Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-XZT63181.5.5                         43 END     1           1        2                (no blast hit)
     2   2.0    0Xt7.1-CAAM9358.5                           21 END     8           8       42                MGC98945 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 238.0    0Xt7.1-CABC4434.5.5                         82 PI      73        451     1079                Unknown (protein for MGC:160774) [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012153427 Xt7.1-CABJ1592.3.5 - 95 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABJ1592.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGACACCGCCTTCACTACGTAAGCACCCTGGAGGTGACCGCACCGGCAACCACACCTCCCGTGCAAAGATGAGCTCAGAGTTTGCCAAAGTTATTAACGATGGTCTGTTCTATTACGAGCAGGACCTGTGGACTGAACAGTTTGAGCCAGAATACTCTCAGATTAAGCAAGAAGTGGAGAACTTTAAAAAAGTGAACATGATTAGTCGGGAGCAGTTTGACACCTTAACCCCTGAGCCGCCTGTGGATCCAAACCAGGAAGTTCCTCCAGGACCCCCGCGATTTCAACAAGTCCCTACAGATGATTTGGCTAATAAGCTGTTTGGTGCCCCTGAACCTTCAACGATTGCCCGGTCCCTACCGACCACTGTTCCCGAATCTCCAAATTACCGCAATGCTCGGACGCCACGTACCCCACGCACACCCCGGTTAAAGGATCCAACTCTTACGCCAAGGTTTTACCCAGTGGTTAAAGAAGGCAGGACGATAGATGCTAAGACTCCACGGAAAAGAAAAACACGACACAGCTCCAACCCGCCAATGGAATGCCACGTGGGATGGGTGATGGACTCCAGGGAGCACAGACCTCGTACTGCCTCTGTCAGCTCTACTGCCAGCCCCTCTGAGGTTGCTCCAGCATTGAGCAATTACGGATGTACCCCACAATCTCTGCCAAAGTTCCAGCACCCTTCCCATGAACTGCTGAAAGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAACCTTGACATAGACCCCATATTGCAGGAATATTTGAGCAAGTTCCGCCGACTAGAGGATTTCAGGGTTGATCCACCAATGGGAGAAGATGGAGGATCAAAGAGGCGACACTCACTCTCCACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCAACCCAAAATTCAGCGAGGGAAGAGGCCAAAGCCCAAAGCCATCCTTCCACTGCCACACCGGATTCCCAGACTCCTGGAGCAGGGAAGTAGGCAGAATAAAAATTGGAGTGGAACTAAGGACTGGGAAGGGAACATGGTTTCTTGGATATGGGAAGGTGGATATATCAAATGCAATGGATCCAGCCTTCTTCCTACAGGAAACACTGCTTACACCAGAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTCTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTCTCATGCACGAGACACATCAGTTTTCTTTGAAACAAAGATTGGGTTTTGCAGCATCTCCAGTCTCTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCACCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTCTACCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTAATTACATTTTTAATTTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTACCGAAGATTTGGAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCCCCCCCCCCCCTCCCCCCGCCAGTTTTAGTAAATCACTGCCATCCCCGCTGCAGGTAGTGCTCTTCTGAATGCAGGAAATTCCCAGAGACAATGGAATTGAAACTGCTTTCAGACTCTGTTGCAAAGCCAAATCTGACGGGTCTTGTGGCTGAGAAGGTGCATTTGTGCATGTAGCTGGCATGACAGACACTGCCATTGAATAAAATGGTGCCTAAAGGTTTGGTGTGTTCAGCCAAATCAAGTTACCAGAGCACTAATTAAATAAGCCTTCATATGATTAATTAGGGCTGGATCCTTAAGGAACCATGGCTGGTTACACAGATATTTAAATGCCCCTCCCCTTCATTCTTTATCCTCAGTAGCTGTTAATATTCACCATCGGTGGTGGCAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGACAAAAAA
                                                  Xt7.1-CHK-1008264856                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCCTTCACTACGTAAGCACCCTGGAGGTGACCGCACCGGCAACCACACCTCCCGTGCAAAGATGAGCTCAGAGTTTGCCAAAGTTATTAACGATGGTCTGTTCTATTACGAGCAGGACCTGTGGACTGAACAGTTTGAGCCAGAATACTCTCAGATTAAGCAAGAAGTGGAGAACTTTAAAAAAGTGAACATGATTAGTCGGGAGCAGTTTGACACCTTAACCCCTGAGCCGCCTGTGGATCCAAACCAGGAAGTTCCTCCAGGACCCCCGCGATTTCAACAAGTCCCTACAGATGATTTGGCTAATAAGCTGTTTGGTGCCCCTGAACCTTCAACGATTGCCCGGTCCCTACCGACCACTGTTCCCGAATCTCCAAATTACCGCAATGCTCGGACGCCACGTACCCCACGCACACCCCGGTTAAAGGATCCAACTCTTACGCCAAGGTTTTACCCAGTGGTTAAAGAAGGCAGGACGATAGATGCTAAGACTCCACGGAAAAGAAAAACACGACACAGCTCCAACCCGCCAATGGAATGCCACGTGGGATGGGTGATGGACTCCAGGGAGCACAGACCTCGTACTGCCTCTGTCAGCTCTACTGCCAGCCCCTCTGAGGTTGCTCCAGCATTGAGCAATTACGGATGTACCCCACAATCTCTGCCAAAGTTCCAGCACCCTTCCCATGAACTGCTGAAAGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAACCTTGACATAGACCCCATATTGCAGGAATATTTGAGCAAGTTCCGCCGACTAGAGGATTTCAGGGTTGATCCACCAATGGGAGAAGATGGAGGATCAAAGAGGCGACACTCACTCTCCACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCAACCCAAAATTCAGCGAGGGAAGAGGCCAAAGCCCAAAGCCATCCTTCCACTGCCACACCGGATTCCCAGACTCCTGGAGCAGGGAAGTAGGCAGAATAAAAATTGGAGTGGAACTAAGGACTGGGAAGGGAACATGGTTTCTTGGATATGGGAAGGTGGATATATCAAATGCAATGGATCCAGCCTTCTTCCTACAGGAAACACTGCTTACACCAGAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTCTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTCTCATGCACGAGACACATCAGTTTTCTTTGAAACAAAGATTGGGTTTTGCAGCATCTCCAGTCTCTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCACCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTCTACCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTAATTACATTTTTAATTTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTACCGAAGATTTGGAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCCCCCCCCCCCCTCCCCCCGCCAGTTTTAGTAAATCACTGCCATCCCCGCTGCAGGTAGTGCTCTTCTGAATGCAGGAAATTCACAGAGACAATGGAATTGAAACTGCTTTCAGACTCTGTTGCAAAGCCAAATCTGACGGGTCTTGTGGCTGAGAAGGTGCATTTGTGCATGTAGCTGGCATGACAGACACTGCCATTGAATAAAATGGTGCCTAAAGGTTTGGTGTGTTCAGCCAAATCAAGTTACCAGAGCACTAATTAAATAAGCCTTCATATGATTAATTAGGGCTGGATCCTTAAGGAACCATGGCTGGTTACACAGATATTTAAATGCCCCTCCCCTTCATTCTTTATCCTCAGTAGCTGTTAATATTCACCATCGGTGGTGGCAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGACAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     8     9     8     9     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     6     6     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     6     6     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     8     6     8     7     9     7     9     8    10     8    10     7     9     7     9     7     9     7     9     8     9     9    10     9    10     9    10     9    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     8     9     8     9     7     8     6     8     6     9     7     9     8    10     8    10     8    11     9    11     9    11     9    11     8    11     9    11     9    11     9    11    10    12     9    11     9    11     9    11     9    11    10    12     9    12    11    12    10    12    10    12    10    11     8    11     6     9     8     9     8     9     8    10     8    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8    10     8    10     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9    10     8     9     6     8     7     9     7     9     7     9     7     9     6     8     6     8     6     8     6     8     6     9     6     8     5     9     6    10     6     9     6     9     6     9     5     8     5     7     4     4     2     4     5     5     4     5     3     5     5     5     4     6     6     6     7     7     6     7     7     7     6     7     5     7     6     7     6     7     6     7     7     7     7     7     5     7     4     7     5     6     4     6     5     7     4     8     6     8     7     9     6     9     7     9     7     9     8    10     8    10     8     9     6     8    10    11    10    11    11    12    10    12    12    14    13    15    13    14    13    14    13    16    16    17    19    20    21    21    25    25    25    25    28    28    29    30    33    33    33    33    33    33    33    33    33    33    37    37    39    40    40    42    41    42    42    43    42    44    43    45    43    46    42    46    44    47    45    48    46    48    48    50    48    50    48    50    48    49    48    49    48    49    48    49    46    49    48    50    49    51    49    51    48    51    52    53    52    53    52    53    52    53    48    53    51    53    51    53    51    52    51    52    51    53    50    52    48    51    48    51    48    51    48    51    50    53    45    53    30    39    33    35    33    34    31    34    31    34    30    33    30    32    30    32    30    32    29    31    29    31    30    31    30    31    30    31    30    31    29    30    26    29    21    28    20    26     4     8
  5   1   2       e>1                               Xt7.1-TGas119c13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGACACCGCCTTCACTACGTAAGCACCCTGGAGGTGACCGCACCGGCAACCACACCTCCCGTGCAAAGATGAGCTCAGAGTTTGCCAAAGTTATTAACGATGGTCTGTTCTATTACGAGCAGGACCTGTGGACTGAACAGTTTGAGCCAGAATACTCTCAGATTAAGCAAGAAGTGGAGAACTTTAAAAAAGTGAACATGATTAGTCGGGAGCAGTTTGACACCTTAACCCCTGAGCCGCCTGTGGATCCAAACCAGGAAGTTCCTCCAGGACCCCCGCGATTTCAACAAGTCCCTACAGATGATTTGGCTAATAAGCTGTTTGGTGCCCCTGAACCTTCAACGATTGCCCGGTCCCTACCGACCACTGTTCCCGAATCTCCAAATTACCGCAATGCTCGGACGCCACGTACCCCACGCACACCCCGGTTAAAGGATCCAACTCTTACGCCAAGGTTTTACCCAGTGGTTAAAGAAGGCAGGACGATAGATGCTAAGACTCCACGGAAAAGAAAAACACGACACAGCTCCAACCCGCCAATGGAATGCCACGTGGGATGGGTGATGGACTCCAGGGAGCACAGACCTCGTACTGCCTCTGTCAGCTCTACTGCCAGCCCCTCTGAGGTTGCTCCAGCATTGAGCAATTACGGATGTACCCCACAATCTCTGCCAAAGTTCCAGCACCCTTCCCATGAACTGCTGAAAGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAACCTTGACATAGACCCCATATTGCAGGAATATTTGAGCAAGTTCCGCCGACTAGAGGATTTCAGGGTTGATCCACCAATGGGAGAAGATGGAGGATCAAAGAGGCGACACTCACTCTCCACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCAACCCAAAATTCAGCGAGGGAAGAGGCCAAAGCCCAAAGCCATCCTTCCACTGCCACACCGGATTCCCAGACTCCTGGAGCAGGGAAGTAGGCAGAATAAAAATTGGAGTGGAACTAAGGACTGGGAAGGGAACATGGTTTCTTGGATATGGGAAGGTGGATATATCAAATGCAATGGATCCAGCCTTCTTCCTACAGGAAACACTGCTTACACCAGAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTCTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTCTCATGCACGAGACACATCAGTTTTCTTTGAAACAAAGATTGGGTTTTGCAGCATCTCCAGTCTCTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCACCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTCTACCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTAATTACATTTTTAATTTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTACCGAAGATTTGGAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCC
  5   1   2       e>1                                 Xt7.1-CABJ1592.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCCCCCCCCCCCCTCCCCCCGCCAGTTTTAGTAAATCACTGCCATCCCCGCTGCAGGTAGTGCTCTTCTGAATGCAGGAAATTCACAGAGACAATGGAATTGAAACTGCTTTCAGACTCTGTTGCAAAGCCAAATCTGACGGGTCTTGTGGCTGAGAAGGTGCATTTGTGCATGTAGCTGGCATGACAGACACTGCCATTGAATAAAATGGTGCCTAAAGGTTTGGTGTGTTCAGCCAAATCAAGTTACCAGAGCACTAATTAAATAAGCCTTCATATGATTAATTAGGGCTGGATCCTTAAGGAACCATGGCTGGTTACACAGATATTTAAATGCCCCTCCCCTTCATTCTTTATCCTCAGTAGCTGTTAATATTCACCATCGGTGGTGGCAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGACAAAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------G--
                                                                       ...PROTEIN --- Dm ---- 2e-102     NP_524998.1 La related protein CG14066-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 6e-114     XP_781138.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 5e-175     XP_696560.1 PREDICTED: similar to FLJ10378 protein isoform 1 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_056130.2 KIAA0731 protein [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 0          XP_910122.2 PREDICTED: similar to la related protein isoform 1 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_414577.2 PREDICTED: hypothetical protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAH93491.1 MGC98945 protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 0          NP_001089363.1 hypothetical protein LOC734413 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABJ1592.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------TAA---------------TAA------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------TAG---------------------ATG---------TAG------------TAG------------TAG---------------------------------------------------------------------TAA---------------------------------------------TGA---------------------------TGA---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TGA---ATG------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------TGAATG---ATGTGAATG---------------------------------TAG---------------------TGA---------------------------TAA---ATG------------------------ATGATG---------------------TAG------------------------------TAG---------------TAA------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------ATGATGTAA------------------------------------------------------------------------TAA------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------ATG---------------------------------------------------------------------------ATGTAG------TGA---------------------ATG---------------------------------------------------TAA------------ATG------TAG---------------------------------------------------------------------------------TAA---------------------------------------------------------------------------ATG---------TGA------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------ATG------------------------------------------------------------TAG---------TAG------------------------------------------------------------------------------------------------------------------------TGA---TAG---------------------------------------------------------------------------------TGA---------------TGATGA---------------------------------------------------------------------------TAA------------------------TGA------------------------------------------------------------------ATG------------------------------------------ATG---------------ATGTAA------TGAATG------------------------------------------------------TGA---------TAG------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       e>1                               Xt7.1-TGas119c13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGACACCGCCTTCACTACGTAAGCACCCTGGAGGTGACCGCACCGGCAACCACACCTCCCGTGCAAAGATGAGCTCAGAGTTTGCCAAAGTTATTAACGATGGTCTGTTCTATTACGAGCAGGACCTGTGGACTGAACAGTTTGAGCCAGAATACTCTCAGATTAAGCAAGAAGTGGAGAACTTTAAAAAAGTGAACATGATTAGTCGGGAGCAGTTTGACACCTTAACCCCTGAGCCGCCTGTGGATCCAAACCAGGAAGTTCCTCCAGGACCCCCGCGATTTCAACAAGTCCCTACAGATGATTTGGCTAATAAGCTGTTTGGTGCCCCTGAACCTTCAACGATTGCCCGGTCCCTACCGACCACTGTTCCCGAATCTCCAAATTACCGCAATGCTCGGACGCCACGTACCCCACGCACACCCCGGTTAAAGGATCCAACTCTTACGCCAAGGTTTTACCCAGTGGTTAAAGAAGGCAGGACGATAGATGCTAAGACTCCACGGAAAAGAAAAACACGACACAGCTCCAACCCGCCAATGGAATGCCACGTGGGATGGGTGATGGACTCCAGGGAGCACAGACCTCGTACTGCCTCTGTCAGCTCTACTGCCAGCCCCTCTGAGGTTGCTCCAGCATTGAGCAATTACGGATGTACCCCACAATCTCTGCCAAAGTTCCAGCACCCTTCCCATGAACTGCTGAAAGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAACCTTGACATAGACCCCATATTGCAGGAATATTTGAGCAAGTTCCGCCGACTAGAGGATTTCAGGGTTGATCCACCAATGGGAGAAGATGGAGGATCAAAGAGGCGACACTCACTCTCCACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCAACCCAAAATTCAGCGAGGGAAGAGGCCAAAGCCCAAAGCCATCCTTCCACTGCCACACCGGATTCCCAGACTCCTGGAGCAGGGAAGTAGGCAGAATAAAAATTGGAGTGGAACTAAGGACTGGGAAGGGAACATGGTTTCTTGGATATGGGAAGGTGGATATATCAAATGCAATGGATCCAGCCTTCTTCCTACAGGAAACACTGCTTACACCAGAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTCTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTCTCATGCACGAGACACATCAGTTTTCTTTGAAACAAAGATTGGGTTTTGCAGCATCTCCAGTCTCTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCACCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTCTACCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTAATTACATTTTTAATTTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTACCGAAGATTTGGAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCC
                                                  Xt7.1-CHK-1008227985                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGCCTTCACTACGTAAGCACCCTGGAGGTGACCGCACCGGCAACCACACCTCCCGTGCAAAGATGAGCTCAGAGTTTGCCAAAGTTATTAACGATGGTCTGTTCTATTACGAGCAGGACCTGTGGACTGAACAGTTTGAGCCAGAATACTCTCAGATTAAGCAAGAAGTGGAGAACTTTAAAAAAGTGAACATGATTAGTCGGGAGCAGTTTGACACCTTAACCCCTGAGCCGCCTGTGGATCCAAACCAGGAAGTTCCTCCAGGACCCCCGCGATTTCAACAAGTCCCTACAGATGATTTGGCTAATAAGCTGTTTGGTGCCCCTGAACCTTCAACGATTGCCCGGTCCCTACCGACCACTGTTCCCGAATCTCCAAATTACCGCAATGCTCGGACGCCACGTACCCCACGCACACCCCGGTTAAAGGATCCAACTCTTACGCCAAGGTTTTACCCAGTGGTTAAAGAAGGCAGGACGATAGATGCTAAGACTCCACGGAAAAGAAAAACACGACACAGCTCCAACCCGCCAATGGAATGCCACGTGGGATGGGTGATGGACTCCAGGGAGCACAGACCTCGTACTGCCTCTGTCAGCTCTACTGCCAGCCCCTCTGAGGTTGCTCCAGCATTGAGCAATTACGGATGTACCCCACAATCTCTGCCAAAGTTCCAGCACCCTTCCCATGAACTGCTGAAAGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAACCTTGACATAGACCCCATATTGCAGGAATATTTGAGCAAGTTCCGCCGACTAGAGGATTTCAGGGTTGATCCACCAATGGGAGAAGATGGAGGATCAAAGAGGCGACACTCACTCTCCACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCAACCCAAAATTCAGCGAGGGAAGAGGCCAAAGCCCAAAGCCATCCTTCCACTGCCACACCGGATTCCCAGACTCCTGGAGCAGGGAAGTAGGCAGAATAAAAATTGGAGTGGAACTAAGGACTGGGAAGGGAACATGGTTTCTTGGATATGGGAAGGTGGATATATCAAATGCAATGGATCCAGCCTTCTTCCTACAGGAAACACTGCTTACACCAGAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTCTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTCTCATGCACGAGACACATCAGTTTTCTTTGAAACAAAGATTGGGTTTTGCAGCATCTCCAGTCTCTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCACCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTCTACCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTAATTACATTTTTAATTTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTACCGAAGATTTGGAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCCCCCCCC
  5   1   2       bld Gas7      in                          XZG3601.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGCCACTTCCAGGTCCCTCCCTTTCAGATGCTTCCCAGACCGACTTCAATCAACTCATAAACTGTCCTGAATTCGTCCCCAGGCAAGGATTCCAGAAGGAAACAGAATCTGCTCCTGGCTCTCCTCGAACATCCAGCCCAGCCCGAACGACAAAATCCGAAGAGGTCTCTAACTTGAAGACCATGCCAAAGGGTCTTTCGGCCAGTTTGCCTGACCTGGACTCTGATAACTGGATAGAAGTCAAGAAAAGGCCGCGACCTTCCCCAGCAAGAACCAAGGATGAGGTTAAGTCGCCACAGGTGGTTACACCCTTGCAGGTGACTCCACAAAAGCCACCCAAAGATCAAGATGAGCCAGAGGAATTGGACTTTATGTTTGATGAGGAAATGGAGCAAATGGACGGGCGGAAGAATACTTTTACTGACTGGTCAGACGAGGACTCTGACTATGAGATCGATGATCGAGATGTGAACAAGATTCTTATTGTGACACAGACACCGCCTTCACTACGTAAGCACCCTGGAGGTGACCGCACCGGCAACCACACCTCCCGTGCAAAGATGAGCTCAGAGTTTGCCAAAGTTATTAACGATGGTCTGTTCTATTACGAGCAGGACCTGTGGACTGAACAGTTTGAGCCAGAATACTCTCAGATTAAGCAAGAAGTGGAGAACTTTAAAAAAGTGAACATGATTAGTCGGGAGCAGTTTGACACCTTAACCCCTGAGCCGCCTGTGGATCCAAACCAGGAAGTTC
  5   1   2       bld Tbd1      in                        CBXT20909.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGACACCGCCTTCACTACGTAAGCACCCTGGAGGTGACCGCACCGGCAACCACACCTCCCGTGCAAAGATGAGCTCAGAGTTTGCCAAAGTTATTAACGATGGTCTGTTCTATTACGAGCAGGACCTGTGGACTGAACAGTTTGAGCCAGAATACTCTCAGATTAAGCAAGAAGTGGAGAACTTTAAAAAAGTGAACATGATTAGTCGGGAGCAGTTTGACACCTTAACCCCTGAGCCGCCTGTGGATCCAAACCAGGAAGTTCCTCCAGGACCCCCGCGATTTCAACAAGTCCCTACAGATGATTTGGCTAATAAGCTGTTTGGTGCCCCTGAACCTTCAACGATTGCCCGGTCCCTACCGACCACTGTTCCCGAATCTCCAAATTACCGCAATGCTCGGACGCCACGTACCCCACGCACACCCCGGTTAAAGGATCCAACTCTTACGCCAAGGTTTTACCCAGTGGTTAAAGAAGGCAGGACGATAGATGCTAAGACTCCACGGAAAAGAAAAACACGACACAGCTCCAACCCGCCAATGGAATGCCACGTGGGATGGGTGATGGACTCCAGGGAGCACAGACCTCGTACTGCCTCTGTCAGCTCTACTGCCAGCCCCTCTGAGGTTGCTCCAGCATTGAGCAATTACGGATGTACCCCACAATCTCTGCCAAAGTTCCAGCACCCTTCCCATGAACTGCTGAAGGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCT
  5   1   2       bld Gas       in                   TGas119c13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAAGCACCCTGGAGGTGACCGCACCGGCAACCACACCTCCCGTGCAAAGATGAGCTCAGAGTTTGCCAAAGTTATTAACGATGGTCTGTTCTATTACGAGCAGGACCTGTGGACTGAACAGTTTGAGCCAGAATACTCTCAGATTAAGCAAGAAGTGGAGAACTTTAAAAAAGTGAACATGATTAGTCGGGAGCAGTTTGACACCTTAACCCCTGAGCCGCCTGTGGATCCAAACCAGGAAGTTCCTCCAGGACCCCCGCGATTTCAACAAGTCCCTACAGATGATTTGGCTAATAAGCTGTTTGGTGCCCCTGAACCTTCAACGATTGCCCGGTCCCTACCGACCACTGTTCCCGAATCTCCAAATTACCGCAATGCTCGGACGCCACGTACCCCACGCACACCCCGGTTAAAGGATCCAACTCTTACGCCAAGGTTTTACCCAGTGGTTAAAGAAGGCAGGACGATAGATGCTAAGACTCCACGGAAAAGAAAAACACGACACAGCTCCAACCCGCCAATGGAATGCCACGTGGGATGGGTGATGGACTCCAGGGAGCACAGACCTCGTACTGCCTCTGTCAGCTCTACTGCCAGCCCCTCTGAGGTTGCTCCAGCATTGA
  5   1   2       bld Gas6      in                         ANBT3241.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATCCAAACCAGGAAGTTCCTCCAGGACCCCCGCGATTTCAACAAGTCCCTACAGATGATTTGACTAATAAGCTGTTTGGTGCCCCTGAACCTTCAACGATTGCCCGGTCCCTACCGACCACTGTTCCCGAATCTCCAAATTACCGCAATGCTCGGACGCCACGTACCCCACGCACACCCCGGTTAAAGGATCCAACTCTTACGCCAAGGTTTTACCCAGTGGTTAAAGAAGGCAGGACGATAGATGCTAAGACTCCACGGAAAAGAAAAACACGACACAGCTCCAACCCGCCAATGGAATGCCACGTGGGATGGGTGATGGACTCCAGGGAGCACAGACCTCGTACTGCCTCTGTCAGCTCTACTGCCAGCCCCTCTGAGGTTGCTCCAGCATTGAGCAATTACGGATGTACCCCACAATCTCTGCCAAAGTTCCAGCACCCTTCCCATGAACTGCTGAAAGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGCAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTGAGCTCAAGTTTTTAACAAGGGATGGTTGTATTGT
  5   1   2       bld Tad5      in                         XZT30996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGCCTGAACCTTCAACGATTGCCCGGTCCCTACCGACCACTGTTCCCGAATCTCCAAATTACCGCAATGCTCGGACGCCACGTACCCCACGCACACCCCGGTTAAAGGATCCAACTCTTACGCCAAGGTTTTACCCAGTGGTTAAAGAAGGCAGGACGATAGATGCTAAGACTCCACGGAAAAGAAAAACACGACACAGCTCCAACCCGCCAATGGAATGCCACGTGGGATGGGTGATGGACTCCAGGGAGCACAGACCTCGTACTGCCTCTGTCAGCTCTACTGCCAGCCCCTCTGAGGTTGCTCCAGCATTGAGCAATTACGGATGTACCCCACAATCTCTGCCAAAGTTCCAGCACCCTTCCCATGAACTGCTGAAAGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTC
  5   1   2       bld Int1      in                         CAAP2647.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTAATAAGCTGTTTGGTGCCCCTGAACCTTCAACGATTGCCCGGTCCCTACCGACCACTGTTCCCGAATCTCCAAATTACCGCAATGCTCGGACGCCACGTACCCCACGCACACCCCGGTTAAAGGATCCAACTCTTACGCCAAGGTTTTACCCAGTGGTTAAAGAAGGCAGGACGATAGATGCTAAGACTCCACGGAAAAGAAAAACACGACACAGCTCCAACCCGCCAATGGAATGCCACGTGGGATGGGTGATGGACTCCAGGGAGCACAGACCTCGTACTGCCTCTGTCAGCTCTACTGCCAGCCCCTCTGAGGTTGCTCCAGCATTGAGCAATTACGGATGTACCCCACAATCTCTGCCAAAGTTCCAGCACCCTTCCCATGAACTGCTGAAAGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTC
  5   1   2       bld Te4       in                        CAAN12258.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTACCCAGTGGTTAAAGAAGGCAGGACGATAGATGCTAAGACTCCACGGAAAAGAAAAACACGACACAGCTCCAACCCGCCAATGGAATGCCACGTGGGATGGGTGATGGACTCCAGGGAGCACAGACCTCGTACTGCCTCTGTCAGCTCTACTGCCAGCCCCTCTGAGGTTGCTCCAGCATTGAGCAATTACGGATGTACCCCACAATCTCTGCCAAAGTTCCAGCACCCTTCCCATGAACTGCTGAAAGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAACCTTGACATAGACCCCATATTGCAGGAATATTTGAGCAAGTTCCGCCGACTAGAGGATTTCAGGGTTGATCCACCAATGNGAGAAGATGGAGGATCAAAGAGGCGACACTCACTCTCTACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCACTCAAAAATTCAGCGAGGGAAGAGGCCAAAGCCCAAAGCCATCCTTCCACTGGCA
  5   1   2       bld Gas7      in                         XZG29270.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGATCCGACACGACACAGCTCCAACCCGCCAATGGAATGCCACGTGGGATGGGTGATGGACTCCAGGGAGCACAGACCTCGTACTGCCTCTGTCAGCTCTACTGCCAGCCCCTCTGAGGTTGCTCCAGCATTGAGCAATTACGGATGTACCCCACAATCTCTGCCAAAGTTCCAGCACCCTTCCCATGAACTGCTGAAAGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAACCTTGACATAGACCCCATATTGCAGGAATATTTGAGCAAGTTCCGCCGACTAGAGGATTTCAGGGTT
  5   1   2       bld Gas1      in                     NISC_mq21a03.y2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGATGTTCCAGCACCCTTCCCATGAACTGCTGAAAGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAACCTTGACATAGACCCCATATTGCAGGAATATTTGAGCAAGTTCCGCCGACTAGAGGATTTCAGGGTTGATCCACCAATGGGAGAAGATGGAGGATCAAAGAGGCGACACTCACTCTCCACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCAACCCAAAATTCAGCGAGGG
  5   1   2       bld Egg       in                   TEgg015c13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGAACTGCTGAAAGAGAATGGATTTACACAACATGTTTACCACAAGTACCGCCGACGTTGCCTTAATGAAAGGAAACGGCTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAACCTTGACATAGACCCCATATTGCAGGAATATTTGAGCAAGTTCCGCCGACTAGAGGATTTCAGGGTTGATCCACCAATGGGAGAAGATGGAGGATCAAAGAGGCGACACTCACTCTCCACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCAACCCAAAATTCAGCGAGGGAAGAGGCCAAAGCCCAAAGCCATCCTTCCACTGCCACACCGGATTCCCAGACTCCTG
  5   1   2       bld Te4  PIPE in                          CAAN489.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGGCATAGGCCAGTCTCAGGAGATGAACACCCTCTTCCGCTTCTGGTCTTTCTTTCTTCGAGATCATTTCAATAAGAAAATGTATGAGGAGTTCAGGCAACTGGCTGTGGAGGATAGCAAAGAGGGATACAGGTACGGGTTGGAGTGCCTGTTCAGATACTACAGCTACGGCCTAGAAAAGAAGTTCCGAGTGGACATATTCCGAGATTTCCAGGAAGAGACTAGAAGGGACTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAACCTTGACATAGACCCCATATTGCAGGAATATTTGAGCAAGTTCCGCCGACTAGAGGATTTCAGGGTTGATCCACCAATGGGAGAAGATGGAGGATCAAAGAGGCGACACTCACTCTCCACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCAACCCAAAATTCAGCGAGGGAAGAGGCCAAAGCCCAAAGCCATCCTTCCACTGCCACACCGGATTCCCAGACTCCTGGAGCAGGGAAGTAGGCAGAATAAAAATTGGAGTGGAACTAAGGACTGGGAAGGGAACATGGTTTCTTGGATATGGGAAGGTGGATATATCAAATGCAATGGATCCAGCCTTCTTCCTACAGGAAACACTGCTTACACCAGAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGA
  5   1   2       bld Gas7                                 XZG17720.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGACGCGTGGGCTACGAAACTGGTCAGCTCTATGGGCTGGAGAAGTTTTGGGCCTTCTTAAAATATTCCAAAGCCAAAAACCTTGACATAGACCCCATATTGCAGGAATATTTGAGCAAGTTCCGCCGACTAGAGGATTTCAGGGTTGATCCACCAATGGGAGAAGATGGAGGATCAAAGAGGCGACACTCACTCTCCACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCAACCCAAAATTCAGCGAGGGAAGAGGCCAAAGCCCAAAGCCATCCTTCCACTGCCACACCGGATTCCCAGACTCCTGGAGCAGGGAAGTAGGCAGAATAAAAATTGGAGTGGAACTAAGGACTGGGAAGGGAACATGGTTTCTTGGATATGGGAAGGTGGATATATCAAATGCAATGGATCCAGCCTTCTTCCTACAGGAAACACTGCTTACACCAGAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCT
  5   1   2       bld HdA                            THdA051f06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACCAATGGGAGAAGATGGAGGATCAAAGAGGCGACACTCACTCTCCACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCAACCCAAAATTCAGCGAGGGAAGAGGCCAAAGCCCAAAGCCATCCTTCCACTGCCACACCGGATTCCCAGACTCCTGGAGCAGGGAAGTAGGCAGAATAAAAATTGGAGTGGAACTAAGGACTGGGAAGGGAACATGGTTTCTTGGATATGGGAAGGTGGATATATCAAATGCAATGGATCCAGCCTTCTTCCTACAGGAAACACTGCTTACACCAGAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTCTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTCTCATGCACGAGACACATCAGTTTTCTTTGAAACAAAGATTGGGTTCTGCAGCATCTCCAGTCTCTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTCTGGCTTTCTTCTTCTCGCAGCACTCGGCATGC
  5   1   2       bld Gas7                                  XZG8617.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAGATGGAGGATCAAAGAGGCGACACTCACTCTCCACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCAACCCAAAATTCAGCGAGGGAAGAGGCCAAAGCCCAAAGCCATCCTTCCACTGCCACACCGGATTCCCAGACTCCTGGAGCAGGGAAGTAGGCAGAATAAAAATTGGAGTGGAACTAAGGACTGGGAAGGGAACATGGTTTCTTGGATATGGGAAGGTGGATATATCAAATGCAATGGATCCAGCCTTCTTCCTACAGGAAACACTGCTTACACCAGAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTCTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTCTCATGCACGAGACACATCAGTTTTCTTTGAAACAAAGA
  5   1   2       bld Gas7      in                         XZG38526.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCGACACTCACTCTCCACAGGTGAGGGCAGAAGGAGGTACCCATCCCAGTCTTCCAGTAGAGGATCTGGTCATCAGACTTCAACCCAAAATTCAGCGAGGGAAGAGGCCAAAGCCCAAAGCCATCCTTCCACTGCCACACCGGATTCCCAGACTCCTGGAGCAGGGAAGTAGGCAGAATAAAAATTGGAGTGGAACTAAGGACTGGGAAGGGAACATGGTTTCTTGGATATGGGAAGGTGGATATATCAAATGCAATGGATCCAGCCTTCTTCCTACAGGAAACACTGCTTACACCAGAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTCTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTCTCATGCACGAGACACATCAGTTTTCTTTGAAACAAAGATTGGGTTCTGCAGCATCTCCAGTCTCTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTG
  3  -1   2      seed Spl1      in                         CABK4125.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGATTCCCAGACTCCTGGAGCAGGGAAGTAGGCAGAATAAAAATTGGAGTGGAACTAAGGACTGGGAAGGGAACATGGTTTCTTGGATATGGGAAGGTGGATATATCAAATGCAATGGATCCAGCCTTCTTCCTACAGGAAACACTGCTTACACCAGAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTCTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTCTCATGCACGAGACACATCAGTTTTCTTTGAAACAAAGATTGGGTTCTGCAGCATCTCCAGTCTCTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAA
  3   1   2       bld Tbd1      in                        CBXT20909.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTACAGGAAACACTGCTTACACCAGAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTTTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTTTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTTTTTGGCTTTTGTTTTTCATGCACGAGACACATCAGTTTTTTTTGAAACAAAGATTGGGTTTTGCAGCATTTCCAGTTTTTGACATTGTTTTTTGAACGATGCCTTTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATTTTTTGGCTTTTTTTTTTTTCGCAGCAACTCGGCATGCAGCTTATGGGTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAAACAAAAAACTAGCAAAAGACTAGAGGAAAAAAAAAAAAAAA
  3   1   2       bld Gas6      in                         ANBT3241.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGACTCCAGGTGCTGGAGGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTCTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTCTCATGCACGAGACACATCAGTTTTCTTTGAAACAAAGATTGGGTTCTGCAGCATCTCCAGTCTCTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGG
  3   1   2       bld Gas       in                    TGas119c13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCAAGGACTAGTTGTTCCCGTGCCCTTTACACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTCTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTCTCATGCACGAGACACATCAGTTTTCTTTGAAACAAAGATTGGGTTTTGCAGCATCTCCAGTCTCTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTTTAAAATAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg015c13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACATATAGGGGGTAGCTGCTCATACTGAAGAGGAGGATGATCTTTGGTTAGGGGTATGACATTTAGTTTCATTTCTTTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTTTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTTTCATGCACGAGACACATCAGTTTTTTTTGAAACAAAGATTGGGTTTTGCAGCATCTCCAGTCTTTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATTTTTTGGCTTTCTTTTTTTTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG38526.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTAGCAGAAACCTGGAGGAAAGCTCTCGCTATGTTCAGAGGGAGATTTTTATTTTTTTTTTTCTCCTTGTTTTTAAATTATTGGATTTGTGCCCTTCTTTTTGAGCAGCAATTCCTCAGTGTGAAAAAAGACTGCGGACTCGTGTCTGCTGTGAGATGGCCACGCGCAGACGAGCCGAGCTTTGCTGTTACAGGCTCGCCATAGGGCGACACACAGGGCCCTTCTCTGGCTTCTGTCTCTCATGCACGAGACACATCAGTTTTCTTTGAAACAAAGATTGGGTTTTGCAGCATCTCCAGTCTCTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAGACTAGAGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGTTTAAATTTTTAAAAAAGAAAAAAAAAAAAAATAAT
  5   1   2       bld Gas                            TGas001k08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCTGCAGCATCTCCAGTCTCTGACATTGTCTTTTGAACGATGCCTCTTCCTCATTACATTGAAAAGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCACCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTCTACCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTAA
  3  -1   2       bld Tbd0      in                     NISC_nl21d10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACGATGCCTCTTCCTCATTACATTGAAAAGGGGGTTCCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCACCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTCTACCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTT
  3  -1   2       bld Lun1      in                         CABD7437.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCCATTACATTGAAAGGGGGTTCAGGGATTGTCCACTTGGTGGCGCCTAATCTTCTGGCTTTCTTTCTTCTCGCAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCACCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTCTACCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTTTAATTACATTTTTAATTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTA
  3   1   2       bld Gas7      in                         XZG29270.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCAACTCGGCATGCAGCTTATGGCTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCACCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTCTACCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTAATTACATTTTTAATTTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTG
  5   1   2       bld Fat1      in                         CABC9280.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTCAAGGCAACCCTGCAGTTGGTCCCCCTTCCCTTTTAAGAGAGAATTATATATAAATATATTTTTATTTTTTCTTTTGTTTTATTGTTTTTTTTTTTTTTCTGAATGAGAATGTGAATGAGAACCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCACCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTCTACCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTAATTACATTTTTAATTTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTACCGAAGATTTGGAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACA
  3  -1   2       bld Neu       in                    TNeu055d01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTTTTTTTTTTGTCTTTTTTTTTTTTTTCTGAATGAGAATGCTCCCCGCGCTGGCCAAAAAAAACAAAAACTAGCAAAAGACTAGAGCAAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAAAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCACCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTCTACCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTAATTACATTTTTAATTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTACCGAAGATTTGGAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCC
  3   1   2       bld Gas7      in                          XZG3601.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGAAAAAAAATTATCAAAACTGAAAACAAGACTGCCTTTTATTTCCCTTTTAAAACATGAATCTTTTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCCCCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTTTCCCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTAATTACATTTTTAATTTTTTTTCCCCCCTTAAGGACCAGGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTCCCGAAGATTATTTAATTGAAAAAAAAAAATTACCC
  5   1   2       bld Tad5      in                         XZT47503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGTCCGCAAGACTGCCTTTTATTTCCCTTTTAAACATGAATCTATTTAGCAGTGAGAACAAAATGATGAAACATTGCCTTATAGTAACCTAGAAGCTTGCAGAAGGAGCTGCCATATTGGAATAGAGCAGCAGCCAATCATAAGCATTTTGGAGCAGCCAATAAACAGAAGACTGGCTGCAGACCAGTCATATCACCTGGCACAATAGCCCCCACATTTCATGCTGCTGTTTATCTTCACTGGGACGACTGTTTCAAGGTTGTTCTACCCCAGGGCATATTAATTTGGTATTAAAAAAAAATTGCCGCATGATGTAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTAATTACATTTTTAATTTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTACCGAAGATTTGGAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCCCCCCCACC
  5   1   2       bld Tad5      in                         XZT51184.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCGAAAGCAGGAAGAGGCAATTTGATTTTTTTTTTAATTACATTTTTAATTTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTACCGAAGATTTGGAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCCCCCCCCCCC
  5   1   2       bld Eye       in                         CCAX2010.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTACCGAAGATTTGGAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCCCCCCCCCCCC
  5   1   2       e>1                                 Xt7.1-CABJ1592.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCCCCCCCCCCCCTCCCCCCGCCAGTTTTAGTAAATCACTGCCATCCCCGCTGCAGGTAGTGCTCTTCTGAATGCAGGAAATTCACAGAGACAATGGAATTGAAACTGCTTTCAGACTCTGTTGCAAAGCCAAATCTGACGGGTCTTGTGGCTGAGAAGGTGCATTTGTGCATGTAGCTGGCATGACAGACACTGCCATTGAATAAAATGGTGCCTAAAGGTTTGGTGTGTTCAGCCAAATCAAGTTACCAGAGCACTAATTAAATAAGCCTTCATATGATTAATTAGGGCTGGATCCTTAAGGAACCATGGCTGGTTACACAGATATTTAAATGCCCCTCCCCTTCATTCTTTATCCTCAGTAGCTGTTAATATTCACCATCGGTGGTGGCAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGACAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224691                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCCCCCCCCCCCCTCCCCCCGCCAGTTTTAGTAAATCACTGCCATCCCCGCTGCAGGTAGTGCTCTTCTGAATGCAGGAAATTCACAGAGACAATGGAATTGAAACTGCTTTCAGACTCTGTTGCAAAGCCAAATCTGACGGGTCTTGTGGCTGAGAAGGTGCATTTGTGCATGTAGCTGGCATGACAGACACTGCCATTGAATAAAATGGTGCCTAAAGGTTTGGTGTGTTCAGCCAAATCAAGTTACCAGAGCACTAATTAAATAAGCCTTCATATGATTAATTAGGGCTGGATCCTTAAGGAACCATGGCTGGTTACACAGATATTTAAATGCCCCTCCCCTTCATTCTTTATCCTCAGTAGCTGTTAATATTCACCATCGGTGGTGGCAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAxxxxAAAAAAAAAAAAAAAAAAAA
  3  -1   2       chi Gas5                                  XZF2522.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTGCAGCGCTGCAGCCTCGAGGCAATTTGATTTTTTTTTTAATTACATTTTTAATTTTTTTCCCCCCTTAAGGAACAAGAATAAACAAAATCAGTTCCATGCTGCAAAAGGGTTAGTTGTGTTGCATTTGCTGTGTTTCTTTGGGGACCTTAGGGCTTAATTCTACCGAAGATTTGGAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCCCCCCCCCCCCTCCCCCCGCCAGTTTTAGTAAATCACTGCCATCCCCGCTGCAGGTAGGGCTCTTCTGAATGCAGGAAATTCCCAGAGACAATGGAATTGAAACTGCTTTCAGACTCTGTTGCAAAGCCAAATCTGACGGGTCTTGTGGCTGAAAAGGTGCATTTGTGCATGTAGCTGGCATGACAAACACTGCCATTGAATAAAATGGTGCCTAAAGGTTTGGTGTGTTCAGCCAAATCAAGTTACCAGAGCTATTTCTTTTTCTNaaaaaaaaaaaaaaaaaaaaaaaaaaaaaggggaaaaaaaattaaaaaaaaaaaaaaaaaaaaggattaaaaaaaaaaaaaaaaaCCCCGGCCCCTTTGGGGGGGGTTATTTTCCTTAAACCCAAACTGGAAAAAAACCTTTGAGGAGTTGGGCCAACCCCCACCTAGATGGCGGGGAAAAAAAGGCTTTATTTGGAAAATTGGGAA
  3   1   2       bld Gas7 5g3  out                        XZG54157.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTGGGGGGCCTTGGGGGTTATTTTTTCCGAAGATTTGGAAATTTTTGGCCAATTGGCCCTCGGGGAACCCCAGATTCCAATGGGGGTTTGTTTACCCCTTAAAAGAATTCCCCCCCCCCCCTTCCCCGGCCAGTTTTAGTAAAACACTCCCCTCCCCCCCGCAGGTAGGGTTTTTTTGAATGCGGGAAATTTCCAGGGGCAAAGGAATTGAAAATGTTTTTAAATTTTGTTGAAAAAACAAATTTTAAGGGTTTTTTGGGTGAAAAAGGGCATTTTTGCAAGTAAGGGGCAAAACAAACACCCCCCTTGAAAAAAAAGGGGCCCAAAGGTTTGGGGGGTTTAGCCAAAACAAGTTTCCCGGGCCCTAATTAAAAAAGCCTTCATATGATTAATTAGGGGGGGGTCCTTAAGGAACCAAGGGGGGTTACCCAAAAATTTAAAAGCCCCCCCCCTTCATTTTTTTTCCCCAGGAGGGGTTAAAATTCCCCCTCGGGGGGGGGAGGGGCCATTTTTCCAGTTTTACCTTTACTTGGATTTGGGTTCCCAAAATTGGGGAAGAATAGGGGGGGAAAGGTTTTTATAAATTAAAGGG
  5   1   2       bld Neu                            TNeu119l17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTAATTCTACCGAAGATTTGGAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCCCCCCCCCCTCCCCCCGCCAGCTTTAGTAAATCACTGGCATCCCCGCTGCAGGTAGTGCTCTTCTGAATGCAGGAAATTCACAGAGACAATGGAATTGAAACTGCTTTCAGACTCTGTTGCAAAGCCAAATCTGACGGGTCTTGTGGCTGAGAAGGTGCATTTGTGCATGTAGCTGGCATGACAGACACTGCCATTGAATAAAATGGTGCCTAAAGGTTTGGTGTGTTCACCAAATCAAGTTACCAGAGCACTAATTAAATAAGCCTTCATATGATTAATTAGGGCTGGATCCTTAAGGAACCATGGCTGGTTACACAGATATTTAAATGCCCCTCCCCTTCATTCTTTATCCTCAGTAGCTGTTAATATTCACCA
  5   1   2       bld Tail      in                         CBSW1229.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAATTCTTGGCCAATTGGCCATCGCTGAACCACAGATTACAATCGAGACTCGTTTACACCTTAATAGACTCCCCCCCCCCCCCCCTCCCCCCGGCAGTTTTAGTAAATCACTGGCATCCCCGCTGCAGGGAGTGGTCTTCTGAATGCAGGAAATTCCCAGAGACAATGGAATTGAAACTGCTTTCAGACTCTGGTGCAAAGCCAAATCTGACGGGTCTTGGGGCTGAAAAGGGGCATTTGTGCATGTAGCTGGGATGACAGACACTGCCATTGAATAAAATGGTGCCTAAAGGGTTGGTGGGTTCAGCCCAATCAAGTTACCAGAGCACTAATTAAATAAGCCTTCATATGATTAATTAGGGCTGGATCCTTAAGGAACCATGGCTGGGTACACAGATATTTAAATGCCCCTCCCCTTCATTCTTTATCCTCAGTAGCTGTTAATATTCACCATCGGTG
  5   1   2       bld Eye       in                         CCAX3792.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCCAGTTTTAGTAAATCACTGCCATCCCCGCTGCAGGTAGTGCTCTTCTGAATGCAGGAAATTCACAGAGACAATGGAATTGAAACTGCTTTCAGACTCTGTTGCAAAGCCAAATCTGACGGGTCTTGTGGCTGAGAAGGTGCATTTGTGCATGTAGCTGGCATGACAGACACTGCCATTGAATAAAATGGTGCCTAAAGGTTTGGGTGTGGTTCAGCCAAATCAAGTTACCCA
  5   1   2       bld Gas7                                 XZG18190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGAAATTCACAGAGACAATGGAATTGAAACTGCTTTCAGACTCTGTTGCAAAGCCAAATCTGACGGGTCTTGTGGCTGAGAAGGTGCATTTGTGCATGTAGCTGGCATGACAGACACTGCCATTGAATAAAATGGTGCCTAAAGGTTTGGTGTGTTCAGCCAAATCAAGTTACCAGAGCACTAATTAAATAAGCCTTCATATGATTAATTAGGGCTGGATCCTTAAGGAACCATGGCTGGTTACACAGATATTTAAATGCCCCTCCCCTTCATTCTTTATCCTCAGTAGCTGTTAATATTCACCATCGGTGGTGGCAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTT
  5   1   2       bld Gas8                                   st1h18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTGAAACTGCTTTCAGACTCTGTTGCAAAGCCAAATCTGACGGGTCTTGTGGCTGAGAAGGTGCATTTGTGCATGTAGCTGGCATGACAGACACTGCCATTGAATAAAATGGTGCCTAAAGGTTTGGTGTGTTCAGCCAAATCAAGTTACCAGAGCACTAATTAAATAAGCCTTCATATGATTAATTAGGGCTGGATCCTTAAGGAACCATGGCTGGTTACACAGATATTTAAATGCCCCTCCCCTTCATTCTTTATCCTCAGTAGCTGTTAATATTCACCATCGGTGGTGGCAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCC
  3   1   2       bld Neu                             TNeu089a04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTAAATAAGCCTTCATATGATTAATAGGGGCTGGATCCTTAAGGAACCATGGCTGGTTACACAGATATTTAAATGCCCCTCCCCTTCATTCTTTATCCTCAGTAGCTGTTAATATTCACCATCGGTGGTGGCAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACAATACCGCGCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Gas5                                   XZF684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATATGATTAATTAGGGGCTGGATCCTTAAGGAACCATGGCTGGTTACACAGATATTTAAATGCCCCTCCCCTTCATTCTTTATCCTCAGTAGCTGTTAATATTCACCATCGGTGGTGGCAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAAAGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGT
  5   1   2       bld Tad5      in                         XZT62753.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGATCCTTAAGGAACCATGGCTGGTTACACAGATATTTAAATGCCCCTCCCCTTCATTCTTTATCCTCAGTAGCTGTTAATATTCACCATCGGTGGTGGCAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCCGATCAAAAA
  5  -1   2       bld Spl1      in                         CABK4125.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTCTTTATCCTCAGTAGCTGTTAATATTCACCATCGGTGGTGGCAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAG
  3   1   2       bld Te3  5g3  out                        CAAM4692.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAG
  3   1   2       bld Te3  PIPE out                       CAAM13915.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATC
  5   1   2       bld Ski1      in                         CABJ1592.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCTGCCATCTTGCCAGTTTTACCTCTACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCANANAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATT
  3   1   2       bld Te3       out                        CAAM5315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTTGGATTTGTGTTCCATATATTGGTGATGACTAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCGGATC
  3   1   2       bld Gas7      in                         XZG61255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGAGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATC
  5   1   2       bld Neu       in                   TNeu077l06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGATGACTAGTGGGTGAAAGGGTGGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCATGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTG
  5   1   2       bld Gas7      in                         XZG61255.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTGGGTGAAAGGGTAGATACGAGTGCCTAATACTCCCAGAATCCCTTGAGGGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCANAAAACAGAANAAAAAAAAAAAAGG
  3   1   2       bld Te3       out                       CAAM14537.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATACTCCCAGAATCCCTGGAGGGTGCTTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCGGTTC
  3   1   2       bld Gas6      in                         ANBT2003.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTCCGTAAGCACCCTCAAGGGATTCTGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAACC
  5   1   2       bld Gas6      in                         ANBT2003.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTCCGTAAGCACCCTCAAGGGATTCTGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4       in                        CAAN12258.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTGCTTACGGAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCGGATC
  3   1   2       bld Int1      in                         CAAP2647.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAACTGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTT
  5   1   2       bld Gas8      in                          st98m06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCACTTGCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGTCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCA
  5   1   2       bld Gas8      in                          st99m06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCACTTGGCCCCCTGGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGTCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCA
  3   1   2       bld Te4  PIPE in                          CAAN489.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACTGCCCCCCTGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATAGGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCCCCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCGGTTC
  3   1   2      seed Ski1      in                         CABJ1592.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTGCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGACAAAAAA
  3   1   2       bld Neu       in                    TNeu077l06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAAGTGTAGTAAAAATAAAAACCTCAAA
  5  -1   2       bld TpA                            TTpA067h10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGACAAAAAAAAAAAA
  5  -1   2       bld Tbd0      in                     NISC_nl21d10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGCAAGTATGCAGTGAACTTAGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Fat1      in                         CABC9280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGACAAAA
  3   1   2       bld Tad5      in                         XZT47503.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAAGGTATAAAAATAAAAACCTC
  3   1   2       bld Tad5      in                         XZT62753.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTCCTGATATGGTTATCTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGAC
  3   1   2       bld Te3  5g3  out                        CAAM9358.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCCTTTCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGAC
  3   1   2       bld Te3  5g3  out                        CAAM1705.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCTTTCCCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGAC
  5  -1   2       bld Neu       in                   TNeu055d01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGATGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTATAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAAAAAAAAA
  5  -1   2       bld Neu                            TNeu114d07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAAAAAAACCCCGGGCCCGGG
  3   1   2       bld Tad5      in                         XZT30996.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGGCATGTATGTGCTACAGATCATATATCTTCAGATATGTATAGAAATATATATAAATCCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTC
  5  -1   2       bld Lun1      in                         CABD7437.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGAC
  3   1   2       bld Te3       out                        CAAM1161.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGAC
  3   1   2       bld Tad5      in                         XZT51184.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGAC
  3   1   2       bld Tail      in                         CBSW1229.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCATGGTTAGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTNAAAAATAAAAACCTCAAAGACAAAAAAAAAAAAAAA
  5   1   2       bld Gas                            TGas055l15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGGCTGCTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCT
  3   1   2       bld TpA       in                    TTpA024l01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCATGTGATTTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAACCTCAA
  5   1   2       bld TpA       in                   TTpA024l01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCATGTGATTATTCTTTTACACTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGAC
  3  -1   2       bld TbA  5x3  out                   TTbA024n04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTTTTTTTTTTTTTACCTGGCCTACTCTTTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATC
  3  -1   2       chi Neu  5g   ?                     TNeu083h07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTTTTTCTTTTTTTTTTTTTTTTTTTTTTTCCAAAGGCATCATTAAACATTTATTCATTTTTACAGGACACCAAGATTACACTGTACAGGGTTACACAAATCATTTCTTGCCAGCTTTTACAGCAAACTTAGTCACTTTTCCAAAGCTTGCTGCCTTTTTATCCAAACCAGGGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAAATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAAACTGACACGCTTACATTTCTTGATGAAAGGGGATTGGGGCCCAGGGTATTGCTGTTCAAAAAATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAAACTATGGAATGCTTCAAATACATTACCCCCCACCCCCTTTATGCTCGGATCAAAAAACGGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTG
  3   1   2       bld Thy1                                CBST7829.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTATATTGACAGTAGCTAGTGTGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGAC
  3   1   2       chi HdA       out                   THdA045p09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAACTGGCAAGTTTCAAGAGGTCGACAGCATTGAACATGGCAATCTTTTGATTTGATTTCTTGGGTCNGAGTCCTCGTCGAGTTTTGGGTGTTCTTGAACCTAATGCTCCCCTATACTCTGATTTTACCCCCAGTTTTCCCTGCTGAGTTTTCCTAATCTCAGTTATGTGNTTCTCCCCAACATACAATACCCTATCCCAATAAATCTTGGCTGCTAATAAAAAAAACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAGACAAAAAAAAAAAAAAAAAAGCG
  5   1   2       bld Gas8      ?                           st84a02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTCCTTTAGTTTGCTCCTTCCCTCCCATATCTTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAAANGGATAAAATTGACAAAANGTAAAANACTTGAAT
  5   1   2       bld In54                            IMAGE:8945644.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTATTTTTATATAGGGGGAGTTTATTTGATTCGAATTCGTCCCGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGACAATGGTTTCTGATGCTTGTGTTATTGTGGGGGTAGTGCCGGTATGTATTTATATGCTTTCCACTTTAGTAAAATACCGTGTATAACCCTCTAGCGCCCTGTGTTCTAATCTGTGGGGGCCTTGCGTGTTGCAGGCTTCAACTCCCACTATTATTGCCAATAGAGTCGAGGCATCCTGGGTGTTTGTAGTTCTGCTAATTGCCTAGAAACAGTTAAAGACCGATAATCAGAAGCTGCTGAAAGCTAATTGACACATTAAGCTCTTAAGAATCAAAGGAACTTTACCTTAAACTTGTATTTGCATCCTCTTTGC
  5   1   2       bld Gas       in                   TGas065g21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGGGTGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTATATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAA
  3   1   2       bld Gas       in                    TGas065g21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGATTTTGGCCCCCATGTAGAATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCGAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCGTTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACGAAAAAAAGAAGTGTATAAAAAATAAAAACCTTCAAAGACATAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                           XZG994.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGATGGCAGGAACGAACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATCCAAAAAAAAAGGATAAAAATAAAAACCTC
  5   1   2       bld Gas                            TGas044g11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTGTAAAAATAAAAACCTCANAGCC
  5   1   2       bld Gas7      in                           XZG994.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACTGTTGCTTTGTTGCACCTTACAAATCCATTAAAATACAAACAACCTATTGCTCCAAACCAGTGACTCTAGCACTGCTGGGCTGGGAGTCACGCTGTCTTAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGACAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas1      in                     NISC_mq21a03.x2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGATTTGCACACAATTCACTTCAAACCACTTGTTTTCCCCCCCCAGGAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTTTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAACCAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATACCATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATCCAAAAAAAAATGTATAAAAATAAAACCCTCAAAGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd1                                  CBXT994.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCAGTTCAAACCAGTTGTTTTCCCCCCCCAGGAAGATTGACACGCTTACATTTTTTGATGAGAGTGGATTGGTGCTCAGTGTATTGGGGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATTGTAGACTTTGTG
  5   1   2       bld Neu       in                   TNeu063f20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTGTAAAAATAAAAACCTCAAAGAC
  3   1   2       bld Neu       in                    TNeu063f20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGACTGACACGCTTACATTTCTTGATGAGAGTGGATTGGTGCTCAGTGTATTGCTGTTCTAAAGATTCCACTACCTTCCCCTTCACAAGCCTTTGCCAACACTTAACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCACCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAAGTGTATAAAAATAAAAACCTCAAA
  3   1   2       bld Eye       in                         CCAX2010.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCTTCCACCTTCCAAAGTCATCGTTGACTTTGTGCAAACGCTGCTGCCCCCAGACTATGGAATGCTTCAGATACATTACCCCCCCCCCCCTTTATGCTCAGATCAAAAAACAGAAAGAAAAAAAAAAATTCAAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGAC
  3   1   2       bld Gas8      in                          st99m06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACNTTNCCCCCCCCCCCCNTTNTGGTCNGGTCNAAAAACCGNAAGNAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTNGTCATTTCTTGGTAATTTGTGGTAATTATACT
  3   1   2       bld Gas8      in                          st98m06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTNCCCCCCCCCCCCNTTNTGNTCNGGTCNAAAAACCGNAAGNAAAAAAAAAAATTCAAAAAAAATGGATAAAATTGACAAAATGTAAAATACTTGAATGAGCGCTTGTATTATAACATTAATATTATTCAGAGTATCCATTCTTATTGAGTTATGATTTTGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTCCTTTTAATACAAAAAAAAA
  3   1   2       bld Eye       in                         CCAX3792.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCTTCTAGCTGTGCTTTAGTCATTTCTTGGTAATTTGTGGTAATTATACTTTTTCCTTTTTAATACAAAAAAAAATGTATAAAAATAAAAACCTCAAAGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)