Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-IMAGE:7004046.5                       3 END     2           1       66                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 231.0    0Xt7.1-XZG48009.5                            9 PI      95        727      866                Hypothetical protein MGC76136 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012153497 Xt7.1-TEgg057g09.3.5 - 108 ESTs
                                                                       .-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TEgg057g09.3.5                                                    GGACGCAGGCTGGGCAGCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTAAACAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008264876                                                          CxGxxxGGCAGCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGxxxxxGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTxAAxxAAAAAAAAAAAAAAAAAAAAAGCG
                                                      consensus depths                                                         5     9     6    11     6    11     8    16     8    18    10    19    12    21    12    26    28    30    26    32    34    36    33    37    33    37    37    41    39    41    40    42    37    41    40    42    40    42    38    42    39    43    36    43    41    45    40    45    41    46    41    45    40    45    37    45    38    45    40    45    37    45    38    45    39    46    38    48    40    49    43    49    41    49    40    48    38    48    41    48    41    48    40    48    41    49    42    52    42    52    42    52    41    52    39    51    37    51    38    50    38    51    37    49    38    50    37    48    39    50    39    50    38    49    40    51    41    54    40    52    41    53    41    54    43    54    46    57    43    54    48    58    46    58    46    58    47    58    46    59    47    60    44    60    47    61    47    59    49    60    49    60    47    59    45    57    42    57    49    56    48    56    46    55    48    53    48    53    48    53    47    53    47    53    46    51    44    51    45    50    46    50    44    50    45    47    45    47    43    49    46    49    47    48    47    49    48    49    46    49    49    50    51    52    51    52    49    51    49    51    48    51    47    51    46    51    42    51    44    52    26    51    27    47    26    46    25    46    25    46    26    47    26    47    25    47    26    46    27    45    27    44    24    42    21    38    21    38    19    37     3     9     5     5
                                                                   VAR                                                                                                                                                                                                                                                                                                    ATGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGCTCTGATATTATGATGCAACTGGATGATGCGGTGAGCAGCACAATCACAGGCCCGCGTGATGCACAGGTCTATCCGCCGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGAACGCTGAACTGCGCAGGAAGTGTTTGCAGGGTCCAGGATCATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCTCTTGCTTTTTAAATAAAAGG
                                                                   SNP                                                                                                                                                                                                                                                                            -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                        -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                        -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----T------
                                               BLH ATG      99     930                                                    
                                               BLH MIN      84     202                                                    
                                               BLH MPR      75     202                                                    
                                               BLH OVR      99     147                                                    
                                               EST CLI      31       2                                                    
                                               ORF LNG      99      20                                                    
                                                                                                                                                                                                                                                        PROTEIN --- Gg ---- 9e-023     NP_001025952.1 queuine tRNA-ribosyltransferase domain containing 1 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 4e-118     NP_502268.1 TRNA Guanine Transglycosylase TGT-1 (tgt-1) [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Sp ==== 5e-119     XP_001198912.1 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN --- Dm ---- 3e-140     NP_608585.1 CG4947-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 7e-172     NP_068688.1 tRNA-guanine transglycosylase; queuine tRNA-ribosyltransferase [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                           PROTEIN --- Hs ---- 6e-174     NP_112486.1 tRNA-guanine transglycosylase [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN -== Dr ==== 0          NP_957304.1 similar to queuine tRNA-ribosyltransferase 1 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN === Xl ==== 0          AAH97803.1 MGC115515 protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PREDICTED = ?? ==== 0          NP_001089529.1 hypothetical protein LOC734584 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PREDICTED = Xt ==== 0          AAH62509.1 Hypothetical protein MGC76136 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg057g09.3.5                                                                                                                                                       ATG------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------ATG------------------ATG---------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------ATG------ATG---------------------------------------------------------------------TGA------------TAG------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------TAA------------TAA
                                                                   ORF                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   1           Gas1 FL                     IMAGE:5309397.FL-MGC                                       GTCATCGCGCATTGGGACGCAGGCTGGCAGCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATTATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACGCCAAGTTTTTAAACAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg001l19.FL-Sanger                                        TCATCGCGCATTGGGACGCAGGCTGGCAGCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAAAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCTGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATCAAAAAAAAAAAAAAAAAA
  5   1   1         - Egg  5g                        TEgg131h13.p1kSP6 ATCATAAGGCCCAGCGCAAAGGACGCATGCGAGTGACGTCATCGCGCATTGGGACGCAGGCTGGCAGCATACTCACGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAAAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAATAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCATCACAATCACAGGCCCGCGTGTGGAGGAAGCCATG
  5   1   1         - Egg  5g3  in                  TEgg057g09.p1kaSP6                CGCAAAGGACGCATGCGAGTGACGTCTTCGCGCATTGGGACGCAGGCTGGCAGCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTG
  5   1   1         - Egg  5g                        TEgg143n12.p1kSP6                CGCAAAGGACGCATGCGAGTGACGTCATCGCGCATTGGGACGCAGGCTGGCAGCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAAATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGAGGAAACCATGCACAGGTCTATC
  5   1   1   22    - Gas7 5g                              XZG28185.5p ..................CCCACGCGTCCGCCCACGCGTCCGCGCGCATTGGGACGCAGGCTGGCAGCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCTGCGTGTGGAGGAAGCCATGCACAAGTCTATCCGCTGGTTGGATCGATGTA
  5   1   1   12    - Gas7 5g3  in                         XZG52081.5p ..................CGGACGCGTGGGCGGACGCGTGGGTCGCGCATTGGGACGCAGGCTGGCAGCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAACTT
  5   1   1         - Egg  5g                        TEgg140d10.p1kSP6                              CGAGTGACGTCATCGCGCATTGGGACGCAGGCTGGCAGCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCT
  5   1   1         - Egg  FL   in                   TEgg001l19.p1kSP6                                       TCATCACGCATTGGGACGCAGGCTGGCACCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACTCTTTGGTACACCGGGTGTTAACGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAAAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCATATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGT
  5   1   1         - Gas1 FL   in                    IMAGE:5309397.y1                                             CGCATTGGGACGCAGGCTGGCAGCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATTATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGA
  5   1   1   12    - Gas7 5g3  in                         XZG19069.5p ...................................................GGGACGCAGGCTGGCAGCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGGCCCGC
  5   1   1   12    - Gas7 5g3  in                         XZG33918.5p .......................................................CGCAGGCTGGCAGCAGACTCAGGAAACAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGG
  5   1   1         - Egg  5g   out                  TEgg042b23.p1kSP6                                                               TGGCAGCAGACTCATGAAACTATGAAGTAATGCGAGCGACTGTGGCGCTGGAACTCAAAGAGTTGTTTCCGCGTCTCAAGGGAAAAAAATGGCGGCGCCCCATTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCATTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCA
  5   1   1         - Neu0 5x                            IMAGE:6991394                                                                                   CAGGAAGTATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGANAAANGCGGGCGGCCTGCATGTTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAAGCGTGGGGTTTCAGAATGGTTTCCCCTGGTGGAGTTGTCAAAAGTGACGGAAAGAGGGGGTGCAGTTTCAGATCTCCCTACCATGGGGAAAGAGAATCCTGCTCCACCCCAAAAAAATCCATTGGAAATCCAAAATGCCCTGGGGCTCCGGAATTTTATGATGCAACTGGGATGAATTTGGTGAAGCAACCAAAATCACCGGGCCCCCCGGGGTGGAGGAAACCCTTGGCCCAGGGCCTATCCCCCCGGGTTGGGAACCAAGTGATTTGCCCCCCAAAAAAAAACCCCCAAATTTGAAAAAAAACCTTTTTTGCCCCTCCTTCCAAAGAGAGGCCCGGGGGGGCTAAAAACTGCCCCCACAAAAAATGTTTTTTCCCGGAAAAAAAAAAAAAAAAGGGGGAGCGCCCCCCCGCGGTTTTTCCCCCATTTGGGGGGCCCCCACAGCGGGGGGGAAAGAAAAAAAAAAAAAAATATTCTTCTTTTTGGGAAAAAAAGGGGGGGCCCCCCTCCCCCAGCGAGGGACCTTATTTTTCTCCGGGGGGGGAAAAAACCCTCTCTTTTCTCTTTCTGGGGGGGGGGGGGGGAGAATACGCCCCC
  5   1   1         - TpA  5g3  in                  TTpA045b16.p1kaSP6                                                                                   AGGAAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAAAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTA
  5   1   1         - Gas  FL                        TGas042b06.p1kSP6                                                                                    CAAGGAAGTAATGCGAGCGACTGTGGCGCTGGAACTCAAGGAGTTGTTTCCCTTCTCAAGGGAAAAAATGGCGGCGCCCCAGTGTGACGCTTTGGTACACCGGGTGTCAGCGGAGTGCCCACTCACCAAGGTCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCACTGAAGACTCCGGTGTTCATGCCCGTCGGGACACACGGCACCATGAAGGGGGTGACCGGAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGTCTGGGGAACAC
  5   1   1         - Egg  5g3  in                   TEgg056p04.p1kSP6                                                                                       AAGTAATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTG
  5   1   1   12    - Gas7 5g3  in                          XZG6153.5p .......................................................................................AAGTATGCGAGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTTGGAGAATGGTGACCCCTCAGCACTG
  5   1   1         - Egg  5g                        TEgg095c03.p1kSP6                                                                                              AGCGACTGTAGGCGCTGTGAACGCAAGGAGTTGTTTCCGCGTCTCAAAGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGAGTTAGCGGAGTGCCCAGAGACCAAAGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAAGGCACCATGAAGGGGGTGACGGCAAATCACCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCAGGATGCGCCCAGGTCTGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGATTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACTGAAGAAAGGGTGCATTTCAGATCTCCCTACCATGGGAAATAGATACTGCTCACACCCACAGAAATCCATTGAAATCCAAAATGCACTGGGGTCTAATATTATGATACTACTGGATGATGT
  5   1   1         - Egg  5g                        TEgg095d03.p1kSP6                                                                                                AGCGACTGTGGCGCTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCTGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTG
  5   1   1   12    - Gas7 5g3  in                         XZG57627.5p ............................................................................................................CTGGAACGCAAGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTC
  5   1   1       chi Gas8      in                          st32i16.5p                                                                                                                       AGGAGTTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGTGAGGGGAAACTTGTAGCGGAAGTGCAGGCTCATTTGGCTTGTAATGTAGCGCTAGGAACTGCTCTGTGTGTGTGTGCTGTCCGGGCCCACAGGCACATCAGCATATGGGAATGTTACACTCATTATGGAGCTATAGTTTAAAGGGGCGCTGGGGGGATGGAAGGAGTGCATGAATTCCCCCCAATCATTGTGGGTGTTACAGTATTAAATACAATTGTTTCCCAGCAGCAGCAGAAAGAGTTAACAGCCTTATCTCCCCTGTAGGGTCCGGAGATTATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCANAAACCTCCTTACTGACAGCGGTGGGTTTCANATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAA
  5   1   1         - Egg  5g3  in                   TEgg024g13.p1kSP6                                                                                                                            TTGTTTCCGCGTCTCAAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAAAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGTTGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGC
  5   1   1         - BrSp      in                     EC2BBA22BC11.g1                                                                                                                                     GGGGCGTTTCAAGGCAAAATGGCGGCGCCCCAGAGTTTGGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGTACCATGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACGTATCACCTCGGGATGCGCCCGGCTCTGATATTATGATGCAACTGGATGATGCGGTGAGCAGCACAATCACAGGCCCGCGTGATGCACAGGTCTATCCGCCGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGAACGCTGAACTGCGCAGGAAGTGTTTGCAGGAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTGTATCAACAAAAAGCCCATTGATCTTGTACCGACAGGGCCGTGTGAAAGCCGGATGA
  5   1   1   14    - Gas6 5g3  in                          ANBT179.5p .....................................................................................................................................CCTAAAGGGCAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATTATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTC
  5   1   1   14    - Gas6 5g3  in                         ANBT2867.5p .....................................................................................................................................CCTAAAGGGCAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATTATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCACAAGGACAGCTAGGTTCGGATC
  5   1   1         - Gas8 5g3  in                           st7h06.5p                                                                                                                                      CGTCTCAGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATTATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGG
  5   1   1         - Egg  5g3  in                   TEgg003p21.p1kSP6                                                                                                                                        TCAAGGGGAAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATTATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAG
  5   1   1   12    - Tad5 5g3  in                         XZT33716.5p ..........................................................................................................................................CAAGGGAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTTCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTT
  5   1   1         - Gas  5g3  in                   TGas067o24.p1cSP6                                                                                                                                                AAAAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATTATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTG
  5   1   1         - Egg  5g                        TEgg099m11.p1kSP6                                                                                                                                                 AAAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTATCGGAGTGCCCAATGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATAGCCCGTCGGCACACAAGGCACCATGAAGGGGGTGACTGTAGATCAGCTGCGGAATCTGGGCTGCTAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCTGGTCCGGAGATCCTTAAAAATGCCGGCGGCCTGCATGGCTTTATGAACTGGGGCGAAAACCTCCTTAGTGACAGCGGTGGGTTTCCTATGGTTTCC
  5   1   1         - Egg  5g                        TEgg099m08.p1kSP6                                                                                                                                                   GAAAATGGCGGCGCCCCAGTGTCACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGACTGCATGGTTTTATGAAATGGGGCA
  5   1   1         - Te5       in                         CAAO1184.5p                                                                                                                                                     AAATGGTGGCGCCACAGAGTTTGGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGCTCTGATATTATGATGCAACTGGATGATGCGGTGAGCAGCACAATCACAGGCCCGCGTGATGCACAGGTCTATCCGCCGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGAACGCTGAACTGCGCAGGAAGTGTTTGCAGGGTCCAGGATCATGTGTTTAACTTCATCCGTCCGGAGGCTGCGTTTGTGAATCCAAGATGGCGTCGGGTTGCTGTGAGCTCGCCTGAGGAGCGAAGCATGCTGTCACCTGTTGCGATAGGAGCAGCCGGAGCGGCGACCGCATCAAACCTGCCGATTGGCACCTGGGCAGATATCAGTCAGAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGATAGGAGCAGCCGGAGCGGCGACCGCATCANACCTGCCGATTGGCACCTGGGCAGATATCAGTCAGAGGTTCGGATCAGCGCTGGTTCCCT
  5   1   1         - Gas7      ?                          XZG44353.5p                                                                                                                                                         GGCGGCGCCCCAGAGTTTGGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGCTCTGATATTATGATGCAACTGGATGATGCGGTGAGCAGCACAATCACAGGCCCGCGTGATGCACAGGTCTATCCGCCGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGAACGCTGAACTGCGCAGGAAGTGTTTGCAGGGTCCAGGATCATGTGTTTAAGTTCATCTACCGGGGATGTGTCTAGGATCGCTGGAGCTTTGCCGTCCGGAGGCTGCGTTTGTGAATCCAAGATGGCGTCGGGTTGCTGTGAGCTCGCCTGAGGAGCGAAGCATGCTGTCACCTGTTGCGGTGATTTTTTGTTTTGTTGTTTGGGTCCCATGTTGATCAGCAGTAGTTTAGCGATCTAGTGGGGTCCTGTTCACTCGCTTTTTAGCGTTTTTCCCTATCCTTTTTGGGCTGTGTCTCAGAGAGCTCCGGTCTCATGCGTCCATACTGGCTGCCGGCTAGCTCCACCCCCCTTACTAGAAATCTTTTAAGCACTGTTTGGTGTTTTTATAGGTATATAAATTGTGGTTTTTAAGGAAGACCTTTTTTTTTTTTTTTTGAAAGGTATATTTTATTGCTTTTCATACAAACAAAACATAAAG
  5   1   1         - Thy1      in                       CBST12878.fwd                                                                                                                                                                       GTTTGGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGGGTGGCGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGCTCTGATATTATGATGCAACTGGATGATGCGGTGAGCAGCACAATCACAGGCCCGCGTGATGCACAGGTCTATCCGCCGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGAACGCTGAACTGCGCAGGAAGTGTTTGCAGGGTCCAGGATCATGTGTTTAACTTCATCTACCGGGGATGTGTCTAGGATCGCTGGAGCTTTGCCGTCCGGAGGCTGCGTTTGTGAATCCAAGATGGCGTCGGGTTGCTGTGAGCTCGCCTGAGGAGCGAAGCATGCTGTCACCTGTTGCGTGGCAGGAATTATCAGGCCAAATGTAGTAACGTGGTAACAGCAGCCCTCAGTCTGTTTGATTGCGGCAAGATGGCACCTAGATGTTTGGACCACCTTGTTACAGGCTCCACCCACTTACCAGTCTGTTCAAATGTGTGATATGATAGGAGCAGCCGGAGCGGCGACCGCATCAAACCTGCCGATTGGCACCTGGGCAGATATCAGTCAGAGGTTCGGATCAGCGCTGGTTCCC
  5   1   1         - HdA       in                   THdA046m13.p1kSP6                                                                                                                                                                         CACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAAAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTT
  5   1   1         - Gas8      in                         st113h11.5p                                                                                                                                                                         CACGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCANTGAAGACTCCCGTGTTCATGCCCGTCGGCNCACAGGGCACCATGAAGGGGGTGACGGCANATCANCTGCGGAATCTGGGCTGCNAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATTATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAANGNGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGANGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCNACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGANGTCTGGATGCTGAACTGCGCAGG
  5   1   1         - Gas8      out                         st17i02.5p                                                                                                                                                                           CGCTTTGGTACACCGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATTATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGA
  5   1   1         - Neu0      in                       IMAGE:6992082                                                                                                                                                                                        CGGGTGTTAGCGGAGTGCCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCAACCAAGACAGCCTGGTTCGGATCAGCGCTGGTTCCCCGGGGTTCCCTACAGCTAAAAAACAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTG
  5   1   1         - Ovi1      in                         CABI6161.5p                                                                                                                                                                                                         CCCAGTGACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATTATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTA
  5   1   1         - Egg0      in                         dad64h05.y1                                                                                                                                                                                                           CCATTGACAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCATTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGTTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGGTGGATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGNGGGTTTCAGATGGTTTCCCTGGTGGAGTTGNCAAAAGAAACAGAAGAAGGGGTGCAGNTCANATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGNTCTCTGTTATTATGATGCAACTNNATNATGNGGNGAGCANCACAATCACANGCCCCCNNGNGNANGAAGCCATCCACAGNNCTATC
  5   1   1         - Tbd0      in                       IMAGE:6976863                                                                                                                                                                                                           CCAGTGACAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCACAAGACAGCTAGGTTCGGATCAGCGCTGGGTTCCTGGGGGTTCCCTACAGCTAAAGAACAAACAGTTTTGCTAAAGATTTCCAGCCCATANACAAGAAACTGTGATTTGTCCAACGTGTCCAAAGGTACCGCCGGGGCCTACATCAATGGCCTTTATTTAAAAATGAACCCTGCTTGCTATGGCACCATATTACAATCCCATAAACTTGCCTTAATCAGCTGGAATCT
  5   1   1         - Tad5      in                         XZT55107.5p                                                                                                                                                                                                               GACCAAGGCCCGGGCATGTGAGTTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGGACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTC
  5   1   1         - Gas       in                   TGas121o11.p1kSP6                                                                                                                                                                                                                                     TTCCGCTTGCCCCATGGCCCAGTGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTATCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGC
  5   1   1         - Gas                            TGas016a15.p1kSP6                                                                                                                                                                                                                                                           TGAAGACTCCCGTGTTCATGCCCGTCGGCACACAGGGCACCATGAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGC
  5   1   1         - Gas8      in                         st111b02.5p                                                                                                                                                                                                                                                                                                ACCATGTAAGGGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATTATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGG
  5   1   1         - Gas                            TGas027h12.p1kSP6                                                                                                                                                                                                                                                                                                                   GCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGT
  5   1   1         - TbA       in                   TTbA068n09.p1kSP6                                                                                                                                                                                                                                                                                                                   TTCGATCAGCTGCGGAATCTGGGCTGCTAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAAAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAAATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACATGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAACACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAAAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATTCATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATAT
  5   1   1         - Gas7                                 XZG31282.5p                                                                                                                                                                                                                                                                                                                                            GCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGGTCCGGAGATCATGAAAAAGGCGGGCGGCCTGCATGGTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATG
  5   1   1         - Neu                            TNeu023n06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTTATGAACTGGGGCAGAAACCTCCTTACTGACAGCGGTGGGTTTCAGATGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACA
  5   1   1         - Neu                            TNeu133k02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCCTTACTGACAGTGGTGGGTTTCAGATGGTTTACCTGCTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATG
  5   1   1         - Gas       in                   TGas137f08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTACTGACAGCGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAA
  5   1   1         - Gas7                                 XZG34195.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGACGCGTGGGGTGGGTTTCAGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCC
  5   1   1         - Gas       in                   TGas120e14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCCGGGGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTAGCCTAAGCGGAGGAGAAGAGACAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCCTTACCCTTATGGGAGTGGGATATGCT
  5   1   1         - Egg                            TEgg115k03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAG
  3   1   1         - BrSp      in                     EC2BBA22BC11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGAACGCTGAACTGCGCAGGAAGTGTTTGCAGGAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTGTATCAACAAAAAGCCCATTGATCTTGTACCGACAGGGCCGTGTGAAAGCCGGATGATAAAACCCGACTATACCATTTCTACAGGGAGACAATGGGGGTCATTTATAAAGACCCCAAGTGCAAGAGAACTAAGGGGTGCAAAAGAACACTCGGGTACAGTGTCTAGCACAAAGCAGCCCCGAATGACTGTAAATCTGGACATGGAAGATCCAAATGTTTGCCTAAGTTGGTGGCCAAAATCAAGCTGATAATAATAGGGCCCCATGCAGTCGGCAGTCGCATCAAAGGCCCAAATTAATCCTCAGAACCTACTGGGATTTTCCGACCTGCTTCACAGATATCTGATTGATCCCAAGTCTGTAAAAACAAGACCAAGCTTGTAATGCTTATCCCTCACCATTCTGTTTAAACACAGGGCACGGGGTAGGTGGAGATGCGTGATTTATACCTTTACA
  5   1   1         - Gas7      in                         XZG65644.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTTGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTAT
  5   1   1         - TbA       in                   TTbA039d04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTCTGCCCTCCTCCCCTGCACAGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCANGCCGGGACCNCATAGCCCTGTTGGGCTTTAACTATTGTCTGAAATG
  3   1   1       chi Gas       in                    TGas137f08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCTGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTAAACAAAAAAAAAAAAAAAAAAGCGGCGAGAA
  3   1   1         - Te5       in                         CAAO1184.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGAACGCTGAACTGCGCAGGAAGTGTTTGCAGGGTCCAGGATCATGTGTTTAACTTCATCCGTCCGGAGGCTGCGTTTGTGAATCCAAGATGGCGTCGGGTTGCTGTGAGCTCGCCTGAGGAGCGAAGCATGCTGTCACCTGTTGCGATAGGAGCAGCCGGAGCGGCGACCGCATCAAACCTGCCGATTGGCACCTGGGCAGATATCAGTCAGAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGATAGGAGCAGCCGGAGCGGCGACCGCATCAAACCTGCCGATTGGCACCTGGGCAGATATCAGTCAGAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGCCCTACATCAATGCCTTATTTAGAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTGCTTTTTAAATAAAAGGCTACATTTTT
  3   1   1         - Neu0      in                       IMAGE:6992082                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTGGAATGATTGGGGTGAGCCGCCACAAATCACCAGGCCCCGGGTGTGGAGGAAGGCCATGCACAGGTCTATTCCCACTGTTGGATTCGATGTATTGCGGCCAACAGCAACCCGAATGGACAGAATCTCTTTGCCATCTTCCAGGAAGGTCTGGATGTTGAACTGCGCAGGAAAGTGTTTGCAGGAGAAGACAAAAGCGGGACGTCCCCGGCTTTGCCAATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACATTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTCCTTTTTCTAAGAATGAA
  3   1   1         - Thy1      in                       CBST12878.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAGGATCATGTGTTTAACTTCATCTACCGGGGATGTGTCTAGGATCGCTGGAGCTTTGCCGTCCGGAGGCTGCGTTTGTGAATCCAAGATGGCGTCGGGTTGCTGTGAGCTCGCCTGAGGAGCGAAGCATGCTGTCACCTGTTGCGTGGCAGGAATTATCAGGCCAAATGTAGTAACGTGGTAACAGCAGCCCTCAGTCTGTTTGATTGCGGCAAGATGGCACCTAGATGTTTGGACCACCTTGTTACAGGCTCCACCCACTTACCAGTCTGTTCAAATGTGTGATATGATAGGAGCAGCCGGAGCGGCGACCGCATCAAACCTGCCGATTGGCACCTGGGCAGATATCAGTCAGAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGCCCTACATCAATGCCTTATTTAGAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTGCTTTTTAAATAAAAGGGCTAAATTTTTAACAATC
  3   1   1         - Tbd0      in                       IMAGE:6976863                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTTGGGGTTCGAATGGTAATTGGCCGCCCAAACCAGGCAAACCCCCGGATTGGAACAGAATTCTCTTTTGCCCATTCATCCAAAGGGAGGTTCTGGATGCTGAAACTGCGCAGGAAAGTGTTTGCAGGAGNATGACAAAAACGGGACGTCCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTAAATAAAATGCCAA
  5   1   1       chi Gas7                                  XZG8660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAANAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTTGCTATCAGCTGAATCTG
  3   1   1         - Egg  5g3  in                    TEgg057g09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAACAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas       in                    TGas120e14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTAGTTTTAAATAAAATGCCAAGTTTTTAAACAATCAAAAAAAAAAAAAAAAAAA
  5   1   1         - Tad5      in                         XZT54183.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCANGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTTAGACTTTTATTTTTAAATAAATGCCAAGTTTTTAAACAATCAAAAAAAAAAAAAGG
  3   1   1         - Gas6 5g3  in                          ANBT179.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCAACAGCAACCNCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACGCCAAGTTTTAAACAATC
  3   1   1       chi Hrt1      out                        CAAQ8319.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTGACACTATAGGGGGCATGGCTCCCGCTGTGACACAGACCAGTACAATCCGTAGGGTAATAGAGAGCACAGAATGAATTCACTCAGTGGGCAGTGCTGCTGTTTTGGTAGGACAGGGCATTGGTACTGGCACTGCCCCAGCATCCCACAACTGATTTTGGACTTGGGGAATTTTTAGCCCAGAACTAGAGAGGCCGCAGGTTTTATACCACTAATACTGACTGTGCTGGGCCTGATAATCTGTCTAATTTATCTCAATCTGTTTGTCTTGCTTAGAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACGCCAAGTTTTTAAACAATC
  3   1   1         - Ovi1      in                         CABI6161.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACGCCAAGTTTCTAAACAATC
  3   1   1         - Gas  5g3  in                    TGas067o24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAAGGCCANAGTTTTTAACAATCAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7 5g3  in                         XZG57627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTT
  3   1   1         - Gas7 5g3  in                          XZG6153.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCCGGCTTTGCCATTGGTGGCTTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTT
  3   1   1         - Gas8      out                         st17h02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTNTGGATGCTGAACTGCGCAGGAAGTGTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTAAGAACTT
  3   1   1         - Gas       in                   TGas121o11.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAACAATCAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7 5g3  in                         XZG33918.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTCCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAACC
  5   1   1         - Egg       in                   TEgg049b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTT
  3   1   1         - Egg       in                    TEgg049b12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTAAACAAAAAAAAAAAAAAAAAAA
  3   1   1       chi Brn4      out                       CAAL22747.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGTAGGGTAATAGAGAGCACAGAATGAATTCACTCAGTTGGCAGTGCTGCTGTTTGGGTAGGACAGGGCATTGGTACTGGCACTGCCCCAGCATCCCACAACTGATTTTGGACTTGGGGAATTTTTAGCCCAGAACTAGAGAGGCCGCAGGTTTTATACCACTAATACTGACTGTGCTGGGCCTGATAATCTGTCTAATTTATCTCAATCTGTTTGTCTTGCTTAGAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTAAGAACTTTTATTTTTAAATAAAAGGCCAAATTTTTAACAATC
  3   1   1         - Gas6 5g3  in                         ANBT2867.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACNGCCAAGTTTTAAACAATC
  3   1   1         - Egg  5g3  in                    TEgg056p04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGATGACAAAACGGGACGTTCCCCNGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATTTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTTTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTACCAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1         - Gas7      in                         XZG51342.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGANATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATCAAAAAAAAA
  3   1   1         - Tad5 5g3  in                         XZT33716.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTGCCATTGGTGGCNTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTAAAC
  3   1   1         - Gas7      in                         XZG51342.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTGGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAAC
  3   1   1         - Gas8 5g3  in                           st7h06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCANTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGTAAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGNTGAATNTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTAAGAACTT
  3   1   1         - Tad5      in                         XZT55107.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAAC
  3   1   1         - Gas7      in                         XZG65644.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAAC
  3   1   1         - Tad5      in                         XZT54183.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTAAAC
  3   1   1         - Gas8      in                         st111b02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCNTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACNTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTAAGAACT
  3   1   1         - TbA       in                    TTbA039d04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCTTCAGCACTGACCATTTGCTTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGTTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGTTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGTTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGTTGTTATGCCCCATATTACAATCCATAACATTGTTTTTCAGCTGAATTTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGTTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTTTAGAGACAGTTGGTATCACCCTGCAGTGATTTTTGTGTTTTTAGGAACATGGAGTAAATTTGCCCATTCCCTGTTATGGGCCTTTTTATACCCCAGAACTGATATTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTTTTTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACGCCAAGTTTTTAACCATTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   1         - Gas8      in                         st113h11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACCATTTGCCTCGGGACAAACNTCGTTACCTTATGGGAGTGGGATATGCTACAGACNTTGTGGTATGTGTAGCTTNGGGCTNTGATATGTTTGANTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGNGNTGGTTCCNTGGGGTTCCNTACAGCTAAAGAACAANCAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCNTACATCAATGCNTTATTTAAAAGTGACACTGCATGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGNGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCNTGCAGTGATCTNTGTGCTNTTAGGAACATGGAGTAAATCTGCACNTTACCTNTTATGGGCCTTTNTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCNGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGNTCATAGTTCCGNTATTCTGTTTTTATCA
  3   1   1         - Gas8                                  st18i02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTGCNTCGGGACNAACCTCGTTACCNTATGGGAGTGGGATATGCTACAGACNTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTNGACTGTGTCTNTCCAACAAGGACAGNTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTNCAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAANTGTGNTTGTNCCACGTGTCAGAGGTACAGCCGGGCNTACATCAATGCNTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACANTGNTTATCAGNTGAATTTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCTCCAATGGGNTGTGGATGCTNTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGNTNTTAGGAACATGGAGTAAATNTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCNATAGCCCTGTTGGGCTNTAACTTATTGTCTGAAANGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAA
  3   1   1         - Egg  5g3  in                    TEgg003p21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACGCCAAGTTTTTAAACAAAAAAAAAAAAAAAAAAA
  3   1   1         - TbA       in                    TTbA068n09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCGTACAGCTAAAGAACAAACAGTTTGTTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCTTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTTTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATATTCAGGCTGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATCAAAAAAAAAAAAAAAAAAAAGC
  3   1   1         - Gas7 5g3  in                         XZG52081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGGGGGATATGCTACAGACCTTGGGGGTATGTGTAGCTTTGGGCTGGGATATGTTGGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAAC
  3   1   1         - TpA  5g3  in                    TTpA045b16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATTTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTTTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCTGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTTTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGGTTTTTAAACAATCAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7 5g3  in                         XZG19069.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTGGTATGTGTAGCTTTGGGCTGGGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCCCCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTCCAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACAGGGAGTAAAATCTGCCCATTCCCTGTTATGGGCCTTTTTATCCCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTT
  5  -1   1         - Egg                            TEgg069f05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCTGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATAAAAAAAAAAAAAAAAAAGCGG
  3   1   1         - Gas8      in                          st32i16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GANTGTGTCTNTCCAACAAGGACAGCTAGGTTNGGATCAGCGCTGGTTCCCNGGGGTTCCCTACAGNTAAAGAACAAGCAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACANTGCTGCTATGCACCATATTACAATCCATAACATTGNTTNTCAGNTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTNGTGCNGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCNTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACC
  3   1   1         - Egg  FL   in                    TEgg001l19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGATCAGCGCTGGTTCCTTGGGGTTCCCTGCAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCATACATCAATGCCTTATTTAAAAGTGACACTGTTGTTATGCACCATATTACAATCCATAACATTGGTTATCAGCTGAATTTGATGCGCTGGGTGAGGGACAGCATCTTGCAGGGCCGCTTCCCCCAGTTGGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTTTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTATGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATGCCACAGAACTGATACTCAGGCTGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTTCGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATCAAAAAAAAAAAAAAAAAA
  3   1   1         - Egg  5g3  in                    TEgg024g13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCTGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTAA
  3   1   1         - Thy1                                CBST3623.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGCCCTACATCAATGCCTTATTTAGAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTGCTTTTTAAATAAAAGGCTAAATTTTTAACAATC
  5   1   1         - Gas       in                   TGas120m22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGGTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATC
  3   1   1         - Gas       in                    TGas120m22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATCAAAAAAAAAAAAAAAAAA
  3  -1   1         - Gas5                                  XZF2374.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAGCGTGCAGCGCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACGCCAAGTTTTTAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas1 FL   in                    IMAGE:5309397.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACGCCAAGTTTTTAAACAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   1         - Egg                            TEgg056a01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACC
  3   1   1         - HdA       in                    THdA046m13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACCATGTACAGCAGCCGAGACAAGTACCCCCAATGGGTTGGGGATGCTCGAGAGACAGTTGGTATCGCCCTGCAGTGATCTGTGGGGTCTTAGGAACATGGAGGAAAATCTGCACACTACTGGTTATGGGCCTTTTTATACCACAGAACTGATAGTCAGGCTGGGACCCAATAGCCCCGTTGGGCTTTAAATTAAAGTATGAAAAGTTCCGCTCACAGTCCCGTTATTCCGTTTTAATCAATAACCTTATTTTTAAGAAATTCTATTTTTAAATAAAAGTGCCAAGTTTTTAACCAAAAAAAAAA
  3   1   1         - Egg0      in                         dad64h05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACA
  5   1   1         - BrSp                             EC2BBA13CE12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTAAGAACTTTTATTTTTAAATAAAAGGCCAAATTTTTAACAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)