Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-IMAGE:7004046.5                       3 END     2           1       66                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 231.0    0Xt7.1-XZG48009.5                            9 PI      95        727      866                Hypothetical protein MGC76136 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012153497 Xt7.1-TEgg057g09.3.5 - 108 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                         5     9     6    11     6    11     8    16     8    18    10    19    12    21    12    26    28    30    26    32    34    36    33    37    33    37    37    41    39    41    40    42    37    41    40    42    40    42    38    42    39    43    36    43    41    45    40    45    41    46    41    45    40    45    37    45    38    45    40    45    37    45    38    45    39    46    38    48    40    49    43    49    41    49    40    48    38    48    41    48    41    48    40    48    41    49    42    52    42    52    42    52    41    52    39    51    37    51    38    50    38    51    37    49    38    50    37    48    39    50    39    50    38    49    40    51    41    54    40    52    41    53    41    54    43    54    46    57    43    54    48    58    46    58    46    58    47    58    46    59    47    60    44    60    47    61    47    59    49    60    49    60    47    59    45    57    42    57    49    56    48    56    46    55    48    53    48    53    48    53    47    53    47    53    46    51    44    51    45    50    46    50    44    50    45    47    45    47    43    49    46    49    47    48    47    49    48    49    46    49    49    50    51    52    51    52    49    51    49    51    48    51    47    51    46    51    42    51    44    52    26    51    27    47    26    46    25    46    25    46    26    47    26    47    25    47    26    46    27    45    27    44    24    42    21    38    21    38    19    37     3     9     5     5
                                                                   VAR                                                                                                                                                                                                                                                                                                    ATGGGTGACGGCAGATCAGCTGCGGAATCTGGGCTGCGAGATCTGCCTGGGGAACACCTATCACCTCGGGATGCGCCCGGCTCTGATATTATGATGCAACTGGATGATGCGGTGAGCAGCACAATCACAGGCCCGCGTGATGCACAGGTCTATCCGCCGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGAACGCTGAACTGCGCAGGAAGTGTTTGCAGGGTCCAGGATCATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCTCTTGCTTTTTAAATAAAAGG
                                                                   SNP                                                                                                                                                                                                                                                                            -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                        -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                        -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----T------
                                               BLH ATG      99     930                                                    
                                               BLH MIN      84     202                                                    
                                               BLH MPR      75     202                                                    
                                               BLH OVR      99     147                                                    
                                               EST CLI      31       2                                                    
                                               ORF LNG      99      20                                                    
                                                                                                                                                                                                                                                        PROTEIN --- Gg ---- 9e-023     NP_001025952.1 queuine tRNA-ribosyltransferase domain containing 1 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 4e-118     NP_502268.1 TRNA Guanine Transglycosylase TGT-1 (tgt-1) [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Sp ==== 5e-119     XP_001198912.1 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN --- Dm ---- 3e-140     NP_608585.1 CG4947-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 7e-172     NP_068688.1 tRNA-guanine transglycosylase; queuine tRNA-ribosyltransferase [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                           PROTEIN --- Hs ---- 6e-174     NP_112486.1 tRNA-guanine transglycosylase [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN -== Dr ==== 0          NP_957304.1 similar to queuine tRNA-ribosyltransferase 1 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN === Xl ==== 0          AAH97803.1 MGC115515 protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PREDICTED = ?? ==== 0          NP_001089529.1 hypothetical protein LOC734584 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PREDICTED = Xt ==== 0          AAH62509.1 Hypothetical protein MGC76136 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg057g09.3.5                                                                                                                                                       ATG------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------ATG------------------ATG---------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------ATG------ATG---------------------------------------------------------------------TGA------------TAG------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------TAA------------TAA
                                                                   ORF                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   1         - Neu                            TNeu133k02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCCTTACTGACAGTGGTGGGTTTCAGATGGTTTACCTGCTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATG
  5   1   1         - Gas       in                   TGas120e14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCCGGGGATGGTTTCCCTGGTGGAGTTGTCAAAAGTGACGGAAGAAGGGGTGCAGTTCAGATCTCCCTACGATGGGAAAGAGATCCTGCTCACCCCAGAAAAATCCATTGAAATCCAAAATGCACTGGGCTCTGATATTATGATGCAACTGGATGATGTGGTGAGCAGCACAATCACAGGCCCGCGTGTGGAGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTAGCCTAAGCGGAGGAGAAGAGACAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCCTTACCCTTATGGGAGTGGGATATGCT
  5   1   1       chi Gas7                                  XZG8660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGAAGCCATGCACAGGTCTATCCGCTGGTTGGATCGATGTATTGCCGCCAACAGCAACCCCGATCGACAGAATCTCTTTGCCATCATCCAAGGAGGTCTGGATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAANAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTTGCTATCAGCTGAATCTG
  3   1   1         - Gas8      out                         st17h02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTNTGGATGCTGAACTGCGCAGGAAGTGTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTAAGAACTT
  3   1   1         - Gas7 5g3  in                         XZG33918.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTCCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAACC
  5   1   1         - Egg       in                   TEgg049b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGAACTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTT
  3   1   1         - Egg       in                    TEgg049b12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCGCAGGAAGTGTTTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTAAACAAAAAAAAAAAAAAAAAAA
  3   1   1       chi Brn4      out                       CAAL22747.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGTAGGGTAATAGAGAGCACAGAATGAATTCACTCAGTTGGCAGTGCTGCTGTTTGGGTAGGACAGGGCATTGGTACTGGCACTGCCCCAGCATCCCACAACTGATTTTGGACTTGGGGAATTTTTAGCCCAGAACTAGAGAGGCCGCAGGTTTTATACCACTAATACTGACTGTGCTGGGCCTGATAATCTGTCTAATTTATCTCAATCTGTTTGTCTTGCTTAGAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTAAGAACTTTTATTTTTAAATAAAAGGCCAAATTTTTAACAATC
  3   1   1         - Gas6 5g3  in                         ANBT2867.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGCAGGAGATGACAAAACGGGACGTCCCCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACNGCCAAGTTTTAAACAATC
  3   1   1         - Egg  5g3  in                    TEgg056p04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGATGACAAAACGGGACGTTCCCCNGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATTTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTTTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTACCAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1         - Gas7      in                         XZG51342.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGCTTTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGANATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATCAAAAAAAAA
  3   1   1         - Tad5 5g3  in                         XZT33716.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTGCCATTGGTGGCNTAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTAAAC
  3   1   1         - Gas7      in                         XZG51342.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGCCATTGGTGGCCTAAGCGGAGGAGAAGAGAAAGATCACTTTGGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAAC
  3   1   1         - Gas8 5g3  in                           st7h06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAGCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCANTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGTAAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGNTGAATNTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTAAGAACTT
  3   1   1         - Tad5      in                         XZT55107.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGGAGGAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAAC
  3   1   1         - Gas7      in                         XZG65644.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAAC
  3   1   1         - Tad5      in                         XZT54183.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCCTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTAAAC
  3   1   1         - Gas8      in                         st111b02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAAGAGAAAGATCACTTTTGGAGAATGGTGACCNTCAGCACTGACCATTTGCCTCGGGACAAACCTCGTTACNTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTAAGAACT
  3   1   1         - TbA       in                    TTbA039d04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCTTCAGCACTGACCATTTGCTTCGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGTTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGTTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGTTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGTTGTTATGCCCCATATTACAATCCATAACATTGTTTTTCAGCTGAATTTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGTTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTTTAGAGACAGTTGGTATCACCCTGCAGTGATTTTTGTGTTTTTAGGAACATGGAGTAAATTTGCCCATTCCCTGTTATGGGCCTTTTTATACCCCAGAACTGATATTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTTTTTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACGCCAAGTTTTTAACCATTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   1         - Gas8      in                         st113h11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACCATTTGCCTCGGGACAAACNTCGTTACCTTATGGGAGTGGGATATGCTACAGACNTTGTGGTATGTGTAGCTTNGGGCTNTGATATGTTTGANTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGNGNTGGTTCCNTGGGGTTCCNTACAGCTAAAGAACAANCAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCNTACATCAATGCNTTATTTAAAAGTGACACTGCATGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGNGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCNTGCAGTGATCTNTGTGCTNTTAGGAACATGGAGTAAATCTGCACNTTACCTNTTATGGGCCTTTNTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCNGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGNTCATAGTTCCGNTATTCTGTTTTTATCA
  3   1   1         - Gas8                                  st18i02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTGCNTCGGGACNAACCTCGTTACCNTATGGGAGTGGGATATGCTACAGACNTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTNGACTGTGTCTNTCCAACAAGGACAGNTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTNCAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAANTGTGNTTGTNCCACGTGTCAGAGGTACAGCCGGGCNTACATCAATGCNTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACANTGNTTATCAGNTGAATTTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCTCCAATGGGNTGTGGATGCTNTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGNTNTTAGGAACATGGAGTAAATNTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCNATAGCCCTGTTGGGCTNTAACTTATTGTCTGAAANGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAA
  3   1   1         - Egg  5g3  in                    TEgg003p21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGACAAACCTCGTTACCTTATGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACGCCAAGTTTTTAAACAAAAAAAAAAAAAAAAAAA
  3   1   1         - TbA       in                    TTbA068n09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGAGTGGGATATGCTACAGACCTTGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCGTACAGCTAAAGAACAAACAGTTTGTTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCTTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTTTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATATTCAGGCTGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATCAAAAAAAAAAAAAAAAAAAAGC
  3   1   1         - Gas7 5g3  in                         XZG52081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGGGGGATATGCTACAGACCTTGGGGGTATGTGTAGCTTTGGGCTGGGATATGTTGGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAAC
  3   1   1         - TpA  5g3  in                    TTpA045b16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATTTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTTTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCTGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTTTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGGTTTTTAAACAATCAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7 5g3  in                         XZG19069.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTGGTATGTGTAGCTTTGGGCTGGGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCCCCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTCCAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACAGGGAGTAAAATCTGCCCATTCCCTGTTATGGGCCTTTTTATCCCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTT
  5  -1   1         - Egg                            TEgg069f05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGTATGTGTAGCTTTGGGCTGTGATATGTTTGACTGTGTCTTTCCAACAAGGACAGCTAGGTTCGGATCAGCGCTGGTTCCCTGGGGTTCCCTACAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCTGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATAAAAAAAAAAAAAAAAAAGCGG
  3   1   1         - Gas8      in                          st32i16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GANTGTGTCTNTCCAACAAGGACAGCTAGGTTNGGATCAGCGCTGGTTCCCNGGGGTTCCCTACAGNTAAAGAACAAGCAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACANTGCTGCTATGCACCATATTACAATCCATAACATTGNTTNTCAGNTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTNGTGCNGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCNTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACC
  3   1   1         - Egg  FL   in                    TEgg001l19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGATCAGCGCTGGTTCCTTGGGGTTCCCTGCAGCTAAAGAACAAACAGTTTGCTAAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCATACATCAATGCCTTATTTAAAAGTGACACTGTTGTTATGCACCATATTACAATCCATAACATTGGTTATCAGCTGAATTTGATGCGCTGGGTGAGGGACAGCATCTTGCAGGGCCGCTTCCCCCAGTTGGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTTTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTATGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATGCCACAGAACTGATACTCAGGCTGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTTCGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATCAAAAAAAAAAAAAAAAAA
  3   1   1         - Egg  5g3  in                    TEgg024g13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGATTTCCAGCCCATAGACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGGCCTACATCAATGCCTTATTTAAAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCTGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTAA
  3   1   1         - Thy1                                CBST3623.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACAAGAACTGTGATTGTCCCACGTGTCAGAGGTACAGCCGGCCCTACATCAATGCCTTATTTAGAAGTGACACTGCTGCTATGCACCATATTACAATCCATAACATTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCGCCCTGCAGTGATCTCTGTGCTCTTGCTTTTTAAATAAAAGGCTAAATTTTTAACAATC
  5   1   1         - Gas       in                   TGas120m22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGGTGCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATC
  3   1   1         - Gas       in                    TGas120m22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTTATCAGCTGAATCTGATGCGCTCGGTGAGGGACAGCATCCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACAATCAAAAAAAAAAAAAAAAAA
  3  -1   1         - Gas5                                  XZF2374.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAGCGTGCAGCGCTGCAGGGCCGCTTCCCCCAGTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACGCCAAGTTTTTAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas1 FL   in                    IMAGE:5309397.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTGTGCAGGACTTTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTTAAGAACTTTTATTTTTAAATAAAACGCCAAGTTTTTAAACAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   1         - Egg                            TEgg056a01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTATGAGAACCATGTACAGCAGCAGAGACAAGTACCCCCAATGGGCTGTGGATGCTCTAGAGACAGTTGGTATCACCCTGCAGTGATCTCTGTGCTCTTAGGAACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACC
  3   1   1         - HdA       in                    THdA046m13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACCATGTACAGCAGCCGAGACAAGTACCCCCAATGGGTTGGGGATGCTCGAGAGACAGTTGGTATCGCCCTGCAGTGATCTGTGGGGTCTTAGGAACATGGAGGAAAATCTGCACACTACTGGTTATGGGCCTTTTTATACCACAGAACTGATAGTCAGGCTGGGACCCAATAGCCCCGTTGGGCTTTAAATTAAAGTATGAAAAGTTCCGCTCACAGTCCCGTTATTCCGTTTTAATCAATAACCTTATTTTTAAGAAATTCTATTTTTAAATAAAAGTGCCAAGTTTTTAACCAAAAAAAAAA
  3   1   1         - Egg0      in                         dad64h05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACATGGAGTAAAATCTGCACATTACCTGTTATGGGCCTTTTTATACCACAGAACTGATACTCAGGCCGGGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTTAAGAACTTTTATTTTTAAATAAAATGCCAAGTTTTTAAACA
  5   1   1         - BrSp                             EC2BBA13CE12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGACCCAATAGCCCTGTTGGGCTTTAACTTATTGTCTGAAATGTTCCGCTCATAGTTCCGTTATTCTGTTTTTATCAATTACCTTTTTTAAGAACTTTTATTTTTAAATAAAAGGCCAAATTTTTAACAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (