Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 252.0    0Xt7.1-CABE10701.3                          17 PI      97       5797     5937                StAR-binding protein [Homo sapiens]

 This cluster: approximate FL confidence score = 99%

 1012153576 Xt7.1-XZG52323.3.5 - 157 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     5     3     5     2     4     2     4     2     4     2     4     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     5     6     5     6     5     6     6     6     6     6     6     6     7     7     6     6     6     6     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     9     9     9     9     9    10     9    10     8     9     8     9     8     9     8     9     8     9     9     9     9     9     9     9    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11     9     9     9     9     9     9     9     9    11    11    10    11    10    11    11    12    11    12    11    12    10    11    11    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11     8    11     8    11     7    10     8    11     9    12    10    13    10    13    10    17    11    16    10    16    10    16    11    16    12    17    12    17    12    17    12    17    12    17    13    18    14    19    14    19    12    17    12    16    14    18    13    17    13    16    13    16    13    17    13    18    14    18    14    18    14    18    14    18    15    19    15    19    14    18    14    18    14    18    14    18    14    17    15    17    15    18    15    18    18    20    19    23    23    25    23    25    23    26    23    26    23    26    23    26    23    26    22    26    22    26    22    26    24    27    24    27    24    27    23    26    23    25    22    26    24    27    24    29    26    29    27    30    27    30    27    30    29    31    29    31    29    31    30    32    30    32    30    32    32    34    33    35    33    36    33    37    32    36    32    34    34    35    34    36    36    37    31    34    33    34    31    32    29    30    25    26    24    25    24    25    24    26    23    25    25    26    24    25    24    25    24    25    25    26    25    26    22    23    21    22    21    22    21    22    21    22    21    22    21    22    21    22    21    22    22    23    21    22    21    22    21    22    21    22    21    22    21    22    21    22    21    21    20    20    19    20    21    21    21    21    22    22    22    22    21    21    21    21    21    21    21    21    21    21    21    21    21    21    20    20    19    19    19    19    19    19     5     6     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8    10     8    10     8    10     9    11     9    11     9    11     9    11    10    12    13    15    22    23    30    31    29    31    31    34    32    34    33    34    33    34    33    34    33    33    32    32    33    34    33    34    34    35    34    35    34    35    34    35    34    35    34    35    34    35    34    35    34    35    34    35    36    36    36    36    38    39    39    40    38    45    38    46    39    47    40    48    40    48    40    49    40    51    40    53    40    53    40    54    40    54    40    54    40    54    40    55    42    56    41    57    47    53    50    54    34    54    34    54    34    54    34    54    38    58    41    55    41    55    40    52    38    49    35    47    37    47    36    46    36    44    36    44    35    44    38    46    38    46    40    45    38    44    38    44    35    41    35    41    36    41    35    41    34    41    36    41    34    40    36    39    34    38    35    37    35    37    37    38    36    38    33    38    32    38    33    38    33    39    34    39    32    38    31    38    32    39    32    39    32    39    32    39    31    38    31    38    29    38    27    36    26    35    25    34    19    30    15    17     6     6
  5   1   2                                         Xt7.1-TEgg048l06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGCGCGGCTCGGCTCGGAGGCTGCCCTGCCCGGGATGGAATGGGAAGAGAGCGGATACTTTGTATCAGTGTCTCCCGGAGAGTGAGGAAGTGAGAGCAGGAAGCGGCCGGCGCTGCCCCCTTCCCGGCTGCCTCCTTCCCGGCCAGAGGGAAACTTTGTGGGCTCAGTATGAGAGGATAAAGGCGGGGGCTGCCGGGATACAAAGTTTGCCTTGGGATGGCTTGAATGTGACCGGGGGGCGGCAGTGTGAGTGCAGCCGGGGGGCTGCCGGGGGCTCAGCATGGCCAAAGTCATTCAGAAGAAGAACCACTGGAGCAGCCGAGTGCACCGCTGCGCTGTGAGCTGTGTGGGGGAGCCGGGGGAGCCGGGGCTGCCGGTGCTGGGGGGCGCGGAGGATGGGGAGTTCCTGTACCTGGGGGGGGCGGCTGAGGGGCTGAGGTGCAGCGATGGCGAGCTGGCCGAGGGGGAGTTACTGCTGGAGGTGGCCGGGGTGCCCGTCTCTGGATTACCGCGATACGATGTACTGGAACTGGTCCGGAACAGCAAGCAGCCTGTCCCCATCACTGCTGTCAGACAAGGAAGCCGACTCAACAAGGACCTGAGGCATTATCTTAACCAAAGGTTTCAGAAAGCATCTCCAGACCACGAGCTACAGCAGATTATCCGAGATAATCTCTACCGCCATGCAGTGCCTTGCACCACCCGATCGCCAAGAGAAGGGGAGGTCCCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTTTAGAACTTGAAAAAAGTGGAACACTACTTGAAGTCGGCACATATGAAGGTAACTATTATGGGACGCCCAAGCCCCCGAGCCAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCCTGGAGAACCAATCTTCATAGGTCATATTGTGCCACTGGGGTCAGCGGATGCCGACGGGCGGTTGCGCTCTGGCGACGAGCTTATCTGTGTGGATGGAACAGCGGTTGTTGGAAAATCTCATCAACTCGTCGTACAGCTTATGCAACAGGCTGCGAAGCAAGGACACGTCAATCTAACGATCAGACGAAAAACCATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAACGGAGGAGAAGCGGACGCCCCAAGGCAGCCAAAACTCCTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGCGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCTG
  5   1   2                                            Xt7.1-CABG870.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCGGCGCTGCCCCCTTCCCGGCTGCCTCCTTCCCGGCCAGAGGGAAACTTTGTGGGCTCAGTATGAGAGGATAAAGGCGGGGGCTGCCGGGATACAAAGTTTGCCTTGGGATGGCTTGAATGTGACCGGGGGGCGGCAGTGTGAGTGCAGCCGGGGGGCTGCCGGGGGCTCAGCATGGCCAAAGTCATTCAGAAGAAGAACCACTGGAGCAGCCGAGTGCACCGCTGCGCTGTGAGCTGTGTGGGGGAGCCGGGGCTGCCGGTGCTGCCGGTGCTGGGGGGCGCGGAGGATGGGGAGTTCCTGTACCTGGGGGGGGCGGCTGAGGGGCTGAGGTGCAGCGATGGCGAGCTGGCCGAGGGGGAGTTACTGCTGGAGGTGGCCGGGGTGCCCGTCTCTGGATTACCGCGATACGATGTACTGGAACTGGTCCGGAACAGCAAGCAGCCTGTCCCCATCACTGCTGTCAGACAAGGAAGCCGACTCAACAAGGACCTGAGGCATTATCTTAACCAAAGGTTTCAGAAAGCATCTCCAGACCACGAGCTACAGCAGATTATCCGAGATAATCTCTACCGCCATGCAGTGCCTTGCACCACCCGATCGCCAAGAGAAGGGGAGGTCCCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTTTAGAACTTGAAAAAAGTGGAACACTACTTGAAGTCGGCACATATGAAGGTAACTATTATGGGACGCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTCCTTAGAAATAGACTGCAATTGACTTCTGCTAGCACTGACTGTTTTAACAAATGTGTGCTGCCGTCACTAACTGGGAAGGTTGGATCTAGGCCAATTCCGATAAGCCAAATCTGAGCCAAAATAATTTCTCTACTCTTATCTTTTTTTCCCCCCTTTTCAGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAGTATTTTTCGATGTATCTTTTTTAAGTTATTTGCCAAATGTCGACCCTAAAGAATTTAACCTGTTCTGCAACGAACTTATTTTATTGACTGTGTTCCAGCGGGAACGTGAGGATCCCGACACGTCTTCTCTAGAACACGTTTCCGGCACTGGACAGACCCACTGTTCCAAGTTTTTTTTTTCCCTTCGTAAACTTGATTTTTATGATTTCTGACTGTTAAATAGTGACCTATTACTACGGTTAATGTGTTTAAACATGGTGAGTCCGGTGGTGGGACCCTAAGCCAATGAATGGACATTTGTGAATGAAGAAGCGCTAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAAGGACGTAAAACAAGCACACATCGCACAAGGTGATTTTAATTGTCTTTTTATTTTAATTTTTTGTTGTGTGTGTGGGGGGGAGGGGGGGAATGTTGTATGACCACTCCTTTATTA
  5   1   2  SIG                                    Xt7.1-TNeu071c02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTACGCCATCACGCATTTTCTTGATGGAAACCCATCCGTGGGCCGATTTTTTTTTTTCATTTTTTCCCTAAAAACAAAAACACTATGCATATATCAATTCAACTTTTGTTCATACAGTAGCTTTATTTAACTTATGGGAGTCGATACGTCGATGACGTTTCCTTTGATTCAAGGTGATTGTGGACTTTGCCAGGACTGCTTCCTTGTGCGGAACAGAACACAAAGCCTATGTAGCTAGGAAAGCAAGTCTGTGAATGCTATTTTTATTATCAAATAAAGTTTTCAGTACAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                T---------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----T---T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------G--C-
                                               BLH ATG     189    1647                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH MIN     189     224                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH OVR     189    1282                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               ORF LNG     189     413                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 2e-007     FAA00131.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN -== Cs ==== 2e-008     BAA76285.1 CsENDO-3 [Ciona savignyi] ================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Sc ---- 7e-014     NP_011051.1 involved in ubiquitin-mediated protein degradation; Rsp5p [Saccharomycescerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Xl ---- 2e-020     AAR97566.1 frizzled-8 associated multidomain protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 2e-093     NP_611551.1 CG30388-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 5e-097     NP_502219.2 K01A6.2 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 8e-110     XP_001180066.1 PREDICTED: similar to MAGI-1, partial [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          AAI28639.1 Unknown (protein for MGC:146260) [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = ?? ==== 0          NP_001090712.1 hypothetical protein LOC100036692 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Gg ==== 0          XP_415974.2 PREDICTED: similar to membrane associated guanylate kinase, WW and PDZ domain containing 2 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 0          NP_001007064.1 BAI1-associated protein 1 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 0          NP_001025021.1 membrane associated guanylate kinase, WW and PDZ domain containing 1 isoform c [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_001028229.1 membrane associated guanylate kinase, WW and PDZ domain containing 1 isoform c [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZG52323.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGA---------------------------------------------------------------------------TGA------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---ATG------------------------TGA---------TAG---------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------ATG---------ATG---------------------TAA------------------------------------------TAG------------------------------ATG---------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------TAA---TAATGATAA---------------ATG---------------TAG------------------------------------------------ATG------------------------------------TGA------------------------------------TAG------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------TAA---------------------------------------------------------------------------------------------------------------ATG------------------------------------------TGA---------------------------TAA---------------------------------------------------------------------------------------------------TAA---TAA---------ATG------------TAA------TAA------------------------------------------------------------------------------------------------------------------------------------------TAA---ATG---------------ATG---------------------------------------------------------------------------------TAG------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   1         - Brn2      in                        CAAJ16838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAATCACCAGTGTCTTACCAACTCTTACGCTTGTACTGATTTTTTCTCTTTTCTTCGCTCCTCCTCTGCTTGCTTCTGTGGACTGGGTCTCAGAATGATGAGGAATGGTCAACGTAGCATCATTGGTGAAGGAAATCTAGAAAAAAAAAAAAAAAAACAAAAGCAAAAACTTGATCCTTTTGTTAAAACTATACTGCATTGAACTGTGCCAAACCATTTTTCATTATTTTGTATTAAAAAAAAACAAAAAAAAGTCCAAAAACTAAGGAACCACCAACTTATTAAACCCGATGTATGCATAATTCTTACCGGATGATGGGCGTTTGGTCGTCTTTCATATTTTGTGTGCACTGTAACGTTTGTGAAATGAAGAATTCCTGCTTTTTGGGCAGCGCCATATGAAGTATAGAGAAGCGGCGGCTTCTACGCCCCTTGACTCTTCGCCGATAGAACCGCCATTCCCAGCATTTTTCAAAGCTCTTTTGCAGAACGCTGGGAATCCTGTCTCCGCCTACAGGGTAGACGTTTTTTTTCTGCCATAAAGACTTCAAATTCTAAATGCTAAATTCTAAATTAGAGTACATTTATTTAAAGAGAACGGCTATAGTTATGGGGTATATTATCAGGGATAAAGGAAACATTCTATTTTATGTGAAAGTAACGATGTTCTAGATTAAAATGTATAATTAAAAAAAAAAGATGTTACGATGATTATGTCCTGTTTTACGACAGTTACCGAATCGCGCCCCGCTTGTTGAGGGCATTTTCCCAACCAAAGGTCTATGAAGTTTCTGTTTGGAACGTTTTTATTT
  5   1   2                                         Xt7.1-TEgg048l06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGCGCGGCTCGGCTCGGAGGCTGCCCTGCCCGGGATGGAATGGGAAGAGAGCGGATACTTTGTATCAGTGTCTCCCGGAGAGTGAGGAAGTGAGAGCAGGAAGCGGCCGGCGCTGCCCCCTTCCCGGCTGCCTCCTTCCCGGCCAGAGGGAAACTTTGTGGGCTCAGTATGAGAGGATAAAGGCGGGGGCTGCCGGGATACAAAGTTTGCCTTGGGATGGCTTGAATGTGACCGGGGGGCGGCAGTGTGAGTGCAGCCGGGGGGCTGCCGGGGGCTCAGCATGGCCAAAGTCATTCAGAAGAAGAACCACTGGAGCAGCCGAGTGCACCGCTGCGCTGTGAGCTGTGTGGGGGAGCCGGGGGAGCCGGGGCTGCCGGTGCTGGGGGGCGCGGAGGATGGGGAGTTCCTGTACCTGGGGGGGGCGGCTGAGGGGCTGAGGTGCAGCGATGGCGAGCTGGCCGAGGGGGAGTTACTGCTGGAGGTGGCCGGGGTGCCCGTCTCTGGATTACCGCGATACGATGTACTGGAACTGGTCCGGAACAGCAAGCAGCCTGTCCCCATCACTGCTGTCAGACAAGGAAGCCGACTCAACAAGGACCTGAGGCATTATCTTAACCAAAGGTTTCAGAAAGCATCTCCAGACCACGAGCTACAGCAGATTATCCGAGATAATCTCTACCGCCATGCAGTGCCTTGCACCACCCGATCGCCAAGAGAAGGGGAGGTCCCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTTTAGAACTTGAAAAAAGTGGAACACTACTTGAAGTCGGCACATATGAAGGTAACTATTATGGGACGCCCAAGCCCCCGAGCCAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGCCTGGAGAACCAATCTTCATAGGTCATATTGTGCCACTGGGGTCAGCGGATGCCGACGGGCGGTTGCGCTCTGGCGACGAGCTTATCTGTGTGGATGGAACAGCGGTTGTTGGAAAATCTCATCAACTCGTCGTACAGCTTATGCAACAGGCTGCGAAGCAAGGACACGTCAATCTAACGATCAGACGAAAAACCATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAACGGAGGAGAAGCGGACGCCCCAAGGCAGCCAAAACTCCTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGCGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCTG
                                                  Xt7.1-CHK-1008274216                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCTCGGCTCGGAGGCTGCCCTGCCCGGGATGGAATGGGAAGAGAGCGGATACTTTGTATCAGTGTCTCCCGGAGAGTGAGGAAGTGAGAGCAGGAAGCGGCCGGCGCTGCCCCCTTCCCGGCTGCCTCCTTCCCGGCCAGAGGGAAACTTTGTGGGCTCAGTATGAGAGGATAAAGGCGGGGGCTGCCGGGATACAAAGTTTGCCTTGGGATGGCTTGAATGTGACCGGGGGGCGGCAGTGTGAGTGCAGCCGGGGGGCTGCCGGGGGCTCAGCATGGCCAAAGTCATTCAGAAGAAGAACCACTGGAGCAGCCGAGTGCACCGCTGCGCTGTGAGCTGTGTGGGGGAGCCGGGGGAGCCGGGGCTGCCGGTGCTGGGGGGCGCGGAGGATGGGGAGTTCCTGTACCTGGGGGGGGCGGCTGAGGGGCTGAGGTGCAGCGATGGCGAGCTGGCCGAGGGGGAGTTACTGCTGGAGGTGGCCGGGGTGCCCGTCTCTGGATTACCGCGATACGATGTACTGGAACTGGTCCGGAACAGCAAGCAGCCTGTCCCCATCACTGCTGTCAGACAAGGAAGCCGACTCAACAAGGACCTGAGGCATTATCTTAACCAAAGGTTTCAGAAAGCATCTCCAGACCACGAGCTACAGCAGATTATCCGAGATAATCTCTACCGCCATGCAGTGCCTTGCACCACCCGATCGCCAAGAGAAGGGGAGGTCCCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTTTAGAACTTGAAAAAAGTGGAACACTACTTGAAGTCGGCACATATGAAGGTAACTATTATGGGACGCCCAAGCCCCCGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGAACCAATCTTCATAGGTCATATTGTGCCACTGGGGTCAGCGGATGCCGACGGGCGGTTGCGCTCTGGCGACGAGCTTATCTGTGTGGATGGAACAGCGGTTGTTGGAAAATCTCATCAACTCGTCGTACAGCTTATGCAACAGGCTGCGAAGCAAGGACACGTCAATCTAACGATCAGACGAAAAACCATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAACGGAGGAGAAGCGGACGCCCCAAGGCAGCCAAAACTCCTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGCGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGT
  5   1   1       add Egg  5g3  in                   TEgg052b03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGCGCGGCTCGGCTCGGAGGCTGCCCTGCCCGGGATGGAATGGGAAGAGAGCGGATACTTTGTATCAGTGTCTCCCGGAGAGTGAGGAAGTGAGAGCAGGAAGCGGCCGGCGCTGCCCCCTTCCCGGCTGCCTCCTTCCCGGCCAGAGGGAAACTTTGTGGGCTCAGTATGAGAGGATAAAGGCGGGGGCTGCCGGGATACAAAGTTTGCCTTGGGATGGCTTGAATGTGACCGGGGGGCGGCAGTGTGAGTGCAGCCGGGGGGCTGCCGGGGGCTCAGCATGGCCAAAGTCATTCAGAAGAAGAACCACTGGAGCAGCCGAGTGCACCGCTGCGCTGTGAGCTGTGTGGGGGAGCCGGGGCTGCCGGTGCTGCCGGTGCTGGGGGGCGCGGAGGATGGGGAGTTCCTGTACCTGGGGGGGGCGGCTGAGGGGCTGAGGTGCAGCGATGGCGAGCTGGCCGAGGGGGAGTTACTGCTGGAGGTGGCCGGGGTGCCCGTCTCTGGATTACCGCGATACGATGTACTGGAACTGGTCCGGAACAGCAAGCAGCCTGTCCCCATCACTGCTGTCAGACAAGGAAGCCGACTCAACAAGGACCTGAGGCATTATCTTAACCAAAGGTTTCAGAAAGCATCTC
  5   1   4      seed Egg       in                   TEgg048l06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGAGCAGGAAGCGGCCGGCGCTGCCCCCTTCCCGGCTGCCTCCTTCCCGGCCAGAGGGAAACTTTGTGGGCTCAGTATGAGAGGATAAAGGCGGGGGCTGCCGGGATACAAAGTTTGCCTTGGGATGGCTTGAATGTGACCGGGGGGCGGCAGTGTGAGTGCAGCCGGGGGGCTGCCGGGG
  3   1   2       ext Brn3 5g3  in                          CAAK391.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGAGCCTGGAGAACCAATCTTCATAGGTCATATTGTGCCACTGGGGTCAGCGGATGCCGACGGGCGGTTGCGCTCTGGCGACGAGCTTATCTGTGTGGATGGAACAGCGGTTGTTGGAAAATCTCATCAACTCGTCGTACAGCTTATGCAACAGGCTGCGAAGCAAGGACACGTCAATCTAACGATCAGACGAAAAACCATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAACGGAGGAGAAGCGGACGCCCCAAGGCAGCCAAAACTCCTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGCGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTTGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCC
  5   1   3        nb Gas7                                  XZG9000.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAATCTTCATAGGTCATATTGTGCCACTGGGGTCAGCGGATGCCGACGGGCGGTTGCGCTCTGGCGACGAGCTTATCTGTGTGGATGGAACAGCGGTTGTTGGAAAATCTCATCAACTCGTCGTACAGCTTATGCAACAGGCTGCGAAGCAAGGACACGTCAATCTAACGATCAGACGAAAAACCATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAACGGAGGAGAAGCGGACGCCCCAAGGCAGCCAAAACTCCTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGCGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGG
  5   1   2       ext Gas8                                   st2c16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAACTCCTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGTGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGG
  3   1   4      seed Egg       in                    TEgg048l06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATCCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCTGAGAAAAAAAAAAAAAAAAAA
  5   1   2                                            Xt7.1-CABG870.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCGGCGCTGCCCCCTTCCCGGCTGCCTCCTTCCCGGCCAGAGGGAAACTTTGTGGGCTCAGTATGAGAGGATAAAGGCGGGGGCTGCCGGGATACAAAGTTTGCCTTGGGATGGCTTGAATGTGACCGGGGGGCGGCAGTGTGAGTGCAGCCGGGGGGCTGCCGGGGGCTCAGCATGGCCAAAGTCATTCAGAAGAAGAACCACTGGAGCAGCCGAGTGCACCGCTGCGCTGTGAGCTGTGTGGGGGAGCCGGGGCTGCCGGTGCTGCCGGTGCTGGGGGGCGCGGAGGATGGGGAGTTCCTGTACCTGGGGGGGGCGGCTGAGGGGCTGAGGTGCAGCGATGGCGAGCTGGCCGAGGGGGAGTTACTGCTGGAGGTGGCCGGGGTGCCCGTCTCTGGATTACCGCGATACGATGTACTGGAACTGGTCCGGAACAGCAAGCAGCCTGTCCCCATCACTGCTGTCAGACAAGGAAGCCGACTCAACAAGGACCTGAGGCATTATCTTAACCAAAGGTTTCAGAAAGCATCTCCAGACCACGAGCTACAGCAGATTATCCGAGATAATCTCTACCGCCATGCAGTGCCTTGCACCACCCGATCGCCAAGAGAAGGGGAGGTCCCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTTTAGAACTTGAAAAAAGTGGAACACTACTTGAAGTCGGCACATATGAAGGTAACTATTATGGGACGCCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGTCCTTAGAAATAGACTGCAATTGACTTCTGCTAGCACTGACTGTTTTAACAAATGTGTGCTGCCGTCACTAACTGGGAAGGTTGGATCTAGGCCAATTCCGATAAGCCAAATCTGAGCCAAAATAATTTCTCTACTCTTATCTTTTTTTCCCCCCTTTTCAGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAGTATTTTTCGATGTATCTTTTTTAAGTTATTTGCCAAATGTCGACCCTAAAGAATTTAACCTGTTCTGCAACGAACTTATTTTATTGACTGTGTTCCAGCGGGAACGTGAGGATCCCGACACGTCTTCTCTAGAACACGTTTCCGGCACTGGACAGACCCACTGTTCCAAGTTTTTTTTTTCCCTTCGTAAACTTGATTTTTATGATTTCTGACTGTTAAATAGTGACCTATTACTACGGTTAATGTGTTTAAACATGGTGAGTCCGGTGGTGGGACCCTAAGCCAATGAATGGACATTTGTGAATGAAGAAGCGCTAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAAGGACGTAAAACAAGCACACATCGCACAAGGTGATTTTAATTGTCTTTTTATTTTAATTTTTTGTTGTGTGTGTGGGGGGGAGGGGGGGAATGTTGTATGACCACTCCTTTATTA
                                                  Xt7.1-CHK-1008274224                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGCCCCCTTCCCGGCTGCCTCCTTCCCGGCCAGAGGGAAACTTTGTGGGCTCAGTATGAGAGGATAAAGGCGGGGGCTGCCGGGATACAAAGTTTGCCTTGGGATGGCTTGAATGTGACCGGGGGGCGGCAGTGTGAGTGCAGCCGGGGGGCTGCCGGGGGCTCAGCATGGCCAAAGTCATTCAGAAGAAGAACCACTGGAGCAGCCGAGTGCACCGCTGCGCTGTGAGCTGTGTGGGGGAGCCGGGGCTGCCGGTGCTGCCGGTGCTGGGGGGCGCGGAGGATGGGGAGTTCCTGTACCTGGGGGGGGCGGCTGAGGGGCTGAGGTGCAGCGATGGCGAGCTGGCCGAGGGGGAGTTACTGCTGGAGGTGGCCGGGGTGCCCGTCTCTGGATTACCGCGATACGATGTACTGGAACTGGTCCGGAACAGCAAGCAGCCTGTCCCCATCACTGCTGTCAGACAAGGAAGCCGACTCAACAAGGACCTGAGGCATTATCTTAACCAAAGGTTTCAGAAAGCATCTCCAGACCACGAGCTACAGCAGATTATCCGAGATAATCTCTACCGCCATGCAGTGCCTTGCACCACCCGATCGCCAAGAGAAGGGGAGGTCCCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTTTAGAACTTGAAAAAAGTGGAACACTACTTGAAGTCGGCACATATGAAGGTAACTATTATGGGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTTATGTCCTTAGAAATAGACTGCAATTGACTTCTGCTAGCACTGACTGTTTTAACAAATGTGTGCTGCCGTCACTAACTGGGAAGGTTGGATCTAGGCCAATTCCGATAAGCCAAATCTGAGCCAAAATAATTTCTCTACTCTTATCTTTTTTTCCCCCCTTTTCAGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAGTATTTTTCGATGTATCTTTTTTAAGTTATTTGCCAAATGTCGACCCTAAAGAATTTAACCTGTTCTGCAACGAACTTATTTTATTGACTGTGTTCCAGCGGGAACGTGAGGATCCCGACACGTCTTCTCTAGAACACGTTTCCGGCACTGGACAGACCCACTGTTCCAAGTTTTTTTTTTCCCTTCGTAAACTTGATTTTTATGATTTCTGACTGTTAAATAGTGACCTATTACTACGGTTAATGTGTTTAAACATGGTGAGTCCGGTGGTGGGACCCTAAGCCAATGAATGGACATTTGTGAATGAAGAAGCGCTAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAAGGACGTAAAACAAGCACACATCGCACAAGGTGATTTTAATTGTCTTTTTATTTTAATTTTTTGTTGTGTGTGTGGGGGGGAGGGGGGGAATGTTGTATGACCACTCCTTTATTATTTTTT
  5   1   4      seed Te3  5g3  in                        CAAM16384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCGGCGCTGCCCCCTTCCCGGCTGCCTCCTTCCCGGCCAGAGGGAAACTTTGTGGGCTCAGTATGAGAGGATAAAGGCGGGGGCTGCCGGGATACAAAGTTTGCCTTGGGATGGCTTGAATGTGACCGGGGGGCGGCAGTGTGAGTGCAGCCGGGGGGCTGCCGGGGGCTCAGCATGGCCAAAGTCATTCAGAAGAAGAACCACTGGAGCAGCCGAGTGCACCGCTGCGCTGTGAGCTGTGTGGGGGAGCCGGGGCTGCCGGTGCTGCCGGTGCTGGGGGGCGCGGAGGATGGGGAGTTCCTGTACCTGGGGGGGGCGGCTGAGGGGCTGAGGTGCAGCGATGGCGAGCTGGCCGAGGGGGAGTTACTGCTGGAGGTGGCCGGGGTGCCCGTCTCTGGATTACCGCGATACGATGTACTGGAACTGGTCCGGAACAGCAAGCAGCCTGTCCCCATCACTGCTGTCAGACAAGGAAGCCGACTCAACAAGGACCTGAGGCATTATCTTAACCAAAGGTTTCAGAAAGCATCTCCAGACCACGAGCTACAGCAGATTATCCGAGATAATCTCTACCGCCATGCAGTGCCTTGCACCACCCGATCGCCAAGAGAAGGGGAGGTCCCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTTTAGAACTTGAAAAAAGTGGAACACTACTTGAAGTCGGCACATATGAAGGTAACTATTATGGGACGCCCAAG
  5   1   2       ext Sto1      in                          CABG870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCCATTTTATGTCCTTAGAAATAGACTGCAATTGACTTCTGCTAGCACTGACTGTTTTAACAAATGTGTGCTGCCGTCACTAACTGGGAAGGTTGGATCTAGGCCAATTCCGATAAGCCAAATCTGAGCCAAAATAATTTCTCTACTCTTATCTTTTTTTCCCCCCTTTTCAGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGANAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTG
  3   1   4      seed Te3  5g3  in                        CAAM16384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGT
  3   1   2       ext Sto1      in                          CABG870.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAGTATTTTTCGATGTATCTTTTTTAAGTTATTTGCCAAATGTCGACCCTAAAGAATTTAACCTGTTCTGCAACGAACTTATTTTATTGACTGTGTTCCAGCGGGAACGTGAGGATCCCGACACGTCTTCTCTAGAACACGTTTCCGGCACTGGACAGACCCACTGTTCCAAGTTTTTTTTTTCCCTTCGTAAACTTGATTTTTATGATTTCTGACTGTTAAATAGTGACCTATTACTACGGTTAATGTGTTTAAACATGGTGAGTCCGGTGGTGGGACCCTAAGCCAATGAATGGACATTTGTGAATGAAGAAGCGCTAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAAGGACGTAAAACAAGCACACATCGCACAAGGTGATTTTAATTGTCTTTTTATTTTAATTTTTTGTTGTGTGTGTGGGGGGGAGGGGGGGAATGTTGTATGACCACTCCTTTATTATTTTTT
  0   1   1           Neu  FLt3                   TNeu028p22.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGCTCTCAATACACCACATTGGCTGAGCTCTCTCAATGGGCAAGAGGACCTATTGGCAGTGCCTGTAGGCTGGCTAACGAGAGGAAGCAGTGGCTGGCACCACCCGATCGCCAAGAGAAGGGGAGGTCCCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTTTAGAACTTGAAAAAAGTGGAACACTACTTGAAGTCGGCACATATGAAGGTAACTATTATGGGACGCCCAAGCCCCCGAGCCAGCCCACCAGTGGGAAAGTGATTTCCAGGGATGCTCTGCAAAACCCTCTGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCATACCGACCACTATGAGTTTGATGATGATGCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACACGATTAACCTTTCCCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCAGAATCTGCCTCATTACCTACCTCCTGACGAGGAAAGCCTTGGACCTCTACCTGATAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCATAACACTAAAACGACATCTTGGTTAGACCCCCGGTGCCTGAACAAACAGCAGAAGCCTCTGGAAGAATGTGAAGATGATGAATTGCCCGCTGGATGGGAGAAAATTGAAGACCCGGTTTATGGAGTCTACTATGTAGATCACATAAACAAGAAAACGCAGTATGAAAATCCTGTATTGGAGGCCAAACGAAAGAAACAGCTTGGACAGCAGCAAAGTGAAGAATGGACAGGGGACCATCCAACCATTGCTCCGCCCCCCATAATGCTTCCTAACAACCTTACTCCAAAAAAAAAAAAAAAAAA
  5   1   2       ext Egg  5g3  in                   TEgg058c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCGCTCAGTGAGGGGGACAGTGGGACTGGGCTAGCTCCTTGCATTCCCTGCAAGCCCGGCTCTCAATACACCACATTGGCTGAGCTCTCTCAATGGGCAAGAGGACCTATTGGCAGTGCCTGTAGGCTGGCTAACGAGAGGAAGCAGTGGCTGGCACCACCCGATCGCCAAGAGAAGGGGAGGTCCCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTTTAGAACTTGAAAAAAGTGGAACACTACTTGAAGTCGGCACATATGAAGGTAACTATTATGGGACGCCCAAGCCCCCGAGCCAGCCCACCAGTGGGAAAGTGATTTCCAGGGATGCTCTGCAAAACCCTCTGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCATACCGACCACTATGAGTTTGATGATGATGCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACACGATTAACCTTTCCCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCAGAATCTGCCTCATTACCTACCTCCTGACGAGGAAAGCCTTGGACCTCTACCT
  5   1   2       ext Neu  FLt3                      TNeu028p22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTCAATACACCACATTGGCTGAGCTCTCTCAATGGGCAAGAGGACCTATTGGCAGTGCCTGTAGGCTGGCTAACGAGAGGAAGCAGTGGCTGGCACCACCCGATCGCCAAGAGAAGGGGAGGTCCCGGGAGTGGACTATAAATTTCTGACTGTGCAGGAGTTTTTAGAACTTGAAAAAAGTGGAACACTACTTGAAGTCGGCACATATGAAGGTAACTATTATGGGACGCCCAAGCCCCCGAGCCAGCCCACCAGTGGGAAAGTGATTTCCAGGGATGCTCTGCAAAACCCTCTGGCCGGCTCCAAGCAGTCGACTCCCAAGCGAACAAAGTCTTACAATGATATGCAAAATGCAGGCGTAGTGCATACCGACCACTATGAGTTTGATGATGATGCTCCTGAAATGAGCAGTAGCTTTACAGGAGACTCCAGTGAAGCAGACGAGCACACGATTAACCTTTCCCAAGATAAAGTCCCACCGGCGGCTCGGATACTCCCTACTTTTCCCATCACGGAAGCTTCTCAGAATCTGCCTCATTACCTACCTCCTGACGAGGAAAGCCTTGGACCTCTACCTGATAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCATAACACTAAAACGACATCTTGGTTAGACCCCCGGTGCCTGA
  5   1   2       ext Egg                            TEgg082l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGGGCCCGGGGGACGAGGAAAGCCTTGGACCTCTACCTGATAACTGGGAAATGGCCTTTACAGAGAATGGAGAAGTCTATTTTATAGACCATAACACTAAAACGACATCTTGGTTAGACCCCCGGTGCCTGAACAAACAGCAGAAGCCTCTGGAAGAATGTGAAGATGATGAAGGGGTACACACCGAGGAACTGGACAGTGAACTAGAATTGCCCGCTGGATGGGAGAAAATTGAAGACCCGGTTTATGGAGTCTACTATGTAGATCACATAAACAAGAAAACGCAGTATGAAAATCCTGTATTGGAGGCCAAACGAAAGAAACAGCTTGGACAGCAGCAAAGTGAAGAATGGACAGGGGACCATCCAACCATTGCTCCGCCCCCCATAATGCTTCCTAACAACCTTACTCCAAAAAAGAAGGAACCAGCAAGAGAAACGGCATCACATGTGAAACCGTTCTTCACCAGGAACCCCTCTGAACTGAAAGGCAAGTTCATCCATACGAAGCTAAGGAAAAGTAGTCGGGGCTTTGGCTTTACCGTTGTCGGAGGGGACGAACCAGATGAGTTCTTGCAAATAAAAAGTTTGGTCGTCGACGGTCCGGCCGCGTTGGACGGCAAAATGGAAACGGGTGATG
  5   1   4      seed Egg       in                   TEgg048k19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAACTGGACAGTGAACTAGAATTGCCCGCTGGATGGGAGAAAATTGAAGACCCGGTTTATGGAGTCTACTATGTAGATCACATAAACAAGAAAACGCAGTATGAAAATCCTGTATTGGAGGCCAAACGAAAGAAACAGCTTGGACAGCAGCAAAGTGAAGAATGGACAGGGGACCATCCAACCATTGCTCCGCCCCCCATAATGCTTCCTAACAACCTTACTCCAAAAAAGAAGGAACCAGCAAGAGAAACGGCATCACATGTGAAACCGTTCTTCACCAGGAACCCCTCTGAACTGAAAGGCAAGTTCATCCATACGAAGCTAAGGAAAAGTAGTCGGGGCTTTGGCTTTACCGTTGTCGGAGGGGACGAACCAGATGAGTTCTTGCAAATAAAAAGTTTGGTCGTCGACGGTCCGGCCGCGTTGGACGGCAAAATGGAAACGGGTGATGTTATCGTTAGCGTGAACGATATCTGCGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGGGAAAGTGTGGACCTTGAACTATGCCGGGGTTATCCTCTTCCGTTTGACCCAGATGACCCCAACACCAGCCTTGTGACATCAGTTGCAATATTGGACAAAGACCCTATCATTGTCAATGGGCA
  5   1   3        nb Gas8      in                          st66j12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCGGGGCTTTGGCTTTACCGTTGTCGGAGGGGACGAACCAGATGAGTTCTTGCAAATAAAAAGTTTGGTCGTCGACGGTCCGGCCGCGTTGGACGGCAAAATGGAAACGGGTGATGTTATCGTTAGCGTGAACGATATCTGCGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGGGAAAGTGTGGACCTTGAACTATGCCGGGGTTATCCTCTTCCGTTTGACCCAGATGACCCCAACACCAGCCTTGTGACATCAGTTGCAATATTGGACAAAGACCCTATCATTGTCAATGGGCAAGAGAATTATGACTCTCCGTCGAGCAACAGCAGTAAAACTAGAAAAGCCAATAACGTCAAGGATCCAAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGTCCTGGCGGTGGGGGCCAGAGAGTGAAGCAGATTGTAGATAGTCCAAGATGCCGGGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAATGTTCAGAACCTTACCCATAACCAAGTTGTGGATTTACTCATCGAATGTCCTAA
  5   1   3        nb Gas8      in                          st65j12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGGGGCTTTGGCTTTACCGTTGTCGGAGGGGACGAACCAGATGAGTTCTTGCAAATAAAAAGTTTGGTCGTCGACGGTCCGGCCGCGTTGGACGGCAAAATGGAAACGGGTGATGTTATCGTTAGCGTGAACGATATCTGCGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGGGAAAGTGTGGACCTTGAACTATGCCGGGGTTATCCTCTTCCGTTTGACCCAGATGACCCCAACACCAGCCTTGTGACATCAGTTGCAATATTGGACAAAGACCCTATCATTGTCAATGGGCAAGAGAATTATGACTCTCCGTCGAGCAACAGCAGTAAAACTAGAAAAGCCAATAACGTCAAGGATCCAAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGTCCTGGCGGTGGGGGCCAGAGAGTGAAGCAGATTGTAGATAGTCCAAGATGCCGGGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAATGTTCAGAACCTTACCCATAACCAAGTTGTGGATTTACTCATCGAATGTCCTA
  5   1   3        nb Tad5      in                         XZT28398.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGACGCGTGGGTTGCAAATAAAAAGTTTGGTCGTCGACGGTCCGGCCGCGTTGGACGGCAAAATGGAAACGGGTGATGTTATCGTTAGCGTGAACGATATCTGCGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGGGAAAGTGTGGACCTTGAACTATGCCGGGGTTATCCTCTTCCGTTTGACCCAGATGACCCCAACACCAGCCTTGTGACATCAGTTGCAATATTGGACAAAGACCCTATCATTGTCAATGGGCAAGAGAATTATGACTCTCCGTCGAGCAACAGCAGTAAAACTAGAAAAGCCAATAACGTCAAGGATCCAAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGTCCTGGCGGTGGGGGCCAGAGAGTGAAGCAGATTGTAGATAGTCCAAGATGCCGGGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAATGTTCAGAACCTTACCCATAACCAAGTTGTGGATTTACTCATCGAATGTCCTAAGGGAAGCGAAGTTACCCTACTGGTTCAAAGAGGAGGACTCCCGGTCCCAAAGAAGAGCCCAAAGTCGCAACCACTTGAAAGGAAAGACAG
  3  -1   2       ext Int1      in                         CAAP1833.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAAAATGGAAACGGGTGATGTTATCGTTAGCGTGAACGATATCTGCGTCCTTGGCTACACGCACGCTCAAGTTGTGAAGATCTTCCAGTCTATACCCATTGGGGAAAGTGTGGACCTTGAACTATGCCGGGGTTATCCTCTTCCGTTTGACCCAGATGACCCCAACACCAGCCTTGTGACATCAGTTGCAATATTGGACAAAGACCCTATCATTGTCAATGGGCAAGAGAATTATGACTCTCCGTCGAGCAACAGCAGTAAAACTAGAAAAGCCAATAACGTCAAGGATCCAAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGTCCTGGCGGTGGGGGCCAGAGAGTGAAGCAGATTGTAGATAGTCCAAGATGCCGGGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAATGTTCAGAACCTTACCCATAACCAAGTTGTGGATTTACTCATCGAATGTCCTAAGGGAAGCGAAGTTACCCTACTGGTTCAAAGAGGAGGACTCCCGGTCCCAAAGAAGAGCCCAAAGTCGCAACCACTTGAAAGGAAAGACAGCCAAAACAGCTCGCAGCACAGTGTTTCCAGCCAGCACAGTGGGCACACTGCTTCACCCCATCACGCCGCGCCTGGGCTCCCCGATTATCCTACCAGCGAGGCGCCGGCTGTCGACAAAGCCGACAACTCCGGGC
  5   1   3        nb Egg       in                   TEgg035h24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGATCTTCCAGTCTATACCCATTGGGGAAAGTGTGGACCTTGAACTATGCCGGGGTTATCCTCTTCCGTTTGACCCAGATGACCCCAACACCAGCCTTGTGACATCAGTTGCAATATTGGACAAAGACCCTATCATTGTCAATGGGCAAGAGAATTATGACTCTCCGTCGAGCAACAGCAGTAAAACTAGAAAAGCCAATAACGTCAAGGATCCAAGGCCTAGCAGCCCTGCTGACATTTCTTCAAATGGTTCCCATGGTTACCCTAATGATACAGTGTCCTTGGCATCCTCTATAGCTACGCAACCTGAACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGTCCTGGCGGTGGGGGCCAGAGAGTGAAGCAGATTGTAGATAGTCCAAGATGCCGGGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAATGTTCAGAACCTTACCCATAACCAAGTTGTGGATTTACTCATCGAATGTCCTAAGGGAAGCGAAGTTACCCTACTGGTTCAAAGAGGAGGACTCCCGGTCCCAAAGAAGAGCCCAAAGTCGCAACCACTTGAAAGGAAAGACAGCCAAAACAGCTCGCAGCACAGTGTTTC
  5   1   2       add Gas6      in                         ANBT1099.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTAAAGGACTAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGTCCTGGCGGTGGGGGCCAGAGAGTGAAGCAGATTGTAGATAGTCCTAGATGCCGGGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAATGTTCAGAACCTTACCCATAACCAAGTTGTGGATTTACTCATCGAATGTCCTAAGGGAAGCGAAGTTACCCTACTGGTTCAAAGAGGAGGACTCCCGGTCCCAAAGAAGAGCCCAAAGTCGCAACCACTTGAAAGGAAAGACAGCCAAAACAGCTCGCAGCACAGTGTTTCCAGCCAGCACAGTGGGCACACTGCTTCACCCCATCACGCCGCGCCTGGGCTCCCCGATTATCCTACCAGCGAGGCGCCGGCTGTCGACCAAGCCGACAACTCCGGGCAGAAAAAGCCTGATCCTTTCAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTCGGTGGAAATGAGCCTGGAGAACCAATCTTCATAGGTCATATTGTGCCACTGGGGTCAGCGGATGCCGACGGGCGGTTGCGCTCTGGTGACGAGCTTATCTGTGTGGATGGAACAGCGGTTGTTGGAAAATCTCATCAACTCGTCGTACAGCTTATGCAACAGGCTGCGAAGCAAGGACACGTCAATCTAACGATCAGACGAAAAACGATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAAC
  5   1   2       ext Egg       in                   TEgg044l11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGGGAATTACTGTGCATATAGTAAAAGGACCAATGGGATTTGGCTTTACCATAGCAGACAGTCCTGGCGGTGGGGGCCAGAGAGTGAAGCAGATTGTAGATAGTCCAAGATGCCGGGGCCTCAAAGAAGGAGATCTTATAGTAGAGGTGAATAAAAAGAATGTTCAGAACCTTACCCATAACCAAGTTGTGGATTTACTCATCGAATGTCCTAAGGGAAGCGAAGTTACCCTACTGGTTCAAAGAGGAGGACTCCCGGTCCCAAAGAAGAGCCCAAAGTCGCAACCACTTGAAAGGAAAGACAGCCAAAACAGCTCGCAGCACAGTGTTTCCAGCCAGCACAGTGGGCACACTGCTTCACCCCATCACGCCGCGCCTGGGCTCCCCGATTATCCTACCAGCGAGGCGCCGGCTGTCGACCAAGCCGACAACTCCGGGCAGAAAAAGCCTGATCCTTTCAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTCGGTGGAAATGAGCCTGGAGAACCAATCTTCATAGGTCATATTGTGCCACTGGGGTCAGCGGATGCCGACGGGCGGTTGCGCTCT
  5   1   2       add Te4       in                         CAAN3071.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCGTATAAACAGACTGCTGCTAACTCGCAATGCTGAAGCGGCGCTGGCTCTTGCAGCACAGATGGCTACATTAGGAATGATCTACCTTGGGATTTTTCTCAGATGAACGTGGCATTTCCATGCTAATCATTATTTCTCCCTTGTTGCTGTTTTCCAGGACTCCCGGTCCCAAAGAAGAGCCCAAAGTCGCAACCACTTGAAAGGAAAGACAGCCAAAACAGCTCGCAGCACAGTGTTTCCAGCCAGCACAGTGGGCACACTGCTTCACCCCATCACGCCGCGCCTGGGCTCCCCGATTATCCTACCAGCGAGGCGCCGGCTGTCGACCAAGCCGACAACTCCGGGCAGAAAAAGCCTGATCCTTTCAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTCGGTGGAAATGAGCCTGGAGAACCAATCTTCATAGGTCATATTGTGCCACTGGGGTCAGCGGATGCCGACGGGCGGTTGCGCTCTGGTGACGAGCTTATCTGTGTGGATGGAACAGCGGTTGTTGGAAAATCTCATCAACTCGTCGTACAGCTTATGCAACAGGCTGCGAAGCAAGGACACGTCAATCTAACGATCAGACGAAAAACGATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCCGCGTCTCTAAC
  5   1   2       ext Tad5      in                         XZT69611.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCGCAACCACTTGAAAGGAAAGACAGCCAAAACAGCTCGCAGCACAGTGTTTCCAGCCAGCACAGTGGGCACACTGCTTCACCCCATCACGCCGCGCCTGGGCTCCCCGATTATCCTACCAGCGAGGCGCCGGCTGTCGACCAAGCCGACAACTCCGGGCAGAAAAAGCCTGATCCTTTCAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTCGGTGGAAATGAGCCTGGAGAACCAATCTTCATAGGTCATATTGTGCCACTGGGGTCAGCGGATGCCGACGGGCGGTTGCGCTCTGGTGACGAGCTTATCTGTGTGGATGGAACAGCGGTTGTTGGAAAATCTCATCAACTCGTCGTACAGCTTATGCAACAGGCTGCGAAGCAAGGACACGTCAATCTAACGATCAGACGAAAAACCATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAACGGAGGAGAAGCGGACGCCCCAAGGCAGCCAAAACTCCTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGCGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGCCGGCAATGCATGTGTGGCCATGC
  5   1   2       add Brn3      in                         CAAK1187.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCCAGCACAGTGGGCACACTGCTTCACCCCATCACGCCGCGCCTGGGCTCCCCGATTATCCTACCAGCGAGGCGCCGGCTGTCGACCAAGCCGACAACTCCGGGCAGAAAAAGCCTGATCCTTTCAAAATCTGGGCCCAATCCAGGAGCATGTATGAGAACAGACTTCCAGACTTTCAAGAGCATGATATATTTTTGTGGCGAAAGGAAACTGGATTTGGGTTTCGAATTCTCGGTGGAAATGAGCCTGGAGAACCAATCTTCATAGGTCATATTGTGCCACTGGGGTCAGCGGATGCCGACGGGCGGTTGCGCTCTGGTGACGAGCTTATCTGTGTGGATGGAACAGCGGTTGTTGGAAAATCTCATCAACTCGTCGTACAGCTTATGCAACAGGCTGCGAAGCAAGGACACGTCAATCTAACGATCAGACGAAAAACGATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAACGGAGGAGAAGCGGACGCCCCAAGGCAGCCAAAACTCCTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGTGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGCCGGCAATGCATGTGTGGCCATGCCTCACAAAATAGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGNGGGACCGGATCTTGGCCGTTAAACGGGTGCTCCATCA
  5   1   0       chi Egg                            TEgg142i22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTTTTTTTTTTTTAAAGGACAAAAAGATACTTTCCCTGTTGCGTTACGTTAAGTGTTTGTACCTCAGTTTTCAGATCATGCAGAATATTTAATAGTGGTTCACATGCAAGAAGAGATGAGTTTAAATACGTATTTACGAAGAGCGCTATGGCAAATAGGGCTGCCCGCGAAGATCAGAAGCATGGACACGTCAATCTAACGATCAGACGAAAAACCATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAACGGAGGAGAAGCGGACGCCCCAAGGCAGCCAAAACTCCTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGCGGCGGAGGCGGCGGGAGCGGCAACTAAGCACCGTGGTTCAGCCGTAGGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGCCGGCAATGCATGTGTGGCCATGCCTCACAAAATAGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCT
  3   1   3        nb Gas8      in                          st65j12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTTCATAGGTCATATTGTGCCACTGGGGTCAGCGGATGCCGACGGGCGGTTGCGCTCTGGTGACGAGCTTATCTGTGTGGATGGAACAGCGGTTGTTGGAAAATCTCATCAACTCGTCGTACAGCTTATGCAACAGGCTGCGAAGCAAGGACACGTCAATCTAACGATCAGACGAAAAACGATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAACGGAGGAGAAGCGGACGCCCCAAGGCAGCCAAAACTCCTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGTGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGCCGGCAATGCATGTGTGGCCATGCCTCACAAAATAGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATGC
  3   1   3        nb Gas8      in                          st66j12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTCATAGGTCATATTGTGCCACTGGGGTCAGCGGATGCCGACGGGCGGTTGCGCTCTGGTGACGAGCTTATCTGTGTGGATGGAACAGCGGTTGTTGGAAAATCTCATCAACTCGTCGTACAGCTTATGCAACAGGCTGCGAAGCAAGNACACGTCAATCTAACGATCAGACGAAAAACGATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAACGGAGGAGAAGCGGACGCCCCAAGGCAGCCAAAACTCNTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGTGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGCCGGCAATGCATGTGTGGCCATGCCTCACAAAATAGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATNTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGA
  3   1   2       add Egg  5g3  in                    TEgg052b03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGCGGATGCCGACGGGCGGTTGCGCTCTGGTGACGAGCTTATCTGTGTGGATGGAACAGCGGTTGTGNGAAAATCTCATCNAACTCGTCGTACAGCTTATGCAACAGGCTGCGAAGCAAGGACACGTCAATCTAACGATCAGACGAAAAACGATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCTTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAACGGAGGAGAAGCGGACGCCCCAAGGCAGCCAAAACTCCTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGTGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGCCGGCAATGCATGTGTGGCCATGCCTCACAAAATAGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAAAAAAAAAAAAAA
  5   1   3        nb Egg                            TEgg083c23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGACACGTCAATCTAACGATCAGACGAAAAACGATCTATCCGGTTCCAAAGGCAGAGAACGAAGCTCCTGCATCACCAGCATCCTCGCACCATAGCAGCACCCAGCCGGCGTCTCTAACGGAGGAGAAGCGGACGCCCCAAGGCAGCCAAAACTCCTTAAACACTGTCAGTTCAGGGCAGCGGCAGCACCAGCGGCATTGGCAGTGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTCG
  5  -1   2       add Egg       in                   TEgg065k10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAACTCCTTAAACACTGTCAGTTCAGGCAGCGGCAGCACCAGCGGCATTGGCAGTGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCACCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGCCGGCAATGCATGTGTGGCCATGCCTCACAAAATAGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGCCCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCCCATCGTTCCCCCAAAAAAAAAAAAAAAAAAGCCGTCTTCCGCAAT
  3   1   2       add HdA                             THdA041n13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCACCAGCGGCATTGGCAGCGGCGGAGGCGGCGGGAGCGGCAACGTCAGCACCGTGGTTCAGCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGCCGGCAATGCATGTGTGGCCATGCCTCACAAAATAGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTTTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTTTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTTTGAAAACGCGGAGAATGGTTTCCGTACCCGGAAATATGAATGATGAGGGAAATGGTCAACGTAGCACTTCACTTGGTGAAGGAAATCTAGAAAAAAAAAAAAAAAAAAG
  5   1   2       ext Egg       in                   TEgg014f09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGGGCCGTGGTTCAGCCGTATGATGTCGAGATCCGACGCGGTGAAAATGAAGGATTTGGATTTGTCATTGTGTCTTCTGTCAGCCGGCCAGAAGCCGGGACTACTTTTGCCGGCAATGCATGTGTGGCCATGCCTCACAAAATAGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCCAGTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGG
  3   1   0       chi Gas6      in                         ANBT1099.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTACTTTTGCCGGCAAATGCAGGTGTGGCCATGCCTCACAGAATAGGTCGGATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCGGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAATGATGAGGAATGGTCAACGTAGCATCATTGGTGAAGGAAATCTAGAAAAAAAAAACAAAAACAAAAGCAAAAACTTGATCCTTTTGTTAAAACTATACTGCATTGAACTGTGCCAAACCATTTTTCATTATTTTGTATT
  3   1   3        nb Gas                             TGas113k06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATAATAGAGGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGACAAAAAAAAAAAAAAAAAA
  5   1   2       ext Gas7      in                         XZG52323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGAGCCCCGCGGATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGA
  5   1   3        nb Tbd1      in                         CBXT8405.b3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCGCTGCGGCAAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACA
  5   1   3        nb Tbd1      in                         CBXT7592.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGTAGCTGAAAGTGGGGGACCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAACAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACA
  3   1   2       ext Egg       in                    TEgg044l11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGAAAGTGGGGACCCGGATCTTGGCCGTTAACGGGTGCTCCATCACCAANCAAGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCTGAGAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg  5g3  in                    TEgg058c11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTCACACTCGGACATCGTCAATTTAATAAAGGAAGCGGGGAACACCGTGACTCTGCGCATCATTCCCGGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACGGAAAGGGAGGAAAAAAAAAAAAAAAAAA
  5   1   2       ext Egg       in                   TEgg006j18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCGATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACAT
  3   1   4      seed Egg       in                    TEgg048k19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGAAACGTCCAACGCGTCTTTATTAACCAATGCAGAGAAGATTGCCACGATTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCTGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACGGAAAGGAGAGAGAAAAAAAAAAAAAAAAAA
  3   1   0       chi Brn3      in                         CAAK1187.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGCGATGATTCCTCCTAATATCGCTGCATGTATGAGAAATGACAAGCTCGGGGAACCTTGCTTCTACCTAATGGGCCAAAATCAAACTACGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAG
  5   1   3        nb Egg                            TEgg095o21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTACGACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAAT
  5   1   3        nb Egg                            TEgg143k07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCACGCATACGCCACAAACGATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCCTGA
  5   1   3        nb Liv1      in                         CAAR9336.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATACCCCAAGAAACAAAAAATAATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGG
  3   1   2       add Egg       in                    TEgg065k10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGCAAAACCAAAGCCGGAGCCCCAGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas8      in                          st74n14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGCCGGAGCCCCAGGTTTGAATTCAAGAACTCACCAGCCACACAGCCTGATCAAGAAATTTATTCAGTGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCTGAGA
  5   1   3        nb Gas       in                   TGas077b05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGAACTAGACCGAGGATTAAAAGGATTTGGGTTTAGTCTACGAGGAGGTCGAGAATATAACATGGATCTCTATGTTTTACGCCTTGCGGAGGATGGGCCTGCAGCCAGATGTGGGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATTAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGACAAGAAATGAAGGAACTAGGAGTGCTG
  3   1   3        nb Te4       in                         CAAN8911.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCTGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGG
  5   1   3        nb Te4       in                         CAAN8911.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAAAATGAGGGTTGGCGATGAAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCTGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAAAAAAAAAAAAA
  5   1   3        nb Egg0      in                         dad73d04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGGGATGAAATCCTGGTAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTGGGGGGCCTCTGATAGAAATCACTCATCACTGGAGTTTAATTATCCAT
  5   1   3        nb Egg                            TEgg104k17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCGATGAATCCTGGAAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTTACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATA
  5   1   3        nb Egg                            TEgg104k18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCGATGAAATCCTGGAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTTACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAG
  5   1   3        nb Egg                            TEgg122d24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAATCCTGGAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGAT
  5   1   3        nb Egg                            TEgg122e24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAATCCTGGAATAAACGGAGAGACCACAAAGAACATGAAGCACGCCCGGGCAATAGAACTGATTAAAAATGGTGGCCGAAGAGTACGCCTGTGTCTGAAACGCGGAGATGGTTCCGTACCGGAATATGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGAT
  3   1   3        nb Gas       in                    TGas077b05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAACCCGGCGTTGACGGAAACAGCCCCACAACCAGTCCACAAAGTGTATCGAAAATGAACTCGTTACCATCTGATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAAAAAAAAAAAAAAA
  5  -1   2       ext Int1      in                         CAAP1833.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATAGAAATCACTCATCACTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATG
  5   1   3        nb Egg                            TEgg081h22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGGGCCCGGGGCTGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCTGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCC
  3   1   2       ext Gas7      in                         XZG52323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCATCACGGGAGTTCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTATGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGT
  5   1   2       add Tbd0      in                     NISC_nl20c05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGATCAATTATCCATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTG
  3   1   3        nb Brn3      out                        CAAK9570.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCCGATCTTCACAAATCATTACAGCATGGAGACAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGT
  5   1   0       chi Tbd0                               IMAGE:6977883                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGGGACCGGGCCGGAATTCCCGGGATCGTTAACACCCTAAAGGCACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGGCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAATGAGAGAAGAAAGAGGTTTCTCCTCCAAAAGCCCAGGGAAAGGTCGCCCGGTGCGCAGAAAGGATGGTNTCCCCCACCCAGGCGAAAGAAATCCCTTTGGGATAGATTTATGGGAATCAAGACCATCCCCCTGATAGAAGAAAAGAAGAAGTTTCCCCTGGACCCGAAAAAGAACCAAGTTCAACGACAGGGAAACGAAAAAAGGGTCTCCCCCCAAAAGGGAGGAAAAAAAAGGGCTTCCTGGTAAGAAAAAAAAAAAGAAGTCCCCCTCGAGAAAAAAAAAAAGGGACAAGGGTCCCCCGTATTAAACGGAACCACAGAGGCCCACGGAAACCCGGCACCCCGAAACCACGGGGATGAAAAACCGAGTCCTGAAAAACATGAGATAACCCCTCCGAAAAATGGGGGCGGGGGCCCCCCACCAGGAGAACCCCCGGGAGGGGGGGGCATCAATACCGCGAGATTGCGAGCCCCCACCGACACCTGGGACCATCCTTCGAACGCCAATGGGCCACCGTTTTATTGGTTCTCTTTCGAGGGAGATCTCTTCTCTAAGAAAGAGGATCTCATAGAAAGGTAGATTTTATATCCCTCTNTAACACCCGCGTTGTAAAAACCCCCTTCGGCTCCCTTCAATTCAGAGAGATATTATTTTCTTAGGCGCATACCAGACAAGAAAGGCCCCTCCCTTACTATTACAAAGAGCGTCGTGCTTCGCCTCTCNTTTCCTGACACCCAGCAATCGGCACGGAGCGCACGTGTTCATCGCGCGTGGAGAGGCTCTGTTTTCTGGCGACCAGCATTATTGCCGACGTGCGGGAATCGCGATCCGCCACAGACAACG
  5   1   2       ext Egg       in                   TEgg006k13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGGGGAGAAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCT
  3   1   2       ext Tad5      in                         XZT69611.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAACGAGCTTACGTTAAAGACCCTAAAGGCAACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTAAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas8      in                          st74n14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACAGGGAGTATGGCAGACCACATAACGAACATCACACTTGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCTGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATAT
  3   1   2       add Brn2      in                        CAAJ16838.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAACGAACATCACACTGGGAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCTGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGT
  3   1   3        nb Tbd1      in                         CBXT8405.g3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAAAA
  3   1   3        nb Liv1      in                         CAAR9336.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGATCTTCTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGT
  3   1   3        nb Tad5      in                         XZT28398.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Egg       in                    TEgg035h24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAATTATTCTGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAGAAAAAAAAAAA
  3   1   3        nb Tbd1      in                         CBXT7592.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTACAAAATAACAGAAAAGATCGATCACCTGAGGGGAGGCGACCAAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAAAA
  3   1   3        nb Gas8                                 st104b15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAACAGNACAGATCGATCNCCTGAGGGGAGGNGNCCAAGACAGGCCGATCGAACAATGCNGNGCNGTCAGAAAAGACATTCTCTNGAGAAAANAAATGAAGGAACTNGG
  3   1   2       ext Egg       in                    TEgg014f09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGACAGGCCGATCGAACAATGACGAACGGTCAGAAAAGACAGTCTCCTGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAAA
  3   1   2       ext Egg       in                    TEgg006k13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAATGACGAACGGTCAGAAAAGACAGTCTCCCGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg       in                    TEgg006j18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAACGGTCAGAAAAGACAGTCTCCTGAGAAAAGAAATGAAGGAACTAGGAGTGCTGAGAACACACTGGAAAGGAGAGAGAAAAATGAGAGAAGAAAAGAGGTTTCTCCTCAAAAGCCCAGGGAAAGGTCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAGAAAAAAA
  5   1   2       add Gas7                                 XZG15000.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGATTCGAATTCTCGACCCACGCGTCCGCGCCGGTGCGCAGAAGGGATGGTTCCCCAACCAGGCGAAGGAAATCCTTGGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTATGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Egg0      in                         dad73d04.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATAGATTTATGGATCAAAGACGATCCCCTGATAGGAGAAGAGAGAGTTCACCTGACCGAAGAAGAGCAAAGTCAACGGACAGGAGACGAGAAAGGTCACCAGAAAGGAGGAGAGAAAGGTCTCCTGAGAGAAGAAGAGAGAAGTCCACTGAGAGAAGAAGGGACAGGTCTCCTGATAAACGAAACAAAGAGCAACGAACCAGCAACAGAGACAGGGATGAACACAGTCTGAAATATGATACCCTCAGAAGTGGCAGGCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAA
  5   1   2       ext Int1      in                         CAAP1610.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATCGATTCCACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAGTATTTTTCGATGTATCTTTTTTAAGTTATTTGCCAAATGTCGACCCTAAAGAATTTAACCTGTTCTGCAACGAACTTATTTTATTGACTGTGTTCCAGCGGGAACGTGAGGATCCCGACACGTCTTCTCTAGAACACGTTTCCGGCACTGGACAGACCCACTGTTCCAAGTTTTTTTTTTCCCTTCGTAAACTTGATTTTTATGATTTCTGACTGTTAAATAGTGACCTATTACTACGGTTAATGTGTTTAAACATGGTGAGTCCGGTGGTGGGACCCTAAGCCAATGAATGGACATTTGTGAATGAAGAAGCGCTAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAAGGACGTAAAACAAGCACACATCGCACAAGGTGATTTTAATTGTCTTTTTATTTTAATTTTTTGTTGTGTGTGTGGGGGGGAGGGGGGGGAATGTTGTATGACCACTCCTTTATTATTTTTT
  3   1   2       ext Int1      in                         CAAP1610.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACCAACAAGAACAACGGAGGAGGCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTAAAAAAAAAAAAGTATTTTTCGATGTATCTTTTTTAAGTTATTTGCCAAATGTCGACCCTAAAGAATTTAACCTGTTCTGCAACGAACTTATTTTATTGACTGTGTTCCAGCGGGAACGTGAGGATCCCGACACGTCTTCTCTAGAACACGTTTCCGGCACTGGACAGACCCACTGTTCCAAGTTTTTTTTTTCCCTTCGTAAACTTGATTTTTATGATTTCTGACTGTTAAATAGTGACCTATTACTACGGTTAATGTGTTTAAACATGGTGAGTCCGGTGGTGGGACCCTAAGCCAATGAATGGACATTTGTGAATGAAGAAGCGCTAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAAGGACGTAAAACAAGCACACATCGCACAAGGTGATTTTAATTGTCTTTTTATTTTAATTTTTTGTTGTGTGTGTGGGGGGGAGGGGGGGAATGTTGTATGACCACTCCTTTATTATTTTTT
  5   1   2       add Gas7      in                         XZG57080.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAATACAAGGAATGCAGCACCGACCTGAGCATCTGAGCGATGCACCATTATGTTCTACGGAGCTTCTGAAATGGTTCATAGTCGTTTACGCTTAGCCTGTTGACCCTGTCATCCTATCAGATATTTTATGCAGACAAAAATCCTATTACAGAGTGTTGTGCCTGATGTACATTTAAAAAAAAAAAAGTATTTTTCGATGTATCTTTTTTAAGTTATTTGCCAAATGTCGACCCTAAAGAATTTAACCTGTTCTGCAACGAACTTATTTTATTGACTGTGTTCCAGCGGGAACGTGAGGATCCCGACACGTCTTCTCTAGAACACGTTTCCGGCACTGGACAGACCCACTGTTCCAAGTTTTTTTTTTTTCCCTTCGTAAACTTGATTTTTATGATTTCTGACTGTTAAATAGTGACCTATTACTACGGTTAATGTGTTTAAACATGGTGAGTCCGGTGGTGGGACCCTAAGCCAATGAATGGACATTTGTGAATGAAGAAGCGCTAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAAGGACGTAAAACAAGCACACATCGCACAAGGTGATTTTAATTGTCTTTTTATTTTAATTTTTTGTCGTGTGTGTGTGGGGGAGGGGGGGAATGTTGTATGACCACTCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAAT
  5   1   2       ext Gas7      in                         XZG22953.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATTGACTGTGTTCCAGCGGGAACGTGAGGATCCCGACACGTCTTCTCTAGAACACGTTTCCGGCACTGGACAGACCCACTGTTCCAAGTTTTTTTTTTCCCTTCGTAAACTTGATTTTTATGATTTCTGACTGTTAAATAGTGACCTATTACTACGGTTAATGTGTTTAAACATGGTGAGTCCGGTGGTGGGACCCTAAGCCAATGAATGGACATTTGTGAATGAAGAAGCGCTAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAAGGACGTAAAACAAGCACACATCGCACAAGGTGATTTTAATTGTCTTTTTATTTAAATTTTTTGTCGTGTGTGTGTGGGGGAGGGGGGGAATGTTGTATGACCACTCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCATTCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTAATTTTTAAATTAGAGTGTCTGCTGC
  3   1   2       add Te4       in                         CAAN3071.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGACCCTAAGCCAATGAATGGACATTTGTGAATGAAGAAGCGCTAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAAGGACGTAAAACAAGCACACATCGCACAAGGTGATTTTAATTGTCTTTTTATTTTAATTTTTTGTCGTGTGTGTGTGGGGGAGGGGGGGAATGTTGTATGACCACTCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTACTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGT
  3   1   2       ext Gas7      in                         XZG22953.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACCCTAAGCCAATGAATGGACATTTGTGAATGAAGAAGCGCTAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAAGGACGTAAAACAAGCACACATCGCACAAGGTGATTTTAATTGTCTTTTTATTTAAATTTTTTGTCGTGTGTGTGTGGGGGAGGGGGGGAATGTTGTATGACCACTCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCATTCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTAATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGT
  3   1   2       add Gas7      in                         XZG57080.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCCAATGAATGGACATTTGTGAATGAAGAAGCGCTAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAAGGACGTAAAACAAGCACACATCGCACAAGGTGATTTTAATTGTCTTTTTATTTTAATTTTTTGTCGTGTGTGTGTGGGGGAGGGGGGGAATGTTGTATGACCACTCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTAATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGT
  5  -1   3        nb Egg                            TEgg092b19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAAGGACGTAAAACAAGCACACATCGCACAAGGTGATTTTAATTGTCTTTTTATTTTAATTTTTTGTCGTGTGTGTGTGGGGGAGGGGGGGAATGTTGTATGACCACTCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTAATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAA
  3   1   2       add Tbd0      in                     NISC_nl20c05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCTTTTTATTTTAATTTTTTGTCGTGTGTGTGTGGGGGAGGGGGGGAATGTTGTATGACCACTCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTACTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2  SIG                                    Xt7.1-TNeu071c02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTACGCCATCACGCATTTTCTTGATGGAAACCCATCCGTGGGCCGATTTTTTTTTTTCATTTTTTCCCTAAAAACAAAAACACTATGCATATATCAATTCAACTTTTGTTCATACAGTAGCTTTATTTAACTTATGGGAGTCGATACGTCGATGACGTTTCCTTTGATTCAAGGTGATTGTGGACTTTGCCAGGACTGCTTCCTTGTGCGGAACAGAACACAAAGCCTATGTAGCTAGGAAAGCAAGTCTGTGAATGCTATTTTTATTATCAAATAAAGTTTTCAGTACAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008274218                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTACGCCATCACGCATTTTCTTGATGGAAACCCATCCGTGGGCCGATTTTTTTTTTTCATTTTTTCCCTAAAAACAAAAACACTATGCATATATCAATTCAACTTTTGTTCATACAGTAGCTTTATTTAACTTATGGGAGTCGATACGTCGATGACGTTTCCTTTGATTCAAGGTGATTGTGGACTTTGCCAGGACTGCTTCCTTGTGCGGAACAGAACACAAAGCCTATGTAGCTAGGAAAGCAAGTCTGTGAATGCTATTTTTATTATCAAATAAAGTTTTCAGTACAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       add Tad0                               IMAGE:6984194                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAATGGACATTTGTGAATGAAGAAGCGCTAACTAAATAGAAGGGAAATCTAGTTCTGACTACTACTGCAATGAATGTTGTATGACCACTCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACTGTAAAAAAAAAAAAAAAAAATCCCATCGTTGTTCAGAATGGAAAAAGTCATTATTAATAAGCTGGTCGGAAACAAAGGTTGCCTTTTTTTTCCGTGTCTTAAACAACTCGTGACAGAAAAGAATTTGGTGTGATGTTCTTNTTGTTTTTAT
  5   1   2       ext Tbd1      in                        CBXT16944.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCACTCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAA
  5   1   2       ext Egg       in                   TEgg070i10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTAT
  5   1   3        nb Egg       out                  TEgg070l19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAATGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTATCTGATTACAGAGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACACAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGATGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGA
  5   1   2       ext Egg       in                   TEgg072i12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAA
  5   1   3        nb Egg       in                   TEgg072j12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACTTTATTATTTTTTTGTGGAGGGAAGACCATTTTTGGCCAGTGTAACCCTTCTCTTGTCTATAGAGTGGTTAAATGTACATACCATTTATGGATTGTTATCGTAATTGCAGTGATAATTGACATTAATTGCCATG
  5   1   3        nb Neu       in                   TNeu091j21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTTTATTATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTT
  3  -1   3        nb Egg       in                    TEgg029n23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTTTTTTTTTTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAG
  5   1   3        nb Neu                            TNeu022o12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGG
  5   1   3        nb Brn4      in                         CAAL9759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCAT
  5   1   3        nb Egg       in                   TEgg002n24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATT
  5   1   2       ext Egg       in                   TEgg003b10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGA
  5   1   3        nb Egg       in                   TEgg016g19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGA
  5   1   4      seed Egg       in                   TEgg069d21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTG
  5   1   3        nb Egg                            TEgg095n24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTCTCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGGCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGGATAAAAGATACTTTATGAAAA
  5   1   3        nb Egg       in                   TEgg069e13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGAGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTC
  5   1   3        nb Egg                            TEgg100h05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAA
  5   1   3        nb Tad5      in                         XZT16404.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGNGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGAAAAAAAAAAAATCGTTGTTTGGGTTTGAAACTTCCTTCATTTC
  3  -1   3        nb Int1      in                        CAAP13637.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTC
  3  -1   3        nb Int1      in                         CAAP6555.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGNGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCNCTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTACGCCATCACGCATTTTCTTG
  3  -1   3        nb Int1      in                         CAAP6556.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGACGATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTT
  5   1   3        nb Tad5                                 XZT29199.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAAATGTAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAA
  5   1   3        nb TbA       in                   TTbA045k11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTACTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGACAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTA
  5   1   3        nb Egg       in                   TEgg029o08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTGTCCAGTTTAGCCCAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTT
  5   1   2       ext TbA       in                   TTbA053d22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGTCTTGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTACGCCATCACGCATTTTCTTGATGGAAACCCAT
  5   1   2       add Brn4                                CAAL19411.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGACGCGTGGGCGACCCACGCGTCCGGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTACTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGAAAAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCAT
  5   1   3        nb Gas8                                  st45m21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTTGGTCTAGAGAATGGTTAAATGTACATACCAGTTATGGATTGTTATCATAATTGTAATGATAATTGACGTTACTTGCCATGCCTTCGGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAA
  5   1   3        nb Ovi1      in                         CABI2239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCGATTCGAGAATTTGTAGTGCTTGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTACGCCATCACGCATTTTCTTGATGGAAACCCATCCGTGGGCCGATTTTTTTTTTTCATTTTTTCCCTAAAAACAAAAACACTATGCATATATCAATTCAACTTTTGTTCATACAGTAGCTTTATTTAACTTATGG
  3   1   3        nb Neu       ?                     TNeu106h06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAGAACAAATTTTATTGACAACAGTCCAATCAAAATGGCCGACAGAGGCCGCTATTTAAAAAGTTGATGGTCTTGTTGCCTGGTTGCATTTCTGTTGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGTATGCCACGTACTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Neu       in                   TNeu071c02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAACTAGTGTCGACAGAGGCCGCTATTTAAAAAGTTGTTGGTCTTGTTGCCTGGTTGCATTTGTGTGGATCAGAAATGATACAGCGGACGGTTCCGACGCGTCGAGGAATGCCAATAGGTATGCCACGTTCTACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTATCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGGCAGGAACAAGCATTGCAAGT
  3   1   3        nb Gas5                                  XZF1653.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGTATGCCACGTACTACTTTTTGAGATCGATCACCTCAGCTGAAGTATTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTACGCCATCACGCATTTTCTTGATGGAAACCCATCCGTGGGCCGATTTTTTTTTTTCATTTTTTCCCTAAAAACAAAAACACTATGCATATATCAATTCAACTTTTGTTCATACAGTAGCTTTATTTAACTTATGGGAGTCGATACGTCGATGACGTTTCCTTTGATTCAAGGTGATTGTGGACTTTGCCAGGACTGCTTCCTTGTGCGGAACAGAACACAAAGCCTATGTAGCTAGGAAAGCAAGTCTGTGAATGCTATTTTTATTATCAAATAAAGTTTTCAGTGC
  5  -1   3        nb Int1      in                         CAAP6555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTACGCCATCACGCATTTTCTTGATGGAAACCCATCCGTGGGCCGATTTTTTTTTTTCATTTTTTCCCTAAAAACAAAAACACTATGCATATATCAATTCAACTTTTGTTCATACAGTAGCTTTATTTAACTTATGGGAGTCGATACGTCGATGACGTTTCCTTTGATTCAAGGTGATTGTGGACTTTGCCAGGACTGCTTCCTTGTGCGGAACAGAACACAAAGCCTATGAAGCTAGGAAAGCAAG
  5  -1   3        nb Int1      in                         CAAP6556.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTTTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTACGCCATCACGCATTTTCTTGATGGAAACCCATCCGTGGGCCGATTTTTTTTTTTCATTTTTTCCCTAAAAACAAAAACACTATGCATATATCAATTCAACTTTTGTTCATACAGTAGCTTTATTTAACTTATGGGAGTCGATACGTCGATGACGTTTCCTTTGATTCAAGGTGATTGTGGACTTTGCCAGGACTGCTTCCTTGTGCGGAACAGAACACAAAGCCTATGAAGCTAGGAAAGCAAG
  3  -1   3        nb Int1      in                         CAAP6712.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGAGATCGATCACTTCAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTACGCCATCACGCATTTTCTTGATGGAAACCCATCCGTGGGCCGATTTTTTTTTTTCATTTTTTCCCTAAAAACAAAAACACTATGCATATATCAATTCAACTTTTGTTCATACAGTAGCTTTATTTAACTTATGGGAGTCGATACGTCGATGACGTTTCCTTTGATTCAAGGTGATTGTGGACTTTGCCAGGACTGCTTCCTTGTGCGGA
  3   1   3        nb Neu       in                    TNeu091j21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCTGAAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTACAGTAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTACGCCATCACGCATTTTCTTGATGGAAACCCATCCGTGGGCCGATTTTTTTTTTTTCATTTTTTCCCTAAAAACAAAAACACTATGCATATATCAATTCAACTTTTGTTCATACAGTAGCTTTATTTAACTTATGGGAGTCGATACGTCGATGACGTTTCCTTTGATTCAAGGTGATTGTGGACTTTGCCAGGACTGCTTCCTTGTGCGGAACAGAACACAAAGCCTATGAAGCTAGGAAAGCAAGTCTGTGAATGCTATTTTTATTATCAAATAAAGTTTTCA
  3   1   3        nb Egg       in                    TEgg016g19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGTATTTTTAAATTAGAGTGTCTGCTGCTTCCGGAGTCCAAAGTTAATACCGTATTACTGCCTCGCTGAGCCAAAACGTTTGGCATTTCTCTCAAGCCACTTAACATTAGCTGATTACAGTGCTTCGTATGCCATGTTTTCTATTTTCCCTCAGACAGGAACAAGCATTGCAAGTCTCGCTGTTGTTGCCATGGTCCAGTAAAAAAAAAAAAAAAAAAAAGCCAATCGTTGTACAGAATTGAAAAATGTAATTATTAAGAGCCTGTTGGAAACAAAATGTTGCCTTTTTTTTTCCTTGTATAAAAGATACTTTATGAAAAAAGAATCATGTGAGGAATGTGATAAGTGTTTATATTTCTGAAAATGGAGATTCATTGGGGATATATTTTAATGTAAACTGAATCAGGTATGTAAAGGTATTTTCAAAACGGGAAAAAAAAAATCGTTGTTGGGTTTGAAACTTCCTTCATTTCCTCGTTGTTGGGCTTGTTAATTATAAAGCACTTGTATGCCGTCTGCTCTCTAATCACCATAACTAACAACGTCCTACGCCATCACGCATTTTCTTGATGGAAACCCATCCGTGGGCCGATTTTTTTTTTTCATTTTTTCCCTAAAAACAAAAACACTATGCATATATCAATTCAACTTTTGTTCATACAGTAGCTTTATTTAACTTATGGGAGTCGATACGTCGATGACGTTTCCTTTGATTCAAGGTGATTGTGGACTTTGCCAGGACTGCTTCCTTGTGCGGAA