Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 99%

 1012153466 Xt7.1-CABI12801.3.5 - 108 ESTs
                                                                       .....-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470......5480......5490......5500......5510......5520......5530.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CABI12801.3.5                                              TCTCACACTTACCCCTCCGCGAACGAGAGGCCGAGTCTCATGGGAGCACCGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCAAAGACCCCACCATTGCCTTCAGATGTGCCAAAAGAGGCAAAAGATAACAAAAAGCAAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGACTGGACGTGTCTTCAGAGGCTGAAACCAAAGCCAAGCTTTCTTCTTCATCTCTTTCTAACTCTGCTGCATCTATTTCTGGTGGCCAGGATGGTGTGCCAACTTCTTTGCCTGATTTTCCTACTGCTTCCAATGCCCCATCTTCTCCTTTAGAACACTACCTAAGTTTACAATGTGACAACAAAGTTGAAACACCAGTAGAGTCATATACTGACTATGAGACACCTTCAGTGCCTTTGTTCTGGAGGTCAGGTTTGTCACAGAGTAAACAGCCTGAGCCTAGGGAGGTTCATGTTGTTGAACCGTTCAATGAAAAAACCAAAGAGAGAAAGACTTATGTCAAATCTCTTCTTGACCAGCTGACACGCAAGTCACCAACTAATAGTGTGGCTGATGCCGATACCGTTGATGTAGATTTGGTTAAGGGAGTTTTCCCTATACAAGATAGCTCTCCCTTTGATGACATTCCACATACAGATACAGATAGTCTTGAGAGTGAAAAAAGTGATGTGCAGTTAACTAAAACTTTAAAAGAAACTCCAAAACCAGCCCCCAGAACACAGTCTGCTCCTAAAAAACAAGAACCAAAGGATGAAATTAAACCAGTACCACCAAAACCAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCTGCGGCCGCTCTAGCCCAGCTCACTCACGATGAGTTAATTCAGCTGGTCCTGAAGCAAAAAGACATCATCTCAAAGAAAGAAGTCCAAATGCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATGTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTATATTCTGACATTTATGCTGTACTGATTGCATCTCACACAGAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTAT
                                                  Xt7.1-CHK-1008266230                                                    ACTTACCCCTCCGCGAACGAGAGGCCGAGTCTCATGGGAGCACCGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCAAAGACCCCACCATTGCCTTCAGATGTGCCAAAAGAGGCAAAAGATAACAAAAAGCAAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGACTGGACGTGTCTTCAGAGGCTGAAACCAAAGCCAAGCTTTCTTCTTCATCTCTTTCTAACTCTGCTGCATCTATTTCTGGTGGCCAGGATGGTGTGCCAACTTCTTTGCCTGATTTTCCTACTGCTTCCAATGCCCCATCTTCTCCTTTAGAACACTACCTAAGTTTACAATGTGACAACAAAGTTGAAACACCAGTAGAGTCATATACTGACTATGAGACACCTTCAGTGCCTTTGTTCTGGAGGTCAGGTTTGTCACAGAGTAAACAGCCTGAGCCTAGGGAGGTTCATGTTGTTGAACCGTTCAATGAAAAAACCAAAGAGAGAAAGACTTATGTCAAATCTCTTCTTGACCAGCTGACACGCAAGTCACCAACTAATAGTGTGGCTGATGCCGATACCGTTGATGTAGATTTGGTTAAGGGAGTTTTCCCTATACAAGATAGCTCTCCCTTTGATGACATTCCACATACAGATACAGATAGTCTTGAGAGTGAAAAAAGTGATGTGCAGTTAACTAAAACTTTAAAAGAAACTCCAAAACCAGCCCCCAGAACACAGTCTGCTCCTAAAAAACAAGAACCAAAGGATGAAATTAAACCAGTACCACCAAAACCAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCTGCGGCCGCxxxxxCCCAGCTCACTCACGATGAGTTAATTCAGCTGGTCCTGAAGCAAAAAGACATCATCTCAAAGAAAGAAGTCCAAATGCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATGTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTATATTCTGACATTTATGCTGTACTGATTGCATCTCxCACAxAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCACAA
                                                      consensus depths                                                   3     3     4     4     3     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     6     7     7     8     8     9    12    12    16    16    16    16    18    18    18    18    18    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    20    20    20    20    19    19    19    19    19    19    19    20    19    20    18    19    18    19    18    19    18    19    17    18    17    19    17    19    18    19    18    19    18    19    18    19    18    19    18    19    15    16    14    15    14    14    14    14    12    12    12    12    12    12    12    12    12    12    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    10    10    10    10     9     9     8     8     7     7     6     7     5     6     5     6     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     3     6     3     6     3     6     3     6     3     6     4     7     4     7     4     7     4     6     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     4     6     4     6     4     6     4     6     4     6     5     6     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     3     5     3     6     3     5     3     5     4     7     6     8     6     8     6     8     6     8     7     9     8    10     8    10     8    10     8    10     8    10    10    12    11    13    11    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    12    13    12    13    12    13    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     2     2     1     1     2     2     2     2     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     7     5     7     6     7     6     7     6     7     6     7     6     7     7     9    12    14    11    14     7    14     7    15     7    15     8    16     8    16     8    16     8    15     9    16    10    16    10    16    10    16    10    15    10    14    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    13    11    13    11    13    10    12     9    11    10    12    10    12    10    12    10    12    10    12    10    12    10    12     9    11     9    11    10    12    10    12    10    12     9    11     9    11     9    11     8    10     8     9    10    11    10    11    10    11    10    11    10    11     9    10     9    10     8     9     8     9     8     9     9    10     8    10     8    10     8    10     8    10     8     9     8     9     8     9     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     7     7     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    11    10    11    10    11    10    11    12    13    12    13    15    19    21    24    19    24    22    24    24    26    24    28    28    28    31    31    30    30    30    30    31    31    32    32    32    32    34    34    34    34    36    36    36    36    36    36    34    34    34    34    34    34    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    39    37    39    37    39    37    39    38    40    38    40    36    38    36    38    36    38    36    38    36    39    36    39    39    39    38    39    39    39    39    39    39    39    39    39    38    39    40    41    39    40    39    40    39    40    39    40    38    39    38    39    38    39    38    39    38    39    38    39    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    34    37    34    36    31    33    23    32
  5   1   2  SIG                                      Xt7.1-CAAN8553.5                                  CGGCGGACTGCCTCTCACACTTACCCCTCCGCGAACTAGAGGCCGAGTCTCATGGGAGCACCGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCANAGACCCCACCATTGCCTTCAGATGTGCCANAAGAGGCAAAAGATAACAAAAAGTCAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGACTGGACGTGTCTTCAGAGGCTGAAACCAAAGCCAAGCTTTCTTCTTCATCTCTTTCTAACTCTGCTGCATCTATTTCTGGTGGCCAGGATGGTGTGCCAACTTCTTTGCCTGATTTTCCTACTGCTTCCAATGCCCCATCTTCTCCTTTAGAACACTACCTAAGTTTACAATGTGACAACAAAGTTGAAACACCAGTAGAGTCATATACTGACTATGAGACACCTTCAGTGCCTTTGTTCTGGAGGTCAGGTTTGTCACAGAGTAAACAGCCTGAGCCTAGGGAGGTTCATGTTGTTGAACCGTTCAATGAAAAAACCAAAGAGAGAAAGACTTATGTCAAATCTCTTCTTGACCAGCTGACACGCAAGTCACCAACTAATAGTGTGGCTGATGCCGATACCGTTGATGTAGATTTGGTTAAGGGAGTTTTCCCTATACAAGATAGCTCTCCCTTTGATGACATTCCACATACAGATACAGATAGTCTTGAGAGTGAAAAAAGTGATGTGCAGTTAACTAAAACTTTAAAAGAAACTCCAAAACCAGCCCCCAGAACACAGTCTGCTCCTAAAAAACAAGAACCAAAGGATGAAATTAAACCAGTACCACCAAAACCAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACC
  5   1   2  SIG                                     Xt7.1-CABI12801.3                                                                                               CGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCAAAGACCCCACCATTGCCTTCAGATGTGCCAAAAGAGGCAAAAGATAACAAAAAGCAAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTTGCTATAAAGAAATACGACCCTACAGACCCTGCGGCCGCATACTCCCAGCTCACTCACGATGAGTTAATTCAGCTGGTCCTGAAGCAAAAAGACATCATCTCAAAGAAAGAAGTCCAAATGCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATGTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTTTATTCTGACATATTTATGCTGTACTGATTGCATCTCACACAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCACAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TGas091b12.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCGCATACTCCCAGCTCACTCACGATGAGTTAATTCAGCTGGTCCTGAAGCAAAAAGACATCATCTCAAAGAAAGAAGTCCAAATGCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATCTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTATATTCTGACATTTATGCTGTACTGATTGCATCTCACACAGCCAGCTCCTATTGAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCTTTTATTATTGAACTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTTATGTAATAATTTGAAGGAAAATTTAAGAATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCANGCAATGTTACACTACCTGTATGTGTTTTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATCAGAAATNTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATTGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCTGGGTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGTTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCGGGGATTATTTTGAATCAAAATAAAAACAATAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGCTCCTATTGAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------GA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------T-A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---A------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --T-A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----T--G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------T-----
                                               BLH ATG     149     431                                              
                                               BLH MIN     119     130                                              
                                               BLH MPR     119     130                                              
                                               BLH OVR     149     897                                              
                                               EST CLI     144       4                                              
                                               ORF LNG     149     274                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Sc ---- 7e-018     NP_012284.1 Required for invasion and pseudohyphae formation in response to nitrogenstarvation; Muc1p [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 2e-019     XP_800520.2 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 4e-021     NP_001021004.1 Dauer or Aging adult Overexpression family member (dao-5) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                 PROTEIN === Dm ==== 2e-030     NP_573313.2 CG6606-PA [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN --- ?? ---- 4e-075     NP_001090651.1 RAB11 family interacting protein 5 (class 1) [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                         PREDICTED = Dr ==== 4e-084     NP_001032306.1 hypothetical protein LOC553374 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                               PREDICTED - Gg ---- 2e-110     XP_001233961.1 PREDICTED: hypothetical protein [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 6e-127     NP_001002814.1 Rab coupling protein isoform 3 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                          PREDICTED - Mm ---- 4e-146     XP_134088.2 PREDICTED: Rab coupling protein isoform 1 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                           PROTEIN === Xl ==== 0          AAH94487.1 LOC432290 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 0          CAJ81459.1 novel protein similar to Rab11fip1 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CABI12801.3.5                                                                                                                                                            TAA------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------ATG------------ATG---------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------ATG---------TAA---------------------------TAA---------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------ATG------------------------TAA------------TAAATG------------------------------------------------------------------------------------------TGA---------------------------------------------TAA------------------------------------------TAGTAG------ATG---------------------------------TAA---------------------------------------------------------------ATG---------ATG------------------TGA---------TAA---------ATG------------------------------------------------------------TAA------------------------------------------------------------------------------TGA------------------------------TAA---TAA------------------ATG------------------------------------------------------------------------------TAA---------------------------------------------TGA------------------------------------------------------------------------------------------------ATG---------------TAA---------------ATG------------------------------------------------------------------------------TAA------TAG------------------TGA---------------------------------------------------------------------TAA---TAA---TGA------------TAA---------------------------------------ATG------------------TGA---------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------TAG---------------------TGA------------------------------------------------------------------------------------------------------ATG---------------------TGA---------------------------------------------------------------------------------------------------TAATAG------------------------TGA---------------------------TAG------------------------------------ATG---------------------------------------------------------------------------------------------------------TAA------TAA---------------------------TGA------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2  SIG                                      Xt7.1-CAAN8553.5                                  CGGCGGACTGCCTCTCACACTTACCCCTCCGCGAACTAGAGGCCGAGTCTCATGGGAGCACCGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCANAGACCCCACCATTGCCTTCAGATGTGCCANAAGAGGCAAAAGATAACAAAAAGTCAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGACTGGACGTGTCTTCAGAGGCTGAAACCAAAGCCAAGCTTTCTTCTTCATCTCTTTCTAACTCTGCTGCATCTATTTCTGGTGGCCAGGATGGTGTGCCAACTTCTTTGCCTGATTTTCCTACTGCTTCCAATGCCCCATCTTCTCCTTTAGAACACTACCTAAGTTTACAATGTGACAACAAAGTTGAAACACCAGTAGAGTCATATACTGACTATGAGACACCTTCAGTGCCTTTGTTCTGGAGGTCAGGTTTGTCACAGAGTAAACAGCCTGAGCCTAGGGAGGTTCATGTTGTTGAACCGTTCAATGAAAAAACCAAAGAGAGAAAGACTTATGTCAAATCTCTTCTTGACCAGCTGACACGCAAGTCACCAACTAATAGTGTGGCTGATGCCGATACCGTTGATGTAGATTTGGTTAAGGGAGTTTTCCCTATACAAGATAGCTCTCCCTTTGATGACATTCCACATACAGATACAGATAGTCTTGAGAGTGAAAAAAGTGATGTGCAGTTAACTAAAACTTTAAAAGAAACTCCAAAACCAGCCCCCAGAACACAGTCTGCTCCTAAAAAACAAGAACCAAAGGATGAAATTAAACCAGTACCACCAAAACCAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACC
                                                  Xt7.1-CHK-1008278406                                        ACTGCCTCTCACACTTACCCCTCCGCGAACGAGAGGCCGAGTCTCATGGGAGCACCGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCANAGACCCCACCATTGCCTTCAGATGTGCCANAAGAGGCAAAAGATAACAAAAAGTCAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGACTGGACGTGTCTTCAGAGGCTGAAACCAAAGCCAAGCTTTCTTCTTCATCTCTTTCTAACTCTGCTGCATCTATTTCTGGTGGCCAGGATGGTGTGCCAACTTCTTTGCCTGATTTTCCTACTGCTTCCAATGCCCCATCTTCTCCTTTAGAACACTACCTAAGTTTACAATGTGACAACAAAGTTGAAACACCAGTAGAGTCATATACTGACTATGAGACACCTTCAGTGCCTTTGTTCTGGAGGTCAGGTTTGTCACAGAGTAAACAGCCTGAGCCTAGGGAGGTTCATGTTGTTGAACCGTTCAATGAAAAAACCAAAGAGAGAAAGACTTATGTCAAATCTCTTCTTGACCAGCTGACACGCAAGTCACCAACTAATAGTGTGGCTGATGCCGATACCGTTGATGTAGATTTGGTTAAGGGAGTTTTCCCTATACAAGATAGCTCTCCCTTTGATGACATTCCACATACAGATACAGATAGTCTTGAGAGTGAAAAAAGTGATGTGCAGTTAACTAAAACTTTAAAAGAAACTCCAAAACCAGCCCCCAGAACACAGTCTGCTCCTAAAAAACAAGAACCAAAGGATGAAATTAAACCAGTACCACCAAAACCAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAG
  0   1   1           Egg  FLt3                   TEgg047a21.FL-Sanger                                                                                                                                                                                              CAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAAAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCAAAGACCCCACCATTGCCTTCAGATGTGCCAAAAGAGGCAAAAGATAACAAAAAGCAAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGACTGGACGTGTCTTCAGAGGCTGAAACCAAAGCCAAGCTTTCTTCTTCATCTCTTTCTAACTCTGCTGCATCTATTTCTGGTGGCCAGGATGGTGTGCCAACTTCTTTGCCTGATTTTCCTACTGCTTCCAATGCCCCATCTTCTCCTTTAGAACACTACCTAAGTTTACAATGTGACAACAAAGTTGAAACACCAGTAGAGTCATATACTGACTATGAGACACCTTCAGTGCCTTTGTTCTGGAGGTCAGGTTTGTCACAGAGTAAACAGCCTGAGCCTAGGGAGGTTCATGTTGTTGAACCGTTCAATGAAAAAACCAAAGAGAGAAAGACTTATGTCAAATCTCTTCTTGACCAGCTGACACGCAAGTCACCAACTAATAGTGTGGCTGATGCCGATACCGTTGATGTAGATTTGGTTAAGGGAGTTTTCCCTATACAAGATAGCTCTCCCTTTGATGACATTCCACATACAGATACAGATAGTCTTGAGAGTGAAAAAAGTGATGTGCAGTTAACTAAAACTTTAAAAGAAACTCCAAAACCAGCCCCCAGAACACAGTCTGCTCCTAAAAAACAAGAACCAAAGGATGAAATTAAACCAGTACCACCAAAACCAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCTGCGGCC
  5   1   4      seed Te4       in                        CAAN11317.5p TGGAGCAAAAAGTTCCTAAGCAACGTTGGTAGGCGGCGGACTGCCTCTCACACTTACCCCTCCGCGAACTAGAGGCCGAGTCTCATGGGAGCACCGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAAAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCA
  5   1   3        nb Te4       in                         CAAN8553.5p                                  CGGCGGACTGCCTCTCACACTTACCCCTCCGCGAACGAGAGGCGGAGTCTCATGGGAGCACCGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGGAT
  5   1   3        nb Te4       in                         CAAN8249.5p                                                 CACACTTACCCCTCCGCGAACGAGAGGCCGAGTCTCATGGGAGCACCGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCA
  5   1   3        nb Egg  FLt3 in                   TEgg047a21.p1kSP6                                                                                                                                                                                               AAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGGAAAAAA
  5   1   2       ext Fat1      in                         CABC1754.5p                                                                                                                                                                                                               CAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAAACTTTCCACCATNCTCATCTCCAAAGACTGTGCT
  5   1   2       ext Gas7      in                         XZG26251.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCCAATGGTACCCACTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAAAGACAAGATTAAGGGGAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCCATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGT
  5   1   2       ext Te5       in                         CAAO6276.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGGACAAGAATTAAGGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCANAGACCCCACCATTGCCTTCAGATGTGCCANAAGAGGCAAAAGATAACAAAAAGTCAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTG
  5   1   2       add Tbd0                               IMAGE:6979109                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAAGAACAAACACCAGCTGCCTCAAATGATTTTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATTAGAGGAACCTAGATCAAAGACCCCACCATTGCCTTCAGATGTGCCAAAAGAGGCAAAAGATAACAAAAAGCAAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGACTGGACGTGTCTTCAGAGGCTGAAACCAAAGCCAAGCTTTCTTCTTCATCTCTTTCTAACTCTGCTGCATCTATTTCTGGTGGCCAGGATGGTGTGCCAACTTCTTTGCCTGATTTTCCTACTGCTTCCAATGCCCCATCTTCTCCTTTAGAACACTACCTAAGTTTACAATGTGACAACAAAGTTGAAACACCAGTAGAGTCATATACTGACTATGAGACACCTTCAGTGCCTTTGTTCTGGAGGTCAGGTTTGTCACAGAGTAAACAGCCTGAGCCTAGGGAGGTTCATGTTTGTGAACCGTNNTCATGAAANAACCCAAGAGAGAAAGACTTATGTNCAATCTCTTCTTGACCAGCTGACACGCAAGTCACCAACTATAGTGTGGCTGATGCGAN
  3   1   2       ext Te5       in                         CAAO6276.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGACTGGACGTGTCTTCAGAGGCTGAAACCAAAGCCAAGCTTTCTTCTTCATCTCTTTCTAACTCTGCTGCATCTATTTCTGGTGGCCAGGATGGTGTGCCAACTTCTTTGCCTGATTTTCCTACTGCTTCCAATGCCCCATCTTCTCCTTTAGAACACTACCTAAGTTTACAATGTGACAACAAAGTTGAAACACCAGTAGAGTCATATACTGACTATGAGACACCTTCAGTGCCTTTGTTCTGGAGGTCAGGTTTGTCACAGAGTAAACAGCCTGAGCCTAGGGAGGTTCATGTTGTTGAACCGTTCAATGAAAAAACCAAAGAGAGAAAGACTTATGTCAAATCTCTTCTTGACCAGCTGACACGCAAGTCACCAACTAATAGTGTGGCTGATGCCGATACCGTTGATGTAGATTTGGTTAAGGGAGTTTTCCCTATACAAGATAGCTCTCCCTTTGATGACATTCCACATACAGATACAGATAGTCTTGAGAGTGAAAAAAGTGATGTGCAGTTAACTAAAACTTTAAAAGAAACTCCAAAACCAGCCCCCAGAACACAGTCTGCTCCT
  5   1   2       ext Gas7      in                         XZG21891.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCCGCTGTAAAACCCAGACTGGACGTGTCTTCAGAGGCTGAAACCAAAGCCAAGCTTTCTTCTTCATCTCTTTCTAACTCTGCTGCATCTATTTCTGGTGGCCAGGATGGTGTGCCAACTTCTTTGCCTGATTTTCCTACTGCTTCCAATGCCCCATCTTCTCCTTTAGAACACTACCTAAGTTTACAATGTGACAACAAAGTTGAAACACCAGTAGAGTCATATACTGACTATGAGACACCTTCAGTGCCTTTGTTCTGGAGGTCAGGTTTGTCACAGAGTAAACAGCCTGAGCCTAGGGAGGTTCATGTTGTTGAACCGTTCAATGAAAAAACCAAAGAGAGAAAGACTTATGTCAAATCTCTTCTTGACCAGCTGACACGCAAGTCACCAACTAATAGTGTGGCTGATGCCGATACCGTTGATGTAGATTTGGTTAAGGGAGTTTTCCCTATACAAGATAGCTCTCCCTTTGATGACATTCCACATACAGATACAGATAGTCTTGAGAGTGAAAAAAGTGATGTGCAGTTAACTAAAACTTTAAAAGAAACTCCAAAACCAGCCCCCAGAACACAGTCTGCTCCTAAAAA
  5   1   2       ext Gas       in                  TGas092c10.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTCTAACTCTGCTGCATCTATTTCTGGTGGCCAGGATGGTGTGCCAACTTCTTTGCCTGATTTTCCTACTGCTTCCAATGCCCCATCTTCTCCTTTAGAACACTACCTAAGTTTACAATGTGACAACAAAGTTGAAACACCAGTAGAGTCATATACTGACTATGAGACACCTTCAGTGCCTTTGTTCTGGAGGTCAGGTTTGTCACAGAGTAAACAGCCTGAGCCTAGGGAGGTTCATGTTGTTGAACCGTTCAATGAAAAAACCAAAGAGAGAAAGACTTACGTCAAATCTCTTCTTGACCAGCTGACACGCAAGTCACCAACTAATAGTGTGGCTGATGCCGATACCGTTGATGTAGATTTGGTTAAGGGAGTTTTCCCTATACAAGATAGCTCTCCCTTTGATGACATTCCACATACAGATACAGATAGTCTTGAGAGTGAAAAAAGTGATGTGCAGTTAACTAAACTTTAAAAGAAACTCCAAAACCAGCCCCCAGAACACAGTCTGCTCCTAAAAAACAAGAACCCAAGGATGAAATT
  5   1   3        nb Egg                            TEgg144n24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGCTTTAGAACACTACCTAAGTTTACAATGTGACAACAAAGTTGAAACACCAGTAGAGTCATATACTGACTATGAGACACCTTCAGTGCCTTTGTTCTGGAGGTCAGGTTTGTCACAGAGTAAACAGCCTGAGCCTAGGGAGGTTCATGTTGTTGAACCGTTCAATGAAAAAACCAAAGAGAGAAAGACTTATGTCAAATCTCTTCTTGACCAGCTGACACGCAAGTCACCAACTAATAGTGTGGCTGATGCCGATACCGTTGATGTAGATTTGGTTAAGGGAGTTTTCCCTATACAAGATAGCTCTCCCTTTGATGACATTCCACATACAGATACAGATAGTCTTGAGAGTGAAAAAAGTGATGTGCAGTTAACTAAAACTTTAAAAGAAACTCCAAAACCAGCCCCCAGAACACAGTCTGCTCCTAAAAAACAAGAACCAAAGGATGAAATTAAACCAGTACCACCAAAACCAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAA
  3   1   2       ext Fat1      in                         CABC1754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGAGAAAGACTTATGTCAAATCTCTTCTTGACCAGCTGACACGCAAGTCACCAACTAATAGTGTGGCTGATGCCGATACCGTTGATGTAGATTTGGTTAAGGGAGTTTTCCCTATACAAGATAGCTCTCCCTTTGATGACATTCCACATACAGATACAGATAGTCTTGAGAGTGAAAAAAGTGATGTGCAGTTAACTAAAACTTTAAAAGAAACTCCAAAACCAGCCCCCAGAACACAGTCTGCTCCTAAAAAACAAGAACCAAAGGATGAAATTAAACCAGTACCACCAAAACCAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGC
  5   1   2       ext Tad5      in                         XZT46797.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTGATGACATTCCACATACAGATACAGATAGTCTTGAGAGTGAAAAAAGTGATGTGCAGTTAACTAAAACTTTAAAAGAAACTCCAAAACCAGCCCCCAGAACACAGTCTGCTCCTAAAAAACAAGAACCAAAGGATGAAATTAAACCAGTACCACCAAAACCAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAANAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGC
  5   1   3        nb Te4       in                         CAAN7907.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGTCTGCTCCTAAAAAACAAGAACCAAAGGATGAAATTAAACCAGTACCACCAAAACCAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCT
  3   1   2       ext Gas       in                    TGas092c10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAAAAACAAGAACCAAAGGATGAAATTAAACCAGTACCACCAAAACCAGCCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAACCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACC
  3   1   2       ext Tad5      in                         XZT46797.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAACCAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCT
  5   1   2       add Lun1      in                        CABD13147.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAACCAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGA
  3   1   3        nb Egg  FLt3 in                    TEgg047a21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCACCTAGAAGTGCTACTAAAGTAAATAAAGCTGCTGATGACTCTGCGCCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACA
  3   1   4      seed Te4       in                        CAAN11317.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTGCAAGCTCTACTCCACCAGAAAAGGCACTGGATACATATTCCAACCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCTGCGGCCGCTCTAGAGATC
  3   1   2       ext Gas7      in                         XZG26251.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTCCACCAGAAAAGGCACTGGATACATATTCCACCCAGGAGCTACAACAGGCTTCTAATGTTGGTTCTTCACTGAACAGTGCCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCT
  3   1   3        nb Te4       in                         CAAN8553.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCT
  3   1   2       ext Gas7      in                         XZG21891.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTTGGTTCTTCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGAAAAAAAAAAAAAAAGG
  3   1   3        nb Te4       in                         CAAN8249.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCACTGAACAGTGGCCAGGCAATAACTGAGGTAAAGATGGCAACTCCAAAGATCAGCGAATACAGTTTAAGGCTAGATGAACTTCCAGTGATTCCAGAGAATCCAGAAGGAACCTCAGATGATGAGCAGCTTGAAACCAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCT
  3   1   3        nb Te4       in                         CAAN7907.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAGATGACATCTTTTCCAGTCATTCGTCCAACAAATCATCAAGTGCTGCAGCTACCAGAGAAACAAATCCACATCTCAGTGTGCAGAAAAACAGTCTTCCAAAAACAAATGATGAGGTTGATTTTGCTTTGGAGCAAAAGAATGAAAAAAATAGAAATCCTGAATGTGTGGATAAGATAAATGCATCTGACGCAATTAAAATTAGCACTGTCAGCTTGGAAAGCCAGGGTAGTGATAAAGCAAACCACTACACACCTATTAACTCTTCTCTTGGCTATTCTTCTCCCACACCTGCTTCCCTTCCAACTGATAAATGTACCACTCCTAGTGCCGACCCCCCGACAAAGCCAGCCATTGAGGGTACTGATAAAGTGGATAGCTCTGGCAAAAAGAAGCTTCTCCGGGCATGGGTTTCACCCTCTGAGACACATCCAATCCCTACAGTGCAGAGTGGTGGAACAGTGTCTTCCAGGATAAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCT
  5   1   2  SIG                                     Xt7.1-CABI12801.3                                                                                               CGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCAAAGACCCCACCATTGCCTTCAGATGTGCCAAAAGAGGCAAAAGATAACAAAAAGCAAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTTGCTATAAAGAAATACGACCCTACAGACCCTGCGGCCGCATACTCCCAGCTCACTCACGATGAGTTAATTCAGCTGGTCCTGAAGCAAAAAGACATCATCTCAAAGAAAGAAGTCCAAATGCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATGTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTTTATTCTGACATATTTATGCTGTACTGATTGCATCTCACACAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCACAAAAAAAAA
                                                  Xt7.1-CHK-1008278410                                                                                                     CGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCAAAGACCCCACCATTGCCTTCAGATGTGCCAAAAGAGGCAAAAGATAACAAAAAGCAAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATAAAGAAATACGACCCTACAGACCCTGCGGCCGCATACTCCCAGCTCACTCACGATGAGTTAATTCAGCTGGTCCTGAAGCAAAAAGACATCATCTCAAAGAAAGAAGTCCAAATGCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATGTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTTTATTCTGACATATTTATGCTGTACTGATTGCATCTCACACAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCACAAAAAAAAAAAAAAA
  0   1   1           Tad5 FLsh                        XZT43544.FL-MGC                                                                                               CGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCAAAGACCCCACCATTGCCTTCAGATGTGCCAAAAGAGGCAAAAGATAACAAAAAGCAAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCTGCGGCCGCATACTCCCAGCTCACTCACGATGAGTTAATTCAGCTGGTCCTGAAGCAAAAAGACATCATCTCAAAGAAAGAAGTCCAAATGCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATGTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATTGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTTTATTCTGACATATTTATGCTGTACTGATTGCATCTCACACAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGCTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAATATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCACAATGAAAAAAAAAAAAAAAAAAAAA
  5   1   1           Egg  FLt3                   TEgg084h08.FL-Sanger                                                                                                                                                                      CAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAAAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCAAAGACCCCACCATTGCCTTCAGATGTGCCAAAAGAGGCAAAAGATAACAAAAAGCAAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCT
  5   1   2       ext Te1       in                        CBWN16917.b1                                         CTGCCTCTCACACTTACCCCTCCGCGAACGAGAGGCCGAGTCTCATGGGAGCACCGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAAAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCA
  5   1   2       ext Tad5 FLsh in                         XZT43544.5p                                                                                               CGCCTACGTATTCACTAGTTTATATTTCGTCGGTACCGCCCCATTTCCTCATATAGTGAAGTAAAGTACGGCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCA
  5   1   3        nb Gas  5g                        TGas001p08.p1kSP6                                                                                                                                                                  TACTGCAGGTGAAGGCAGCGCACCGCCGGCAAAGAGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTA
  5   1   3        nb Egg  FLt3                      TEgg084h08.p1kSP6                                                                                                                                                                     GCAGGTGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAAAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAA
  3   1   3        nb HeRe                             EC2CAA14AG03.b1                                                                                                                                                                         GGGAAGGCAGCGCACCGCCGGCAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGATGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGCTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATG
  5   1   2       ext Lun1      in                         CABD9734.5p                                                                                                                                                                                              CAAAGATGTCTCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAAAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGANAGACGATTTCCTCATCTTCCTGTGATCATGACTCA
  5   1   3        nb Egg                            TEgg091a17.p1kSP6                                                                                                                                                                                                        TCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGC
  3  -1   3        nb Hrt1      in                        CAAQ11519.3p                                                                                                                                                                                                        TCTAGCTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTC
  3  -1   3        nb Ovi1      in                        CABI11768.3p                                                                                                                                                                                                             CTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCACTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAAAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATA
  5   1   2       ext Spl1      in                         CABK6081.5p                                                                                                                                                                                                             CTCAGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGA
  5   1   3        nb Egg                            TEgg115m05.p1kSP6                                                                                                                                                                                                                AGCAGTCCCAGACCTGGTTCCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGA
  5   1   3        nb Int1      in                         CAAP2420.5p                                                                                                                                                                                                                                   CCCTACTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAA
  5   1   4      seed Ovi1      in                        CABI12801.5p                                                                                                                                                                                                                                        CTCACGTCCAGGTAACCGTATTACAGGCTAAAGGCTTGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAGGGATGTCATTGTTTAGTGGAATGAAAGC
  5   1   3        nb Int1      in                         CAAP9645.5p                                                                                                                                                                                                                                                                            TGAAGCCCAAAGGCAAAGCGGGCAGCAACGATGCGTACGCCATCATCCAGCTGGGCAAAGAGAAGTACTCCACCACTGTGGCCGAGAAGAGCCAGGCTCCCGTGTGGAAGGAGGAGGCCACCTTCGAAGTGCCCCTGTTACACAATGATAACCAGGAGCGCTGCACCGTGAGAGTTATAGTTATGCACCGAGCCCTGGTGGGGATGGACAAGTTCCTGGGGCAGTTGGAGCTCAACCTGTGGGAGTTGCACCAGAGCAGGAACAGGAGGAAAGTCCAATGGTACCCATTGAGGTCAAAGCCTGGGAAAAAAGAGAAGGAACGTGGTCAGATAGAGGTGGAAGTCCAGTTCATGAGAAATAATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAGAGACAAGATTAAGGGAAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCTATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACANAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGT
  5   1   3        nb Egg                            TEgg120o09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAAGTCCAGTTCATGAGAAATATATGACGGCTAGCATGTTTGACCTCTCAATGAAGGAGAAATCCCGCTCAACTCTAGGAAAATTAAAAGACAAGATTAAGGGGAAAAAACATGAAGGTTTTCCAGATACTGCATCAGCCATTGTTCCCAGCATGAATCAGTATGACAGTGATGAGGATATGCCAGCAGCAGAAAAAAAGAAATCTAAACTGAAGAACCTGTTTTCAAAGCCAGGATTAAAGAAGAACTCCATTTCTCAGTCCATGTCTGTCCTCCCAACTTTTCCACCATCTTCATCTCCAAAGACTGTGCTAAGGCCTGCTGAGTTTTCATCAGATTTCACTCCTCCAACAGGGTCTCCAGCATCTGAAAGACGATTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTG
  5   1   2       ext Int1      in                        CAAP14439.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTCCTCATCTTCCTGTGATCATGACTCACAAAAGAACAGTTAGTGCTGATACCAGCCAGCTGTCCAGTAATAAGAAGGAAGGATTGTCATTGTTTAGTGGAATGAAGCCAAAGAATGATCCCATCACCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCAAAGACCCCACCATTGCCTTCAGATGTGCCAAAAGAGGCAAAAGATAACAAAAAGCAAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACA
  3   1   2       ext Te1       in                        CBWN16917.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTGGAATGAAGCCAAAGAATGATCCCATCACCCAGATCCAATCTATGCATCAATGGGAATCACGTATACATGGAAGAATCTGAAACAAGAAGTGAGAGTCCCAAAGACAGCTCCCAAACAAACTCCCCACAGATCGTCCGCAAAAATCCACTTTATGCATCTGCTGAAAACCTGTCTTCCAAAACACCTAAAGAAGCAAAAAACAGCCTTTTTCCAGAGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCAAAGACCCCACCATTGCCTTCAGATGTGCCAAAAGAGGCAAAAGATAACAAAAAGCAAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGTATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCT
  5   1   3        nb Tad5                                 XZT61574.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACGCGNNTCCGGAAAGAACAAACACCAGCTGCCTCAAATGATTCTCTTAAATCCTCAACAGTGTCTGCTTCTCAAAATTCCAAATCAGAGGAACCTAGATCAAAGACCCCACCATTGCCTTCAGATGTGCCAAAAGAGGCAAAAGATAACAAAAAGCAAGAGAATAAGAAGTCATCTCTTCTTTCCTTGGTGACTGGCAAAAAAGACACTCCTAAAGTCCCTGAGAATGAGTCTTCTGTTGCGCCCTTAAAAGGGGATATGTCAAAAGCTACTGGCGATAACAAAAAAATAGAACAGTCCTCAATTAATGTCACCAAAAAGACTTCATTGAATCCCTTTGAAGATGACATGGAAGAAGAAAAGAAGCCAGAACCACTTCCCACCTCAGCAAAGACCTCAGCTGTAAAACCCAGGACAAATCCGGTAAAGCCCATGAGTGCAACACAAACCAAAACTGTTTCTGGGTTCTCTCAGCCAATCAAAAGCCACGATGTTGCTATAAAGAAATACGACCCTACAGACCCT
  5   1   0       chi Ovi1      in                         CABI1557.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGATGTTGCTATAAAGAAATACGACCCTACAGACCCTGCGGCCGCATACTCCCAGCTCACTCACGATGAGTTAATTCAGCTGGTCCTGAAGCAAAAAGACATCATCTCAAAGAAAGAAGTCCAAATGCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATGTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTTTATTCTGACATATTTATGCTGTACTGATTGCATCTCACACAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAAATCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGATTAATGTTTC
  3  -1   2       ext Egg  5g   out                   TEgg042b23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATGTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTTTATTCTGACATATTTATGCTGTACTGATTGCATCTCACACAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATG
  5   1   2       ext TpA       in                   TTpA030k22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAGTGAGCATTGTGGTGGGACAAACCAAGACTCAGTCATGTTTTGGGAAGAGCTTATGTGTTTGGGCGTATATGGATGCCTGATTGCTTTCATATGAAGTACAGTAAGCAAACATGTATTTTTATTCTGACGTATTTATGCTGTACTGATTGCATCATCACACAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATATTGTTAAATAAACATATACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTGATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTACTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAGTATATCTTC
  5   1   2       ext Sto1      in                         CABG7709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTGGGACAAACCTTGCTCAGTCATGTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATTGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTTTATTCTGACATATTTATGCTGTACTGATTGCATCTCACACAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGCTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCTTTTTAAGGTTAATGCAGACTTCCAGACTATATGC
  5   1   3        nb Gas                            TGas085d20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACAGTAAGCAAACATGTTTTTTATTCTGACATATTTATGCTGTACTGATTGCATCTCACACAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGCTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGC
  5   1   3        nb Spl2      in                        CBSS5517.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGTAAGCAAACATCTTTTTTATTCTGACATATTTATGCTGTACTGATTGCATCTCACACATCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGCACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGCTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACAT
  5   1   2       ext Te1       in                        CBWN17283.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGCAAACATGTTTTTTATTCTGACATATTTATGCTGTACTGATTGCATCTCACACAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTTATCCTTTTTAAGGTTAATGCAGACTTTCCAGACTAT
  3  -1   3        nb Lun1                                CABD12188.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCATCTCACACAGCCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTC
  5   1   3        nb Lun1      in                         CABD2665.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCATTGCAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGGTACTGACT
  5   1   2       ext Ski1      in                         CABJ2310.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGCTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGTGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTG
  5   1   2       ext Fat1      in                         CABC9368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGAGGCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCATTTATTATTGAATTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTT
  5   1   3        nb Ova1      in                        CABE12650.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGAGGCCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTATGTAATAATTTGAAGGAAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACC
  5   1   3        nb Sto1      in                         CABG2537.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAATTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAG
  5   1   3        nb Sto1      in                         CABG1990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTAAATATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCAGGCAATGTTACACTACCTGTATGTGTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGAT
  5   1   2       ext Ovi1      in                        CABI13178.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTTCTGCCATTTTTTTTTTCAGTGTATTCATAATTGAGGTGGCTTTTCAAATGACCTTTTATCCTTTTAAGGTTAATGCAGACTTCCAGACTATATGCAAAAGAGATGTCAGTTGTATGTAAAATGTATCTCCTTCCACTTGTGCACTACAAATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCANATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTA
  5   1   3        nb Hrt1      in                         CAAQ7637.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCCTAGCATCATAAGCGCATCATAAGCTATAGCCCCTCTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTG
  5   1   2       ext Sto1      in                         CABG4422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTGTTAGATTTGAGTTATCCCCGCTGAATTGTTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGNGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATA
  5   1   2       ext Egg       in                   TEgg073d06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTGTAATCTGTTGGGAAAGATCTGAAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAAC
  5   1   3        nb Ova1      in                         CABE9917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGGCTCCACTCTCAGAATAACATGAGCAGGTTTGGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTT
  5   1   3        nb Te1       out                        CBWN8772.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTGCATAACCCAGACAATGTTGTATGTATAGAAATGTGTGTAAAATATTTATATTTTTGTGCCTTGTATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCA
  3   1   2       ext Fat1      in                         CABC9368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAGAAACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  3   1   4      seed Ovi1      in                        CABI12801.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACTTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTAAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  3   1   3        nb Int1      in                         CAAP2420.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTNTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTG
  3   1   2       ext Lun1      in                         CABD9734.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAA
  3   1   2       ext Egg       in                    TEgg073d06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATGCTTTGTACAAAAAAGAAATATATATTTAATTTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCACAAAAAAAAAAAAAAAAAAGCGGCGAGAA
  3   1   2       ext Ovi1      in                        CABI13178.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTTTGTACAAAAAAGAAATATATATTTTATTAATCATTTAAATATATATATATTTATATGTACTAAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  3   1   2       ext Sto1      in                         CABG4422.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTAAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  3   1   2       ext Ski1      in                         CABJ2310.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAAGAAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  3   1   2       ext Spl1      in                         CABK6081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTC
  5  -1   3        nb Ovi1      in                        CABI11768.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGAAATATATATTTTATTAATCATTTAAATATATATATATTTATAGGTACTAAAACATAATTTTGAAATGAACAAAAATAATTGACCATAAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTNTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAAT
  3   1   2       add Ovi1      in                         CABI1557.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGAAATATATATTTAAATTAATCATTTAAATATATATATATTTATATGTACTAAAACATAATTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCACAAAAAAA
  3   1   2       ext Int1      in                        CAAP14439.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTAATCATTTAAATATATATATATTTATATGTACTAAAACATATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAGCCTCTCGCCCTATAGGA
  3   1   3        nb Sto1      in                         CABG2537.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGTCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACCAATATGTATTCAC
  3   1   3        nb Ova1      in                         CABE9917.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATATATATTTATATGTACTTAAACATATTTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACCAATATGTATTCAC
  3   1   2       add Lun1      in                        CABD13147.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  3   1   3        nb Sto1      in                         CABG1990.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATTTATAGACCTTAAACATATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  3   1   3        nb Hrt1      in                         CAAQ7637.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACCAATATGTATTCAC
  3   1   3        nb Int1      in                         CAAP9645.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGTTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  3   1   3        nb Ova1      in                        CABE12650.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  3   1   2       ext Sto1      in                         CABG7709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  3   1   2       ext Te1       in                        CBWN17283.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCACAAAAAAAAAAAAAAA
  3   1   2       ext Tad5 FLsh in                         XZT43544.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAATATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCACAAT
  5  -1   3        nb Hrt1      in                        CAAQ11519.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  3   1   3        nb Spl2      in                        CBSS5517.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTC
  3   1   3        nb Lun1      in                         CABD2665.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGATTCACAAATGATTCAAGTCAGTATATTTATATCGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  5   1   3        nb Tad5                                 XZT71804.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCACAAAANAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Limb      in                        CBSU9716.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCACAATG
  3   1   3        nb Limb      in                        CBSU9716.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATCCTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCACAATG
  5   1   3        nb Bone      in                        CBTC4995.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACGGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTAGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  3   1   3        nb Bone      in                        CBTC4995.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACGGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTAGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGTATTCAC
  5  -1   2       ext Egg                            TEgg102o17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTGGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATACTCTAGATTATTTGGAATCTGGAAAATAAAACCAATAGTACTCACAAAAAAAAAAAAAAAAACGGCCGCGTCGACACTAGTTCTC
  3   1   2       ext TpA       in                    TTpA030k22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATGGCATGGGGATCACACCTATTTTTGCCATGACAAAGATCCATAGAGGCGGCACACAGACTTGACACATCTGTCCTGTCGCACCATTCCCTCCCATTGGGAATTAACATTTACCCATCCCGGAACTTTATATAATAGGATAGTTGGCATCATATGATTGCACTGAAAATTGTCCTACCAGGCCGAGGATATTTAGACATATGAGCCACCCCGGCAGGGATCGGCTTTAGTCAGGTTCATTATGGTTCAGTG
  3   1   3        nb Fat1                                CABC11345.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGCCCAATTAACATTTACCCATCCCCTGTGCCTTATATAATAGCTTAGTGGGCATCATATTNTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAACCCAATATGTATTC
  3   1   3        nb Egg       in                    TEgg045l15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATAGTAAAAAAAAAAAAAAA
  5   1   3        nb Egg       in                   TEgg045l15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCCGGCTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGCTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGGAAAATAAAAACAATATGT
  5   1   2  SIG                                    Xt7.1-TGas091b12.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCGCATACTCCCAGCTCACTCACGATGAGTTAATTCAGCTGGTCCTGAAGCAAAAAGACATCATCTCAAAGAAAGAAGTCCAAATGCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATCTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTATATTCTGACATTTATGCTGTACTGATTGCATCTCACACAGCCAGCTCCTATTGAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCTTTTATTATTGAACTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTTATGTAATAATTTGAAGGAAAATTTAAGAATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCANGCAATGTTACACTACCTGTATGTGTTTTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATCAGAAATNTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATTGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCTGGGTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGTTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCGGGGATTATTTTGAATCAAAATAAAAACAATAAAAAAAAAA
                                                  Xt7.1-CHK-1008278402                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACTCCCAGCTCACTCACGATGAGTTAATTCAGCTGGTCCTGAAGCAAAAAGACATCATCTCAAAGAAAGAAGTCCAAATGCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATCTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTATATTCTGACATTTATGCTGTACTGATTGCATCTCACACAGCCAGCTCCTATTGAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCTTTTATTATTGAACTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTTATGTAATAATTTGAAGGAAAATTTAAGAATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCANGCAATGTTACACTACCTGTATGTGTTTTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATCAGAAATNTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATTGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCTGGGTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGTTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCGxGxxTxxTTxTGAATCxxxAxAAAAACAATAAAAAAAAAAAAAAAA
  5  -1   2       ext Egg       in                   TEgg043h05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCGCATACTCCCAGCTCACTCACGATGAGTTAATTCAGCTGGTCCTGAAGCAAAAAGACATCATCTCAAAGAAAGAAGTCCAAATGCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATCTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTATATTCTGACATTTATGCTGTACTGATTGCATCTCACACAGCCAGCTCCTATTGAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAGAAAAAAAAAAAAAAAAGC
  3  -1   2       ext Egg       in                    TEgg043h05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGAGTTAATTCAGCTGGTCCTGAAGCAAAAAGACATCATCTCAAAGAAAGAAGTCCAAATGCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACAGTCTATAAACAAGAAGATGGGCAAGTGGTAAATTTGTGCAGATGGACACATTTTCTCCTAATGTAGGTCAGTGAGCATTGTGGTGGGACAAACCTTGCTCAGTCATCTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTATATTCTGACATTTATGCTGTACTGATTGCATCTCACACAGCCAGCTCCTATTGAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCT
  3  -1   3        nb Egg                             TEgg005g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGGGAACTGGAGGATTATATTGACAACCTGCTGGTGCGGATTATGGAGGAGACGCCCAGTTTACTACACTCTATAAACCACAAGATGGGCTAGTGGGAAATTTGTGCATATGGACACATTTTCTCCTAATGTAAGTCAGTGAGCATTGTGGCGGGACAAACCTTGCTCAATCATCTTTTGGGAAGAGCTTTTGTGTTTGGGCTATATGGATGCCTGATTGCTTTAATATGAAGTACAGTAAGCAAACATGTTTTATATTCTGACATGAATGCTGTACTGATTGCATCTCACGCTCCCAGCTCCAAATGAAATGTTGTCATGCAATGAATGCTCTGGAACCCTATGGAT
  5   1   2       ext Gas                            TGas025c13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCAAACATGTTTTATATTCTGACATTTATGCTGTACTGATTGCATCTCACACAGCCAGCTCCTATTGAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCTTTTATTATTGAACTAATGTTTCCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTTATGTAATAATTTGAAGGAAAATTTAAGAATCACTGATGTCAGATTCTCCCTGTATAGACTCCCATAGGCAGGCCTTTGCTGGTAATACTGCTCCGTGCTAAAGGCTGGGAAAGACATCANGCAATGTTACACTACCTGTATGTGTTTTCTGGCCCCAAACATGGCATTTCCTTATACATTGAAATTGTAACTGTGTATCTG
  5   1   4      seed Gas       in                  TGas091b12.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAAACATGTTTTATATTCTGACATTTATGCTGTACTGATTGCATCTCACACAGCCAGCTCCTATTGAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAGCCCAGGCTAAAAAAAATAAATTAAATGCCAAATGCTCTTATTTACTGTCAACCAGGGAGAGGCAAATGTAAATCTGTGGGCTCTTACTGCTTTATTTTGGCTTTGAGCCCTTGGTTCTGACAGCTAATTTCCTGGGTTACTGACTCAGGTAATGCAAGGAAATTCTAACGATACTTTATATCATGGCTAGACCAGTCCACTTGGTGCCTGTAGTAGCCAAGGATGCCCAGCCTGCTAGCCCACCTTTTATTATTGAACTAATGTTTTCACCACCCCAACAAAGTAGTTTTATGTTTGGACAAATATATCTTCCAGGGTCCACATATGGCCACATATATGGTTTTTTTATGTAATAATTTGAAGG
  5   1   2       ext Gas       in                   TGas091b15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAAACATGTTTTATATTCTGACATTTATGCTGTACTGATTGCATCTCACACAGCCAGCTCCTATTGAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGG
  5   1   3        nb Gas       in                   TGas091b16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAAACATGTTTTATATTCTGACATTTATGCTGTACTGATTGCATCTCACACAGCCAGCTCCTATTGAAATGTTGTCATGCAATGAAGGCTCTGGAACCCTATGGATAGTGTTAAATAAACATAGACCTAAAAATGCCTATATGTGCTGCCTCTTGTCCATGGGCCTCCAGTTACACAG
  3   1   4      seed Gas       in                    TGas091b12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATACTGTAAATTGTATTTCTCACTTGTATCAGTTATATAACTGGATCAGAAATNTTCTGCTCTTTTCTGAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATTGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCTGGGTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGTTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCTAGATTATTTTGAATCTGAAAATAAAACAATAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas       in                    TGas091b15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATTGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCTGGGTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGTTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCGGGGATTATTTTGAATCTGGAAAATAAAAACAATAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas       in                    TGas091b16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAATGCTTTGTACAAAAAAGAAATATATATTTTAATTAATCATTTAAATATATATATTTATATGTACTTAAACATAATTTTGAAATGAACAAAAATAATTGACCATTAAAGCACTGCAGAGTGTACGTAAATCAGGTATGAATGACACACAGACAATCTGACACGTGATTTTATTAAATCTCTTAGATTCACAAATGATTCAAGTCAGTATATTTATATTGCATTTAGATAAGATTCCTTTACATATATCGCCCTCACATAGAACCCCAGGCCTATTTAACATTATGCCTCAAATAAGTGTCTCTCTGGGTTGCTTTACAGGAGACTGTAGCCTAGAATAGGCCTTGATACAGGATAGAGAATGAGTTAACTGTCTCTTCTGCAGTGGCATAGAACTATGTAATATATACTTCTATAACATAGGATGGTTGGCTAGTAAAAGAACTGCTCCCTGTAAGCTGCATGGCATGGGGATCACAACTATTTTTCCATGACAAAGATCCATAGATGCAGCACACAGACTTGACACATCTCTCCTGTCGCACCCTTCCCTCCCATTGCCAATTAACATTTACCCATCCCTGTGCCTTATATAATAGCTTAGTTGGCATCATATTTTGCACTGAAAATTCTCCTACCAGGCAGAGGATATTTAGACATGTGAGCCACCCTGGGTGGTATCGGCTTTATTCATGTTCATTTTGGTTCAGTGGTGGCTTTGTTACTTTAATAAATCTTCAGAGGGCTTAGTGCTAGTTACACTGGCTCCTAGACCATCTCGCAGCACTTTATCATTAAGTTAAATATTCTAAATACACTGGATTTTTTTAAAGTTGGTCTGAAATATTTATAATCGAGATTATTTGAATCTGAAAATAAAAACAATAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)