAGCTTGCCATTCAAAAAAATGGGAGGCAGTTGGTGGAACGTTCCAGGTAGCCTAGAAGTGCCCTGTGTGTCATAGCNCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCAAAAAAAAAA
                                                  Xt7.1-CHK-1008225308                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTGCAATGAACTAGAAAGTATTCAGATAAAAGAATAAATCTGGAAAAAAAAAGGGTTGTAACTGGCTGTAGCTTAGCGTCCCACTGAAGCCTGGGAGAGAAGAATGAAGAGCAGCTTCAGCATGACGAGAAGGAACCACGGACTCATCATTCTCTAGGCAGAGCTTCAGAGGATATAACTATAAACTCTAATACCCAAACTTTAAAATGATATTTAATATCTGGTTGCCAAAATGTAGGAGCTCTCCTTTGGGTTGGGCTTGGATATTTTCTCCATCCCTATGAAATACAGGGAGGTAGACTGACTTTGAAATCAATTAATCTGACAATTCTAAACTGATCAAATTGGATTGCATTTAGAAAGACTCTAAATTACTTGAATTAGATCAATATTGATTGACGGCACTGGAAAAACATGTCCACCGCCTTCATACCCTAAACCAGTAAACTCAGGAGCAATATGTTGCTCACCGCCCCATTTGATGTTTCTCCCAGTGGCCTCAAAGCAGGTGCCCATTTTTAAGTCTCTGGCTTGGAGGCAAGTTTTAGAAGAGACACCGTTTTCTCCAATCAGAGCCTCCTGCAGGCCAGCAGTCCACATGGGGTACCAACTAGCCAATCACAGCCCTTATTCAGCATCCACAAAATATGTTTTCATGCTTGTGTGGCTCCCCAACACTTTCTACAGCTGAGTGTAGCTCATGAGTACAAAAGGTTGGGGATCTCTGTCTTTGGCCTGTAGTTCTGAGATGACAAATAAGCTATTGACAATGATACGTACTGATTTGTGACCCTCCCCTGGAGGATTCTTCATTCAACCTTTGCTAAGTCTGCCCCTAATTCTTTCATTAAGCTAGTAGTCGTGTTCACTTCCCATTTTGCTTTGTCTAGACTGCCTTGACATTTGTATCCCCTGGATTACAGAGGTTCTGTTTCATTGATGTTCTCTTCGGTTTCACCTGCTGACAAGCATTTAAACACAGTTCAGGAACATTGTATCTCTAACCTGAGAGAATAATTGCCATTATGCGTGTAAGGCTGATGGCTTGATACAACAGCCCGGTTCATTTCAACACCAAAAACTGCTGGCTGTGGCTTCTTTGCACCTGAAACCTCTTCTGAGCTTGCCATTCAAAAAAATGGGAGGCAGTTGGTGGAACGTTCCAGGTAGCCTAGAAGTGCCCTGTGTGTCATAGCNCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCAAAAAAAAAAAAAAAA
  5   1   2       bld Brn3      in                        CAAK11239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCAATGAAAGTTCTCCCAATCACTCTCTCAATAATGAAGGCGGTGACGATTCCCAGCTTGAAAAGACAAATCTTATTGAGCTGGAAGATGGGCGCTTACGAGGAAAGAGAGGAATACCCAACAGTCTGAGTGGCCTCCAGGACTCGGAAATCGCACGCATGTCAATCTGCTCCGACAAGAAAAGTCCTTCAGAAAGTAGTCTGATTGCCAGCAGCCCTGAGGAGAACTGGCCTTCAAGTCAGAAGTCCTTCAATCTGAACCGTACGCCAAGTACAGTCACGCTCAACAACAATACCGCCAACCAAAACTTTGAAGAGACAGAAGATGCTAAAAACGATTCTCCAATCATAGTAGTTCCTGGGTCAAGTCCTGTTCAAAACGAGAACCTGAAGCGTTTGACTCACAAGCGAGGTCAGCGTGCAGGGTACAGCCGTCTGGCCAAAGAAGCTTCAGAGCTAAACACTGTGGCTTCCTCTGATGCATCCGGCTTTGCAGAAGAAAGAGAGAAAATTATTCAGATAAAAGAATAAATCTGGAAAAAAAAAGGGTTGTAACTGGCTGTAGCTTAGCGTCCCACTGAAGCCTGGGAGAGAAGAATGAAGAGCAGCTTCAGCATGACGAGAAGGAACCACGGACTCATCATTCTCTAGGCAGAGCTTCAGAGGATATAACTATAAACTCTAATACCCAAACTTTAAAATGATATTTAATATCTGGTTGCCAAAATGTAGGAGCTCTCCTTTGGGTTGGGCTTGGATATTTTCTCCATCCCTATGAAATACAGGGAGGTAGACTGACTTTGAAATCAATTAATCTGANCATTCTAAACTGATCAAATTGGATTGCATTTAGAAAGACTCTAAATTACTTGAATTTAGATCATATTGATTGACGGCACTGGA
  5   1   2       bld Tad5                                  XZT4691.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGAGCTTCAGAGCTAACACTGTGGCTTCCTCTGATGCATCCGGCTTTGCAGAAGAAAGAGAGAGTATCCTTTAAACGGAGAATCAGAAGTCCATTTTTCTTCCTACCATCCATTTTTGCTTTTACTTTTATTCATCATTTATTTGCCAATCTCACTCAAGCCTAAAAAATTTCACCTATTGTGATCCTTAATTTTTTTTTTTTTTTTTTTTGCAATGAACTAGAAAGTATTCAGATAAAAGAATAAATCTGGAAAAAAAAAGGGTTGTAACTGGCTGTAGCTTAGCGTCCCACTGAAGCCTGGGAGAGAAGAATGAAGAGCAGCTTCAGCATGACGAGAAGGAACCACGGACTCATCATTCTCTAGGCAGAGCTTCAGAGGATATAACTATAAACTCTAATACCCAAACTTTAAAATGATATTTAATATCTGGTTGCCAAAATGTAGGAGCTCTCCTTTGGGTTGGGCTTGGATATTTTCTCCATCCCTATGAAATACAGGGAGGTAGACTGACTTTGAAATCAATTAATCTGACAATTCTAAACTGATCAAATTGGATTGCATTTAGAAAGACTCTAAATTACTTGAATTAGATCAATATTGATTGACGGCACTGGAAAAACATGTCCACCGCCTTCATACCCTAAACCAGTAAActcaggagcaatatgttgctcaccgccccatttgatgtttctcccagtggcctcaaagcaggtgcccatttttaagtctctggcttggaggcaagttttagaagagacaccgttttctccaatcagagcctcctgcaggccagcagtccacatggggtaccaactagccaatcacagcccttattcagcatccacaaa
  5   1   2       bld Brn2      in                        CAAJ14818.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAACACTGTGGCTTCCTCTGATGCATCCGGCTTTGCAGAAGAAAGAGAGAGTATCCTTTAAACGGAGAATCAGAAGTCCATTTTTCTTCCTACCATCCATTTTTGCTTTTACTTTTATTCATCATTTATTTGCCAATCTCACTCAAGCCTAAAAAATTTCACCTATTGTGATCCTTAATTTTTTTTTTTTTTTTTTTTTGCAATGAACTAGAAAGTATTCAGATAAAAGAATAAATCTGGAAAAAAAAAGGGTTGTAACTGGCTGTAGCTTAGCGTCCCACTGAAGCCTGGGAGAGAAGAATGAAGAGCAGCTTCAGCATGACGAGAAGGAACCACGGACTCATCATTCTCTAGGCAGAGCTTCAGAGGATATAACTATAAACTCTAATACCCAAACTTTAAAATGATATTTAATATCTGGTTGCCAAAATGTAGGAGCTCTCCTTTGGGTTGGGCTTGGATATTTTCTCCATCCCTATGAAATACAGGGAGGTAGACTGACTTTGAAATCAATTAATCTGACAATTCTAAACTGATCAAATTGGATTGCATTTAGAAAGACTCTAAATTACTTGAATTAGATCAATATTGATTGACGGCACTGGAAAAACATGTCCACCGCCTTCATACCCTAAACCAGTAAActcaggagcaatatgttgctcaccgccccatttgatgtttctcccagtggcctcaaagcaggtgcccatttttaagtctctggcttggaggcaagttttagaagagacaccgttttctccaatcagagcctcctgcaggccagcagtccacatggggtaccaactagccaatcacagcccctattCAGCAT
  3  -1   2       bld Ski1      in                         CABJ7295.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATGAACTAGAAAGTATTCAGATAAAAGAATAAATCTGGAAAAAAAAAGGGTTGTAACTGGCTGTAGCTTAGCGTCCCACTGAAGCCTGGGAGAGAAGAATGAAGAGCAGCTTCAGCATGACGAGAAGGAACCACGGACTCATCATTTTATTTTCTCCACCCCCCTCTAGGCAGAGCTTCAGAGGATATAACTATAAACTCTAATACCCAAACTTTAAAATGATATTTAATATCTGGTTGCCAAAATGTAGGAGCTCTCCTTTGGGTTGGGCTCGGATATTTTCTCCATCCCTATGAAATACAGGGAGGTAGACTGACTTTGAAATCAATTAATCTGACAATTCTAAACTGATCAAATTGGATTGCATTTAGAAAGACTCTAAATTACTTGAATTAGATCAATATTGATTGACGGCACTGGAAAAACATGTCCACCGCCTTCATACCCTAAACCAGTAAActcaggagcaatatgttgctcaccgccccatttgatgtttctcccagtggcctcaaagcaggtgcccatttttaagtctctggcttggaggcaagttttagaagagacaccgttttctccaatcagagcctcctgcaggccagcagtccacatggggtaccaactagccaatcacagcccttattcagcatccacaaaatatgttttcatgcttgtgtggctccccaacactttctacagctgagtgtagctcatgagtacaaaaggttggggatctctgTCTTTGGCCTGTAGTTCTGAGATGACAAATAAGCTATTGACAATGATACGTACTGATTTGTGACCCTCCCCTGGAGGATTCTTCATTCAACCTTTGCTAAGTCTGCCCCTAAATCTTTCATTAAGCTA
  3  -1   2       bld Brn4      out                        CAAL6405.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAATGAACTAGAAAGTATTCAGATAAAAGAATAAATCTGGAAAAAAAAAAGGGTTGTAACTGGCTGTAGCTTAGCGTCCCACTGAAGCCTGGGAGAGAAGAATGAAGAGCAGCTTCAGCATGACGAGAAGGAACCACGGACTCATCATTCTCTAGGCAGAGCTTCAGAGGATATAACTATAAACTCTAATACCCAAACTTTAAAATGATATTTAATATCTGGTTGCCAAAATGTAGGAGCTCTCCTTTGGGTTGGGCTTGGATATTTTCTCCATCCCTATGAAATACAGGGAGGTAGACTGACTTTGAAATCAATTAATCTGACAATTCTAAACTGATCAAATTGGATTGCATTTAGAAAGACTCTAAATTACTTGAATTAGATCAATATTGATTGACGGCACTGGAAAAACATGTCCACCGCCTTCATACCCTAAACCAGTAAActcaggagcaatatgttgctcaccgccccatttgatgtttctcccagtggcctcaaagcaggtgcccatttttaagtctctggcttggaggcaagttttagaagagacaccgttttctccaatcagagcctcctgcaggccagcagtccacatggggtaccaactagccaatcacagcccttattcagcatccacaaaatatgttttcatgcttgtgtggctccccaacactttctacagctgagtgtagctcatgagtacaaaaggttggggatctctgTCTTTGGCCTGTAGTTCTGAGATGATAAATAAGCTATTGACAATGATACGTACTGATTTGTGACCCTCCCCTGGAGGATCTTCATTCAACCTTTGCTAGTCTGCCCCTAATTCTTCATTAAGCTA
  5   1   2       bld Tad5                                 XZT70610.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAAAATGTAGGAGCTCTCCTTTGGGTTGGGCTTGGATATTTTCTCCATCCCTATGAAATACAGGGAGGTAGACTGACTTTGAAATCAATTAATCTGACAATTCTAAACTGATCAAATTGGATTGCATTTAGAAAGACTCTAAATTACTTGAATTAGATCAATATTGATTGACGGCACTGGAAAAACATGTCCACCGCCTTCATACCCTAAACCAGTAAActcaggagcaatatgttgctcaccgccccatttgatgtttctcccagtggcctcaaagcaggtgcccatttttaagtctctggcttggaggcaagttttagaagagacaccgttttctccaatcagagcctcctgcaggccagcagtccacatggggtaccaactagccaatcacagcccttattcagcatccacaaaatatgttttcatgcttgtgtggctccccaacactttctacagctgagtgtagctcatgagtacaaaaggttggggatctctgTCTTTGGCCTGTAGTTCTGAGATGACAAATAAGCTATTGACAATGATACGTACTGATTTGTGACCCTCCCCTGGAGGATTCTTCATTCAACCTTTGCTAAGTCTGCCCCTAATTCTTTCATTAAGCTAGTAGTCGTGTTCACTTCCCATTTTGCTTTGTCTAGACTGCCTTGACATTTGTATCCCCTGGATTACAGAGGTTCTGTTTCATTGATGTTCTCTTCGGTTTCACCTGCTGACAAGCATTTAAACACAGTTCANGAACATTGTATCTCTAACCTGAGAGAATAATTGCATTATGCGTGTAAGGCTGATGGCTTGATACAACAGCCCGGTTCATTTTCACACCAAAAACTGCTGGCTGTGGCTTCTTTG
  5   1   2       bld Tad5                                  XZT1220.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAACATGTCCACCGCCTTCATACCCTAAACCAGTAAActcaggagcaatatgttgctcaccgccccatttgatgtttctcccagtggcctcaaagcaggtgcccatttttaagtctctggcttggaggcaagttttagaagagacaccgttttctccaatcagagcctcctgcaggccagcagtccacatggggtaccaactagccaatcacagcccttattcagcatccacaaaatatgttttcatgcttgtgtggctccccaacactttctacagctgagtgtagctcatgagtacaaaaggttggggatctctgTCTTTGGCCTGTAGTTCTGAGATGACAAATAAGCTATTGACAATGATACGTACTGATTTGTGACCCTCCCCTGGAGGATTCTTCATTCAACCTTTGCTAAGTCTGCCCCTAATTCTTTCATTAAGCTAGTAGTCGTGTTCACTTCCCATTTTGCTTTGTCTAGACTGCCTTGACATTTGTATCCCCTGGATTACAGAGGTTCTGTTTCATTGATGTTCTCTTCGGTTTCACCTGCTGACAAGCATTTAAACACAGTTCAGGAACATTGTATCTCTAACCTGAGAGAATAATTGCCATTATGCGTGTAAGGCTGATGGCTTGATACAACAGCCCGGTTCATTTCAACACCAAAAACTGCTGGCTGTGGCTTCTTTGCACCTGAAACCTCTTCTGAGCTTGCCATTCANNAAAATGGAGGCAGTTGGT
  5   1   2       bld Lun1      in                         CABD2373.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAagagacaccgcttttctccaatcagagcctcctgcaggccagcagtccacatggggtaccaactagccaatcacagcccttattcagcatccacaaaatatgttttcatgcttgtgtggctccccaacactttctacagctgagtgtagctcatgagtacaaaaggttggggatctctgTCTTTGGCCTGTAGTTCTGAGATGACAAATAAGCTATTGACAATGATACGTACTGATTTGTGACCCTCCCCTGGAGGATTCTTCATTCAACCTTTGCTAAGTCTGCCCCTAATTCTTTCATTAAGCTAGTAGTCGTGTTCACTTCCCATTTTGCTTTGTCTAGACTGCCTTGACATTTGTATCCCCTGGATTACAGAGGTTCTGTTTCATTGATGTTCTCTTCGGTTTCACCTGCTGACAAGCATTTAAACACAGTTCAGGAACATTGTATCTCTAACCTGAGAGAATAATTGCCATTATGCGTGTAAGGCTGATGGCTTGATACAACAGCCCGGTTCATTTCAACACCAAAAACTGCTGGCTGTGGCTTCTTTGCACCTGAAACCTCTTCTGAGCTTGCCATTCAAAAAAATGGGAGGCAGTTGGTGGAACGTTCCAGGTAGCCTAGAAGTGCCCTGTGTGTCATAGCCCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCANGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCT
  5   1   2       bld Brn4      in                         CAAL9459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGTCATGTTCACTTCCCATTTTGCTTTGTCTAGACTGCCTTGACATTTGTATCCCCTGGATTACAGAGGTTCTGTTTCATTGATGTTCTCTTCGGTTTCACCTGCTGACAAGCATTTAAACACAGTTCAGGAACATTGTATCTCTAACCTGAGAGAATAATTGCCATTATGCGTGTAAGGCTGATGGCTTGATACAACAGCCCGGTTCATTTCAACACCAAAAACTGCTGGCTGTGGCTTCTTTGCACCTGAAACCTCTTCTGAGCTTGCCATTCAAAAAAATGGGAGGCAGTTGGTGGAACGTTCCAGGTAGCCTAGAAGTGCCCTGTGTGTCATAGCCCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCANACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCANATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTAT
  5   1   2       bld Ski1      in                         CABJ7295.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  NNAGGTACAACAGCCCTGGTTCATTTCAACACCAAAAACTGCTGGCTGTGGCTTCTTTGCACCTGAAACCTCTTCTGAGCTTGCCATTCAAAAAAATGGGAGGCAGTTGGTGGAACGTTCCAGGTAGCCTAGAAGTGCCCTGTGTGTCATAGCCCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATGATTTATGTGTTTCCGGCACATGCATAGAAGAGTTTGGTG
  3   1   2      seed Lun1      in                         CABD2373.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCTGCCATTCAAAAAATGGAGGGCAGTTGTGGAACGTTCCAGGTAGCCTAGAAGTGCCCTGTGTGTCATAGCNCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTCAAAA
  3   1   2       bld Brn2      in                        CAAJ11666.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAACGTTCCAGGTAGCCTAGAAGTGCCCTGTGTGTCATAGCNCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCT
  3   1   2       bld Te3       in                         CAAM4440.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGGTAGCCTAGAAGTGCCCTGTGTGTCATAGCNCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATNCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCT
  3   1   2       bld Brn2      in                        CAAJ19023.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGCCTAGAAGTGCCCTGTGTGTCATAGCCCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCT
  3   1   2       bld Brn2 5g3  out                       CAAJ23554.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTGTGTGTCATAGCNCACGTCATGAGTTTGCCTTCTACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCT
  3   1   2       bld Brn2 5g3  out                       CAAJ23131.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCCTTACAGAATGGCATCCAGAGGGGTCCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATC
  3   1   2       bld Brn2      out                       CAAJ16357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  3   1   2       bld Brn2      in                        CAAJ17210.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATC
  3   1   2       bld Brn2      in                        CAAJ20556.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  3   1   2       bld Tad5      in                         XZT61496.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCCTTACAGAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATC
  5   1   2       bld Tad5                                 XZT16421.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAATGGCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACA
  5   1   2       bld Te3       in                          CAAM470.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATCCAGAGGGTTCCCATTCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGAT
  3   1   2       bld Te3       in                        CAAM15722.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  5  -1   2       bld Lun1      in                         CABD8556.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCT
  3   1   2       bld Brn2 5g3  out                       CAAJ15850.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATC
  3   1   2       bld Brn2      in                        CAAJ11307.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  3   1   2       bld Brn2 5g3  out                       CAAJ16076.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTTTTTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCCCATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCCCCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACCCTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTCTCTGGTT
  3   1   2       bld Brn2 5g3  out                       CAAJ22962.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  3   1   2       bld Brn2      in                        CAAJ24148.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATC
  3   1   2       bld Brn3      in                         CAAK5835.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  3   1   2       bld Te3  5g3  out                        CAAM5260.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  3   1   2       bld Brn2      in                        CAAJ11296.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCT
  3   1   2       bld Brn2      in                        CAAJ14818.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGTAGAAATGTGTTGTGCAAACCTAAGAGCTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATC
  3   1   2       bld Brn2 5g3  out                       CAAJ19482.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  3   1   2       bld Brn2 5g3  out                       CAAJ11360.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTGAAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  3   1   2       bld Brn2      in                        CAAJ20010.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  3   1   2       bld Brn3      in                         CAAK6812.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAATTC
  3   1   2       bld Brn3      in                         CAAK7569.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  3   1   2       bld Brn2 5g3  out                       CAAJ13908.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCT
  3   1   2       bld Brn4      in                         CAAL9459.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGAAATGTGTTGTGCAAACCTAAGAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  3   1   2       bld Brn2      out                       CAAJ11657.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATC
  3   1   2       bld Brn2      in                        CAAJ16561.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATC
  3   1   2       bld Brn2 5g3  out                       CAAJ17855.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCTTTGTGAAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATC
  3   1   2       bld Brn3      in                        CAAK11239.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATC
  3   1   2       bld Te3       in                          CAAM470.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCTTTGTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCT
  3   1   2       bld Te3  5g3  out                        CAAM7395.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCTTTGTTGAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATC
  3   1   2       bld Te3  PIPE out                       CAAM14365.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAATGCAGTTCCTATTAAATCAGTGTCCGTGGAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  3   1   2       bld Brn2      in                        CAAJ13801.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAATGTTGTCACAGAGTAGTGCGTGCCATAGTGTGTAATTGTGTGTGTTCTGCCAGGACTGCATGCTGCTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCT
  5   1   2       bld Gas7                                 XZG17939.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGNTCCGCGTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCATGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATATTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE3964.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTC
  5   1   2       bld Ova1      in                         CABE3964.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTGTCTATCTCTCTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCCACCAGCGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGCTGAA
  3   1   2       bld Te3       in                        CAAM13960.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTTTTTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCCCCCAGTAGTTCTTTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTTTGTAGGACCCAATATATTGTGATGTTGCCTGTAAGTGACCCTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATC
  3   1   2       bld Te1       in                         CBWN3670.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGTGACAATAGGGACCTTGCCTGGGAAGGGCTGGGCTCTAGCCTGTGGCTTGTCTTTGATAGAAAACTTGCTGTTTGATGTATTATTTATGTGACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCAAAAAAAAAAAAAAA
  5   1   2       bld Ova1                                 CABE4961.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGATGTATTATTTATGTCACATTTGCCAAGGGTCAGTCCCTTTAGCTGATGTCCTTGTGGCTTTAAAGGCAATTATAAACCCTGCGCAGTTTTGAACTAACGAGAGCATCAAACTCTCAGAATAGAGTATTGCGTGTTAGACAGCAACGGTCTCTTCCAGATATACGGCCTATACACATCAAATGGAGCATTTTTTAGTTCCACATTAATATACATTGTGTATCTGGTTACAGGAGGAGCAAGTACTGGCACCCAGTAGTTCTCTATTGAGTAGTGCAGTGCTTATCCAACCAGGCCAGGAGAGGCTGGACTAGCTCAGCTGGTACAACAATGTTTTTTGTTGAAAGTAATGGACTTAGTACTGGAATGCCCAGTAATGAGAGTATTTGCACCCTGTCGCTCTGTAGGACACAATATATTGTGATGTTGCCTGTAAGTGACACTTGATGGAAAACATTGATAGCAACAAAAAAAATGTGTATTGTGTACGTGCAATGTGCTGTGACGTGCAAAATAAATGGCTGAAAATCTCNNaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaanaaaaaaaaaaaaaa
  3   1   2       bld Te3       out                        CAAM1395.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGCCAAGGGTCAGTCCCTTTAGCGGAGGTCCTTGGGGCTTTAAAGGCAATTTTAAACCCTGCGCCGTTTTGGACTAACGGGGGCCTCAAACTTTCCGAATAGAGTTTTGCGTGTTAGACAGCAACGGTTTTTTCCAGATTTTCGGCCTTTCCCCCTCAAAGGGGGCCTTTTTTTGTTCCCCCTTAATATCCCTTGGGTTTCTGGTTCCAGGGGGGGCAAGTTCTGGCCCCCCGTAGTTTTTTTTTGGGTGGGGCGGGGGTTTTCCCCCCCGGCCCGGGGGGGCTGGGCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)