Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABK8504.5                            2 END     1           1       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     2  25.0    0(repeat)                                    0 REP     94       1130     1284                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012153461 Xt7.1-CABE6645.5.5 - 59 ESTs
                                                                       .........-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABE6645.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGAAGGTTGCGTTTCCGGTTGTCCACCAGCCGGTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAATCTGTGTTTTACTTAAAAGAAGCATGTAACTGGTTACAAGGTTTTCTTATGCTGAAACATGGGGGGGGAAGGACCACTTTGTCAATTGGTGCTGCCTGATTTTTATCTGCCTGATTTTTATCTGCCTCACAGGCTAGTGGGCTTAAAGGACAATGAAAGGTTAATATAAATTAAATGTAAATCTAAATGCATTCTTTTTAAGTACCTACTGCATATCTAAATGCCCAGATCCCTGCTTGCTTCTCTGAGATATGGTGCTGGCAGCCTACAGCAGTGTGAAGACTACAGTGACATCATTCTTCACAAAATGTAAATTACACATAAAAACATTGTCAAGTTCACTAATGAAGTTTTAACAACCGCTACGGATTTTACAGTTTTCCAATATAAAACGACAATGTTCTCTGAATCTAATGCAGAACGCTGACACATTGCAATTACGCTACAGATTTCTGATTAAATTGCATTAACATATAACATTCATCACCATTCAGTTGTTCTACAAAGCTTGATAATGGGTGGATATTGCTACAGGAGAAAGAATCAATATTTATTTTAGCGCTTTATTTTCTTTAACATTCATTCATTTTATAAAAAAAAAAGTAAAAATGCCTCAACAGTATATACACAAGTTGTAAGCTCTGGTGGAGCTGTACACCATGATTGAGAGCTGAATTGTTAACCCTTGGCAGCAGGGTTACCTGCACTGATTGAGATACACAAGTTGTACTTTCAATCCTATTGGCCATTTCAGGGGATAACCTTTGGCATTCTTGACAGGTGGAAGTTTAAGGTCATGGCAGATTATGTTGATCCAATCACAAGGGTTTTATTGGACAAAAATATTAATAGGAGGCAATATGCAATGATGCTTTGCCATAGGTCTGCTTCAGTATTTGGTACTTACTTTTTCAGAGTTTAGAAGCATATGAAACTCCTTTTATAATTACCGCTCTTGGACCAGCATTTTATGTAACCTTCTTAAAGGACAATGAAAGGTTAATATAAATTAAAAGTAGGTCTAAAGGCATTCTTTTTAA
                                                  Xt7.1-CHK-1008264865                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTGCGTTTCCGGTTGTCCACCAGCCGGTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAATCTGTGTTTTACTTAAAAGAAGCATGTAACTGGTTACAAGGTTTTCTTATGCTGAAACATGGGGGGGGAAGGACCACTTTGTCAATTGGTGCTGCCTGATTTTTATCTGCCTGATTTTTATCTGCCTCACAGGCTAGTGGGCTTAAAGGACAATGAAAGGTTAATATAAATTAAATGTAAATCTAAATGCATTCTTTTTAAGTACCTACTGCATATCTAAATGCCCAGATCCCTGCTTGCTTCTCTGAGATATGGTGCTGGCAGCCTACAGCAGTGTGAAGACTACAGTGACATCAxTxxxxACAAAATGTAAATTACACATAAAAACATTGTCAAGTTCACTAATGAAGTTTTAACAACCGCTACGGATTTTACAGTTTTCCAATATAAAACGACAATGTTCTCTGAATCTAATGCAGAACGCTGACACATTGCAATTACGCTACAGATTTCTGATTAAATTGCATTAACATATAACATTCATCACCATTCAGTTGTTCTACAAAGCTTGATAATGGGTGGATATTGCTACAGGAGAAAGAATCAATATTTATTTTAGCGCTTTATTTTCTTTAACATTCATTCATTTTATAAAAAAAAAAGTAAAAATGCCTCAACAGTATATACACAAGTTGTAAGCTCTGGTGGAGCTGTACACCATGATTGAGAGCTGAATTGTTAACCCTTGGCAGCAGGGTTACCTGCACTGATTGAGATACACAAGTTGTACTTTCAATCCTATTGGCCATTTCAGGGGATAACCTTTGGCATTCTTGACAGGTGGAAGTTTAAGGTCATGGCAGATTATGTTGATCCAATCACAAGGGTTTTATTGGACAAAAATATTAATAGGAGGCAATATGCAATGATGCTTTGCCATAGGTCTGCTTCAGTATTTGGTACTTACTTTTTCAGAGTTTAGAAGCATATGAAACTCCTTTTATAATTACCGCTCTTGGACCAGCATTTTATGTAACCTTCTTAAAGGACAATGAAAGGTTAATATAAATTAAAAGTAGGTCTAAAGGCATTCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             2     2     4     6     8     8    11    11    16    18    20    21    21    22    22    23    22    23    22    23    22    23    23    24    23    24    24    27    24    27    24    27    26    29    28    32    31    34    31    35    31    38    30    38    33    40    33    40    37    43    40    44    41    46    41    47    41    47    41    48    41    48    43    48    43    48    43    48    44    48    45    48    44    48    44    48    44    48    44    47    44    47    43    47    41    48    43    47    43    47    42    47    43    47    41    45    40    44    44    46    44    46    44    46    45    46    43    45    44    45    44    46    45    46    44    46    44    45    42    45    40    42    40    41    39    40    38    40    37    40    38    41    35    39    34    38    33    35    33    35    33    35    32    34    34    35    34    35    34    34    32    33    31    32    31    32    25    30    22    25    21    23     7    10     4     5     4     5     4     5     4     4     3     4     4     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     3     4     2     4     3     4     3     6     2     6     2     6     3     6     3     6     3     6     3     6     3     6     3     6     3     5     3     5     3     5     3     5     3     5     3     5     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2
  5   1   2      3-95                                 Xt7.1-CABE6645.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGAAGGTTGCGTTTCCGGTTGTCCACCAGCCGGTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAATCTGTGTTTTACTTAAAAGAAGCATGTAACTGGTTACAAGGTTTTCTTATGCTGAAACATGGGGGGGGAAGGACCACTTTGTCAATTGGTGCTGCCTGATTTTTATCTGCCTGATTTTTATCTGCCTCACAGGCTAGTGGGCTTAAAGGACAATGAAAGGTTAATATAAATTAAATGTAAATCTAAATGCATTCTTTTTAAGTACCTACTGCATATCTAAATGCCCAGATCCCTGCTTGCTTCTCTGAGATATGGTGCTGGCAGCCTACAGC
  5  -1   2      3-95                                 Xt7.1-CBSS3300.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCTTTTTTATTAGCAAGTCACTTTTCTAACATCTTTCTTCACAAAATGTAAATTACACATAAAAACATTGTCAAGTTCACTAATGAAGTTTTAACAACCGCTACGGATTTTACAGTTTTCCAATATAAAACGACAATGTTCTCTGAATCTAATGCAGAACGCTGACACATTGCAATTACGCTACAGATTTCTGATTAAATTGCATTAACATATAACATTCATCACCATTCAGTTGTTCTACAAAGCTTGATAATGGGTGGATATTGCTACAGGAGAAAGAATCAATATTTATTTTAGCGCTTTATTTTCTTTAACATTCATTCATTTTATAAAAAAAAAAGTAAAAATGCCTCAACAGTATATACACAAGTTGTAAGCTCTGGTGGAGCTGTACACCATGATTGAGAGCTGAATTGTTAACCCTTGGCAGCAGGGTTACCTGCACTGATTGAGATACACAAGTTGTACTTTCAATCCTATTGGCCATTTCAGGGGATAACCTTTGGCATTCTTGACAGGTGGAAGTTTAAGGTCATGGCAGATTATGTTGATCCAATCACAAGGGTTTTATTGGACAAAAATATTAATAGGAGGCAATATGCAATGATGCTTTGCCATAGGTCTGCTTCAGTATTTGGTACTTACTTTTTCAGAGTTTAGAAGCATATGAAACTCCTTTTATAATTACCGCTCTTGGACCAGCATTTTATGTAACCTTCTTAAAGGACAATGAAAGGTTAATATAAATTAAAAGTAGGTCTAAAGGCATTCTTTTTAAGTACTTACTGCATATCTAAATTCCCAGATCCCTGCTTGCTTCTCTGAGATATGGTGCTGGC
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------T---
                                               BLH ATG      44     787                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               BLH MIN      44      96                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               BLH OVR      38      49                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               CDS MIN      38      23                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               EST CLI      35      23                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               ORF LNG      38       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                                                       PROTEIN --- Sc ---- 8e-014     NP_011715.1 Transfers mannose residues from dolichyl phosphate-D-mannose to specificserine/threonine residues of proteins in the secretory pathway; Pmt6p[Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ==== 5e-053     NP_491320.1 stromal cell-derived factor 2 precursor (22.8 kD) (1E746) [Caenorhabditiselegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN -== Dm ==== 3e-060     NP_649527.1 CG11999-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 2e-060     XP_784191.1 PREDICTED: similar to stromal cell-derived factor 2 [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Gg ---- 5e-077     XP_001232858.1 PREDICTED: stromal cell-derived factor 2-like 1 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dr ---- 1e-080     NP_956333.1 stromal cell-derived factor 2 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 3e-090     NP_033169.2 stromal cell derived factor 2 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 3e-090     NP_008854.2 stromal cell-derived factor 2 precursor [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 8e-120     AAH82685.1 LOC494694 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = ?? ==== 8e-120     NP_001088005.1 hypothetical protein LOC494694 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 3e-126     CAJ83207.1 stromal cell-derived factor 2 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABE6645.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------ATG---------------------------------------------TGA---------TAG------TGA------------------------------------------------------TGAATG------TAA---------------------------------------------------------------------------------------------------TGA---------------------------------------TAA---------------------------TGA------------TAA---------------------TAA------------------------------------TGA---ATG---------------------------------------------------------------------------------------------------------TAA------------------------------------------------TAAATG------------------------------------------------------------------------------------ATGTAA------------------------------------------------------------------------------------ATG------------------------TGA------------------------------TAA------------------------------------------------------ATG---------------------------------------TAG---------------------------------------------------------------------------------------------------------TGA------------TAA------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATGATG------------------------------------------------TAG------ATG------------TAA------------------------ATGTAA------TAA------ATG------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           TpA  FL                     TTpA009i20.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCGTTTCCGGTTGTCCACCAGCCGGTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAAAAACAAAAAAAAAAAAAAAAAAAA
  5   1   2      3-95                                 Xt7.1-CABE6645.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGAAGGTTGCGTTTCCGGTTGTCCACCAGCCGGTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAATCTGTGTTTTACTTAAAAGAAGCATGTAACTGGTTACAAGGTTTTCTTATGCTGAAACATGGGGGGGGAAGGACCACTTTGTCAATTGGTGCTGCCTGATTTTTATCTGCCTGATTTTTATCTGCCTCACAGGCTAGTGGGCTTAAAGGACAATGAAAGGTTAATATAAATTAAATGTAAATCTAAATGCATTCTTTTTAAGTACCTACTGCATATCTAAATGCCCAGATCCCTGCTTGCTTCTCTGAGATATGGTGCTGGCAGCCTACAGC
                                                  Xt7.1-CHK-1008225205                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTGCGTTTCCGGTTGTCCACCAGCCGGTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAATCTGTGTTTTACTTAAAAGAAGCATGTAACTGGTTACAAGGTTTTCTTATGCTGAAACATGGGGGGGGAAGGACCACTTTGTCAATTGGTGCTGCCTGATTTTTATCTGCCTGATTTTTATCTGCCTCACAGGCTAGTGGGCTTAAAGGACAATGAAAGGTTAATATAAATTAAATGTAAATCTAAATGCATTCTTTTTAAGTACCTACTGCATATCTAAATGCCCAGATCCCTGCTTGCTTCTCTGAGATATGGTGCTGGCAGCCTACAGCAGTGTG
  5   1   2       bld Lun1      in                         CABD6829.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCGATTAGCTGACCACTGCTTGAATCTCAGTGAGTCCTGCCCAATTTTGCAAATTGGGAGAAGGTGGCAGCCCTAGAAATGTTGCTGCTGGTAGAGAAGCTCAAAACATAATGTACATTTCTGGCCTAATTCTTCTCTAAGCTTTAGTTCTCCTTTAAGATGAAAATGTAAATTGTCCTACAATCTCACCCTAAATAGGCCTCAGACTGAGCTTTCCTGACAGGGCTCCTAGCCTCCAGGGGAACACAGCAACCCCACTGTTTGGGAAGTCCCCGCTCCCACCTATTTCCAGATTATTTCATTCATTGCGAGTTAGTACTTCCGGAACAGGAAGGTTGCGTTTCCGGTTGTCCACCAGCCGGTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGTAAGATGAGGGCACATCCCCCAGCGCAAGTGGCACGTCATCAGCGCACCCAGTTCCCTCTGGAGAGGTAAAGTGCCCTCCATGGCATTAGGCGCTGGCAGGTTCCCGTGAGCAGGGTGTTAATGCTTGGCTTANAGCGACATAGCCCTCTCTGTTTAATCAATGGAATTGAAATATAGTGTGTGCCTGGNGGAGGGAGAGACTGTAATCGCGCAGTCGCTGTCAGTTATATGTACAGTATAGCAAATGTGT
  5   1   2       bld Neu  5g                        TNeu021m02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGAAGGTTGCGTTTCCGGTTGTCCACCAGCCGGTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTC
  5   1   2   10  bld Ova1 5g3  in                         CABE8004.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGATTCGAATTGGCCGAGGGTCCACCAGCCGGTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGNTGCCCATTCTGC
  5   1   2       bld Neu  5g3  in                   TNeu130b10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCGTTTCCGGTTGTCCACCAGCCGGTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGA
  5   1   2       bld Gas  5g                        TGas035l24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGTTTCCGGTTGTCCACCAGCCGGTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGNGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCT
  5   1   2       bld TpA  FL   in                   TTpA009i20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGTTTCCGGTTGTCCCCAGCCGGTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACG
  5   1   2       bld HeRe 5g3  in                     EC2CAA20DB04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTCCACCAGCCGGTGAATGAAGATGACGAAGGCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACTTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGGCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTCCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACT
  5   1   2       bld HeRe 5g                          EC2CAA25AD02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTCCACCAGCCGGTGAATGAAGATGACGAAGGCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGGCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTCCGATTTAGACACACATCTACCAGTGTTTTCCTCTTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCC
  5   1   2       bld HeRe 5g3  in                     EC2CAA18BG07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGCCGGTGAATGAAGATGACGAAGGCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACTTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGGCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTCCGATTTAGACACCCATCT
  5   1   2       bld Neu  5g                        TNeu030j14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCA
  5   1   2       bld HeRe 5g3  in                     EC2CAA32CF06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAATGAAGATGACGAAGGCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACTTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGGCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGACCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTT
  5   1   2       bld Neu  5x3  out                  TNeu078f24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATAATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCA
  5   1   2       bld Eye       in                         CCAX4236.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGA
  5   1   2       chi Thy1      in                        CBST8137.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAAATCGAATTCCTTACTGGCTTTGTTCCACNGGTTCTTTTATCCATACTAGATATCTATTCGTGTTTGGCTTCTTTTGGTTATCCCCCAATGCGTTTCAGGCCTTCAGTATAGTTCTGAGAACAACGACGGCGCACCTGCTGATACAAGACTACATCTCCCAGCATTCCTCGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCANGATTTTCCTCAGATCCTGAATGGTCACTTAAAAGTTCAGCTCAGAAATATTTTAAATGTGGA
  5   1   2       bld TbA       in                   TTbA044g15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTC
  5   1   2       bld HdA       in                  THdA036n07.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGACGAAGCCTCACGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTATACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCATAGCAGATGATGAACTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCATGTGAGCAGTCCCGGACACTGAACGTTCATACTGAAATGTGATGGCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCTGTCTTGATTTTCTGTTTATCGTTAATGGTCACGTGAAGAAAATTCATCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTG
  5   1   2      seed TpA       in                   TTpA004o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCT
  5   1   2       bld TbA       in                   TTbA056p24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTACACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAAGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTANAAAGTTCAGCTCAGACATATTTTAAATGTGGA
  5   1   2       bld Lun1      in                         CABD7768.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCC
  5   1   2       bld Neu                            TNeu016g07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAATACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATC
  5   1   2       bld HeRe      in                     EC2CAA31AH08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACTTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGGCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATA
  5   1   2       bld Ova1      in                         CABE6645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGNTGGATTTGAATACAACATTTTTTAAAACAAAAAAAAAAAAAAAAACTCGAGC
  5   1   2       bld Hrt1      in                         CAAQ9038.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTG
  3   1   2       bld Hrt1      in                         CAAQ9038.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTA
  3   1   2       bld Neu       out                   TNeu078f22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE6645.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAC
  3   1   2       bld Lun1      in                         CABD6829.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACACAAATGCTACTGTGCATGTATTTGTTGTGAGACCCCTAACTAATAAGTTGTACATCTAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTTTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAAC
  3   1   2       bld TbA       in                    TTbA044g15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTTTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGATTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTAAAACAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Lun1      in                         CABD7768.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTCGCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTC
  3   1   2       bld HeRe 5g3  in                     EC2CAA20DB04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACGACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTCCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTCATCTCAGCTGCTGTGGATTTGAAA
  3   1   2       bld Neu  5g3  in                    TNeu130b10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACGACGTAGATATGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACNCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA       in                   THdA036n07.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGTTAGATATGGTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCTGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCTTCTGTGTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTTTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCTGGACACAGAACATTCATACTGAATTATGATGTCACTTATAGAGATTGTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCTTGAATGGTCACTTAAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAAAAAAAAAAAGAA
  5   1   2       bld AbdN                               IMAGE:7005654                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTCAGGCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAAACAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACCACATTTTTAAAACAAAATCTGTGTTTTACTTAAAAGAAGCATGTAACTGGGTTACAAGTTTTCTTATGCTGAAACATTGGGGGGGGGAAGGGACACTTTTGTCAATTGGNTGCTGCCCTGATTTTTAATCTGCCCTGATTTTTATCTTGCCTCACAGGGCTAANTGGGGCTTTAAAGGGACAATGGAAAGGGTTAATATNAAATTAAA
  5   1   2       bld HdA       in                  THdA028m20.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGCGGACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCATAAGGAAGTTCACGGCATGTCATACGCAAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCACTCCCGGACACATAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCGTGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTC
  3   1   2       bld HdA       in                   THdA028m20.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACAGCAATCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTATTGGCGTATCCGTGGACAAACCTCACACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTATAACACATGTCAACACAGGGGGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTGGATTTAGACACACATCTACCAGTGTTTTCTTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATATTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATAGTGAATTATGATGTCACCTATAGAGATTCTGATTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCGTGAATGGTCACTTAAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAATTGAGGTGTAACACGCGGGCACGTCCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGACTGCTGTTGGATTTGAATACAAACATTTTTAAACAAAAAAAAAAAAAAAAA
  5   1   2       chi Neu       in                   TNeu101k11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGAATGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAGTGGTCGCTTAAAAAGTTCAGCTCAGAGATATTTTAAAT
  3   1   2       bld TpA                             TTpA060g01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGACAAACCTCCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAACAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA                            TTbA066d09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTTATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTT
  3   1   2       bld HeRe 5g3  in                     EC2CAA18BG07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTCCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTCATCTCAGCTGCT
  3   1   2       bld Thy1      in                        CBST8137.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAGTTACTGGCGTATCCGTGGACAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAATCTGTGTTTTACTTAAAAGAAGCATGTAACTGGT
  3   1   2       bld Neu       in                    TNeu101k11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCACTCCCTTGCTGCTGCCGGTGAGCATTGCCTCTGAGCTGTCCGTGGTGACTTGCGGCTCAGTGGTCAAGCTGCTCAATATCAAGCACAGCGTCCGTCTCCATTCGCACGACGTTAGATATGGTTCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAACCAAAAAAAGAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA056p24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACAAACCTCCACCGTGTGTGAGAGAGGAAAAGTAATTAAATGTGGACAGTCTGTGCGTTTAACACATGTCAACACAGGGCGCAATGTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTTGATTTAGACACACATCTACCAGTGTTTTCCTTTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCATGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATGTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATATTGAATTATGATGTCACCTATAGAGACTTTGACTCCTTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTGGATTGAATACAACATTTTAAAACAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld HeRe      in                     EC2CAA31AH08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAACCTCCACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTTTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTCATCTCAGCTGCTG
  3   1   2       bld Ova1 5g3  in                         CABE8004.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCGTGTGTGAGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTAAAAC
  3   1   2       bld Eye       in                         CCAX4236.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTTTAACACATGTCCAACACAGGGCCCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGATTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACCCCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATTTCAGCTGCTGTTGGATTTGAATACAACATTTTT
  3   1   2       bld HeRe                             EC2CAA15DB01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAGAGGAAAACTAATTAAATGTGGACAGTCTGTGCGTCTAACACACGTCAACACAGGGCGCAATGTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTGTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATATTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCGGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTTTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCTCGGAA
  5   1   2       bld Ski1      in                         CABJ9914.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCGGCACGAGGGTCTGTGCGTCTAACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAATCTGTGTTTTACTTAAAAGAAGCATGTAACTGGTTACAAGGTTTTCTTATGCTGAAACATGGGGGGGGAAGGACCACTTTGTCAATTGGTGCTGCCTGATTTTTATCTGCCTGATTTTTATCTGCCTCACAGGCTAGTGNgcttaaaggacaatgaaaggttaatataaattaaatgtaaatctaaatgcattctttttaagtacctactgcatatctaaatgcccagatccctgctntgctctctgagatatggtgctggcagcctacagcagtgtgaaga
  3   1   2       bld TpA  FL   in                    TTpA009i20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACACATGTCAACACAGGGCGCAATCTGCACAGTCATCACTTTACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATACTGGATGACTGGACTGTTCTATGTGGTGGTGAATTCTGGCAAAGAGATGATGAAGTTCGATTTAGACACACATCTACCAGGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAAAAACAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Te1                                  CBWN4250.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGATGATGAAGTCCGAATTTAGACACACATCTACCAGTGTTTTCCTCTCTGTCACAGGGGAACAGTATGGGAGGCCCATTAACGGCCAGAGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe      in                     EC2CAA25CF10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTCATCTCAGCTGCTGTGGAT
  5   1   2       bld HeRe      in                     EC2CAA25CF10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGAAGTTCACGGCATGTCATACGCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTTAAACCAAA
  5   1   2       bld Tad0                               IMAGE:6984109                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATACGCTAACCAAAACAGCTATTGGGAAAGTCATGGAGGGTATCTTCATGAAGCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAATCTGTGTTTTACTTAAAAGAAGCATGTAACTGGTTACAAGGTTTTCTTATGCTGAAACATGGGGGGGGAAGGACCACTTTGTCAATTGGTGCTGCCTGATTTTTATCTGCCTGATTTTTATCTGCCTCACAGGCTAGTGGGCttaaaggacaatgaaaggtgaatataaattaaatgtcaatctgaatgcattcattttaagtacctactgcatatcaaaattgccaagatccctgcttgcttctctaagacatggtgctggcgacctacagtatttgtgaagactaTTAGGATCTTGGTGAATATTCTCTTCTTTCGCTTGGGGTAGTTCTGGTTAGATAAACACTAACCTCATAAAAATAAATCTATTT
  3   1   2       bld HeRe 5g3  in                     EC2CAA32CF06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCCAGTGAGCAGTCCCGGACACAGAACATTCATACTGAATTATGATGTCACCTATAGAGACTCTGACTCCCTTTCCTTAACCATACAGTGTTGGGATCAATCAGGATTTTCCTCAGATCCTGAATGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAA
  3   1   2       bld TpA       in                    TTpA004o13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTCACTTAAAAAGTTCAGCTCAGAAATATTTTAAATGTGGATTCAAGGGCATGGTTTGTATTGTTGCCCATTCTGCNTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ski1      in                         CABJ9914.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGGTATTATTGTTTTTATGTCCAGTAAGGAACTGAGGTGTAACACCGGGCACGTCCCTGGAACAAAGTAATTTTTAAATATTTCATCTCAGCTGCTGTTGGATTTGAATACAACATTTTTAAAACAAAAATCTGTGTTTTACTTAAAAGAAGCATGTAACTGGTTACAAGGTTTTCTTATGCTGAAACATGGGGGGGGAAGGACCACTTTGTCAATTGGTGCTGCCTGATTTTTATCTGCCTGATTTTTATCTGCCTCACAGGCTAGTGGgcttaaaggacaatgaaaggttaatataaattaaatgtaaatctaaatgcattctttttaagtacctactgcatatctaaatgcccagatccctgcttgcttctctgagatatggtgctggcagcctacagcagtgtgaagactacagtgacatcactgaaatctctcttcccttcctgtaggctgtcttctgttctgcgctacacatacccaccagccaatcagaagcagatctagcagaggggaggggggtgggcatgaaacacttgtgcagtatgaagcaaggaaggaaatgaagggagaatacccttttagagatggctgcctgttctagaaaatgtgaagtaagtgtgactgagtaagtatttgattaggtgagccaaaaatgtggcgtttttactaaacaataggaggactattgggcactatgctttttacattttgacttgcattctcctttaaaGGTCACCTTTAACTTTAAGTGTTTATTTTACCTTTGTATTTGTCTAATGAAAATATTAATATCCAAATGT
  3   1   0       add TpA       out                   TTpA003n04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGATTTTTATCTGCCTGATTTTTATCTGCCTCACAGGCTAGTGGGCttaaaggacaatgaaaggttaatataaattaaatgtaaatctaaatgcattctttttaagtacctactgcatatctaaatgcccagatccctgcttgcttctctgagatatggtgctggcagcctacagcagtgtgaagactacagtgacatcactgaaatctctcttcccttcctgtaggctgtcttctgttctgcgctacacatacccaccagccaatcagaagcagatctagcagaggggaggggggtgggcatgaaacacttgtgcagtatgaagcaAGGAAGGAAATGAAGGGAGAATCCCTTTTTAGAGATGGCTGCCTGTTCTAGAAAATGTGAAGTAAGTGTGACTGAGTAAGTATTTGATTAGGTGAGCCAAAAATGTGGCGTTTTTACTAAACAATAGGAGGACTATTGGGCACTATGCTTTTTACATTTTGACTTGCATTCTCCTTTAAAGGTCACCTTTAACTTTAAGTGTTTATTTTACCTTTGTATTTGTCTAATGAAAATATTAATATCCAAAAAAAAAAAAAAAAAA
  5  -1   2      3-95                                 Xt7.1-CBSS3300.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCTTTTTTATTAGCAAGTCACTTTTCTAACATCTTTCTTCACAAAATGTAAATTACACATAAAAACATTGTCAAGTTCACTAATGAAGTTTTAACAACCGCTACGGATTTTACAGTTTTCCAATATAAAACGACAATGTTCTCTGAATCTAATGCAGAACGCTGACACATTGCAATTACGCTACAGATTTCTGATTAAATTGCATTAACATATAACATTCATCACCATTCAGTTGTTCTACAAAGCTTGATAATGGGTGGATATTGCTACAGGAGAAAGAATCAATATTTATTTTAGCGCTTTATTTTCTTTAACATTCATTCATTTTATAAAAAAAAAAGTAAAAATGCCTCAACAGTATATACACAAGTTGTAAGCTCTGGTGGAGCTGTACACCATGATTGAGAGCTGAATTGTTAACCCTTGGCAGCAGGGTTACCTGCACTGATTGAGATACACAAGTTGTACTTTCAATCCTATTGGCCATTTCAGGGGATAACCTTTGGCATTCTTGACAGGTGGAAGTTTAAGGTCATGGCAGATTATGTTGATCCAATCACAAGGGTTTTATTGGACAAAAATATTAATAGGAGGCAATATGCAATGATGCTTTGCCATAGGTCTGCTTCAGTATTTGGTACTTACTTTTTCAGAGTTTAGAAGCATATGAAACTCCTTTTATAATTACCGCTCTTGGACCAGCATTTTATGTAACCTTCTTAAAGGACAATGAAAGGTTAATATAAATTAAAAGTAGGTCTAAAGGCATTCTTTTTAAGTACTTACTGCATATCTAAATTCCCAGATCCCTGCTTGCTTCTCTGAGATATGGTGCTGGC
                                                  Xt7.1-CHK-1008251252                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATTTCxxxTTTTTTATTAGCAAGTCACTTTTCTAACATCTTTCTTCACAAAATGTAAATTACACATAAAAACATTGTCAAGTTCACTAATGAAGTTTTAACAACCGCTACGGATTTTACAGTTTTCCAATATAAAACGACAATGTTCTCTGAATCTAATGCAGAACGCTGACACATTGCAATTACGCTACAGATTTCTGATTAAATTGCATTAACATATAACATTCATCACCATTCAGTTGTTCTACAAAGCTTGATAATGGGTGGATATTGCTACAGGAGAAAGAATCAATATTTATTTTAGCGCTTTATTTTCTTTAACATTCATTCATTTTATAAAAAAAAAAGTAAAAATGCCTCAACAGTATATACACAAGTTGTAAGCTCTGGTGGAGCTGTACACCATGATTGAGAGCTGAATTGTTAACCCTTGGCAGCAGGGTTACCTGCACTGATTGAGATACACAAGTTGTACTTTCAATCCTATTGGCCATTTCAGGGGATAACCTTTGGCATTCTTGACAGGTGGAAGTTTAAGGTCATGGCAGATTATGTTGATCCAATCACAAGGGTTTTATTGGACAAAAATATTAATAGGAGGCAATATGCAATGATGCTTTGCCATAGGTCTGCTTCAGTATTTGGTACTTACTTTTTCAGAGTTTAGAAGCATATGAAACTCCTTTTATAATTACCGCTCTTGGACCAGCATTTTATGTAACCTTCTTAAAGGACAATGAAAGGTTAATATAAATTAAAAGTAGGTCTAAAGGCATTCTTTTTAAGTACTTACTGCATATCTAAATTCCCAGATCCCTGCTTGCTTCTCTGAGATATGGT
  3  -1   2       bld Spl2      in                        CBSS3300.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGTAATTTCCTTTTTTATTAGCAAGTCACCTTTTCTAACATCCTTTCTTCACAAAATGTAAATTACACATAAAAACATTGTCAAGTTCACTAATGAAGTTTTAACAACCGCTACGGATTTTACAGTTTTCCAATATAAAACGACAATGTTCTCTGAATCTAATGCAGAACGCTGACACATTGCAATTACGCTACAGATTTCTGATTAAATTGCATTAACATATAACATTCATCACCATTCAGTTGTTCTACAAAGCTTGATAATGGGTGGATATTGCTACAGGAGAAAGAATCAATATTTATTTTAGCGCTTTATTTTCTTTAACATTCATTCATTTTATAAAAAAAAAAGTAAAAATGCCTCAACAGTATATACACAAGTTGTAAGCTCTGGTGGAGCTGTACACCATGATTGAGAGCTGAATTGTTAACCCTTGGCAGCAGGGTTACCTGCACTGATTGAGATACACAAGTTGTACTTTCAATCCTATTGGCCATTTCAGGGGATAACCTTTGGCATTCTTGACAGGTGGAAGTTTAAGGTCATGGCAGATTATGTTGATCCAATCACAAGGGTTTTATTGGACAAAAATATTAATAGGAGGCAATATGCAATGATGCTTTGCCATAGGTCTGCTTCAGTATTTGGTACTTACTTTTTCAGAGTTTAGAAGCATATGAAACTCCTTTTATAATTACCGCTCTTGGACCAGCATTTTATGTAACCTTCTTAAAGGACAATGAAAGGTTAATATAAATTAAAAAGTAGTCTAAAGGCA
  3  -1   2       bld Spl1      out                        CABK8504.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGTAATTTCCTTTTTTATTAGCAAGTCACTTTTCTAACATCTTTCTTCACAAAATGTAAATTACACATAAAAACATTGTCAAGTTCACTAATGAAGTTTTAACAACCGCTACGGATTTTACAGTTTTCCAATATAAAACGACAATGTTCTCTGAATCTAATGCAGAACGCTGACACATTGCAATTACGCTACAGATTTCTGATTAAATTGCATTAACATATAACATTCATCACCATTCAGTTGTTCTACAAAGCTTGATAATGGGTGGATATTGCTACAGGAGAAAGAATCAATATTTATTTTAGCGCTTTATTTTCTTTAACATTCATTCATTTTATAAAAAAAAAAGTAAAAATGCCTCAACAGTATATACACAAGTTGTAAGCTCTGGTGGAGCTGTACACCATGATTGAGAGCTGAATTGTTAACCCTTGGCAGCAGGGTTACCTGCACTGATTGAGATACACAAGTTGTACTTTCAATCCTATTGGCCATTTCAGGGGATAACCTTTGGCATTCTTGACAGGTGGAAGTTTAAGGTCATGGCAGATTATGTTGATCCAATCACAAGGGTTTTATTGGACAAAAATATTAATAGGAGGCAATATGCAATGATGCTTTGCCATAGGTCTGCTTCAGTATTTGGTACTTACTTTTTCAGAGTTTAGAAGCATATGAAACTCCTTTTATAATTACCGCTCTTGGAACAGCATTTTATGTAACCTTcttaaaggacaatgaaaggttaatataaattaaaagtaggtctaaaggcattctttttaagtacttactgcatatctaaattcccagatccctgcttgcttctctgagatatggtgctggc
  5  -1   2      seed Spl2      in                        CBSS3300.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCTTTTTTATTAGCAAGTCACTTTTCTAACATCTTTCTTCACAAAATGTAAATTACACATAAAAACATTGTCAAGTTCACTAATGAAGTTTTAACAACCGCTACGGATTTTACAGTTTTCCAATATAAAACGACAATGTTCTCTGAATCTAATGCAGAACGCTGACACATTGCAATTACGCTACAGATTTCTGATTAAATTGCATTAACATATAACATTCATCACCATTCAGTTGTTCTACAAAGCTTGATAATGGGTGGATATTGCTACAGGAGAAAGAATCAATATTTATTTTAGCGCTTTATTTTCTTTAACATTCATTCATTTTATAAAAAAAAAAGTAAAAATGCCTCAACAGTATATACACAAGTTGTAAGCTCTGGTGGAGCTGTACACCATGATTGAGAGCTGAATTGTTAACCCTTGGCAGCAGGGTTACCTGCACTGATTGAGATACACAAGTTGTACTTTCAATCCTATTGGCCATTTCAGGGGATAACCTTTGGCATTCTTGACAGGTGGAAGTTTAAGGTCATGGCAGATTATGTTGATCCAATCACAAGGGTTTTATTGGACAAAAATATTAATAGGAGGCAATATGCAATGATGCTTTGCCATAGGTCTGCTTCAGTATTTGGTACTTACTTTTTCAGAGTTTAGAAGCATATGAAACTCCTTTTATAATTACCGCTCTTGGACCAGCATTTTATGTAACCTTCTTAAAGGACAATGAAAGGTTAATATAAATTAAAAGTAAGTCTAAAGGCATTCTTTTTAAGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)