Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABD5634.3                           85 END     1           1        1                Inositol monophosphatase domain containing 1 [Xenopus tropicalis]
     2   2.0    0Xt7.1-CABJ9463.3.5                         61 END     1           1        1                Unknown (protein for MGC:121383) [Xenopus tropicalis]
     3   0.0    0Xt7.1-XZT53985.3.5                         38 END     1           1        2                (no blast hit)
     4   2.0    0Xt7.1-CABI8298.5                            9 END     6           9       75                uveal autoantigen with coiled-coil domains and ankyrin repeats [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012153596 Xt7.1-CABJ5308.3.5 - 62 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     3     3     4     4     4     4     5     5     6     6     6     6     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9    11    11    11    11    11    11    11    11    11    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12     8     8     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     6     6     6     6     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     5     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     7     7     7     7     7     7     7     7     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     5     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7    10    10    11    11    12    12    15    15    17    17    18    19    19    19    19    19    20    20    20    21    20    22    25    26    25    26    25    26    25    26    25    27    25    28    27    29    29    32    29    31    29    31    30    32    31    33    31    33    31    34    32    34    32    34    31    34    31    34    32    34    32    34    32    34    32    34    32    34    31    34    32    35    32    35    32    34    32    34    32    34    31    33    32    33    32    33    32    33    32    33    31    33    30    33    30    33    31    33    30    33    31    33    29    33    30    33    29    31    28    30    28    30    26    28    26    28    26    28    26    28    26    28    26    28    26    28    25    28    25    28    25    28    23    26    22    25    22    25    22    25    21    25    20    23    20    23    20    22    19    21     4    12     7     7
  5   1   2      ests                                 Xt7.1-CABJ5308.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACTACAAGCACAGGCAGACAGAGAATCTCTCAAGCGGGCAGATTTGCAAGCAGAGATGAAAAGCATTGTTAGAGAGCGTGAAGAACTGCAAGGGCAGCTGAAAACCAGAACAGAAGAGCTATCAGATTTGCAGGCCCAGATGCGCAAGCTGAAAATTCAGGTAGATAATGAATATGTGAAGCTTAAAGTACACGAAGAAAAAATATTGGAACTGCAAAAGCAAAAAGAACAAATACTGCAAGAGTTGTCTCAAGCCCATGCCAAGAACCAGCAGTCACAAGAGGAAGTGCTGAGACTTCAGACTGCGATCCGCGGGCAGAAAGAGGAGCTGGATACACTGCAGCACTGTATTTCAGAGAAGTACGCTCCACTGGCCAGTATAGAAGAAAGAGAGCAGAGCTTTCAGAAATCACTTGGTGCGCTAGAGAAAGAACTGGAGAAGGAGCGCTGCAGAAGCAGAGAGATTCAGCACAAGCTGGAGCAGCATAAACAGGATGCCCAAGACTTCCAGAAAAAATTGGAGTCTGCAAAATTAGTGTTACAACAGGAGAAAGCTGCTCAGGAGCAGGAGAAGCTTGCACTGCAGAGCCAGTTGGCAGAAACGCACGCTTTGCTTCTTCAATTACAGAAGTCTGAGGCTGAGATGAAGCAGAAACAGCAAGAACTCCGGGAGCAGAACTTAAAGGCTCAAAATAAAATCGGTGAGATGAAAGATCAGCTAAGGAACCAGTACATTCCCATTCAAGAGCATGAGGACCTAAAGGCTATTCTAAGCACAAAAGCATCTCTGGAGGTACAGCTGAAAGAACATATGGGTCTGTATGAAAAGGAACTGGAGAAAGTAAAGAGTCTTGAAAAAGAGCTTGAGAAACAGAAAGATGGTTCTCTTCCCCTTGTGCTCCATGCCCAGGAGGTGCAGGCCTGGCAGAAGAGACAAGCGGAAACACAGAAAAGGCTGCAGGAGAAGGAGGAAGCAGCGCAGGCAGCAGAGCAGCAGCTTAAACAGCTCAAGGATGAACTACACACACTCCGCCTCAACTTGCAGGAGGCTGAGCAAGAGAAAGAAGATTGCACTGCTGCAAGGATAGAACTGGAGCAGAAAGTAGCTCAGATGGAGCAGAGCAGCAGCAAGGGCAATGAAGAGGCCACGCAAATGAGCCAAGAGCTGCAGAAATCACAAGAGGAGAGTGTGAAATTAAGAGAGAAAAGCAGTGTCATTGAACATGAAATTTCCCAGCTCAAAGGAAGGTACGACGAATCTCTGGCCACAATAGAAGAGCTAAAGAGTCGAATCCTGTCGTCAGCCAAAGACCTTAAAGACAAGGACAAAGAGATCTCTGCTCTCGTAAATGATGTGGAGAGGCTGAAAATAGCTAAGGCCCAGATGACAGAAGTTGTTGGGAAGAAACTGTCGTATGAGATCCTGCAGTCTCAGGTGGTGTCTCTGCAGCGCCAACTAGAGGAAACTCAGCAGAAGCACCAAGACATCATTGCCATCTACCGCTCACACCTGCTTAGTGCTGCCCAGGGTCACATGGATGCTGATGTCCAAGATGCCTTGTTACAGATTATCCACATGCGGCAAGAGCTCGTCTTCTAAAACCTTCACTTCTTTTGTTATGTGAATAGAGGCCAGGGACTTACTCAATGTACATTAAACCAGTAATGATTAAATATACATATAATTATGGGAGACCAAAATACAAAATAAACAAAAAATTAGGTATAGGAAGTGGATTAGTAACAGAGGTCAAACATTGGAGCACAAAGAAGATGGGGTAAATAAATGGATGTGTATGGGAAGGTGAATAGAAGGGAGGGTTTGTGTAGGGGAGAAGGATATGTAAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAAAAAAAAAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         G-----------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN -== Br ==== 3e-011     CAC13104.1 nuclear lamin [Branchiostoma lanceolatum] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Cs ---- 5e-013     AAX84194.1 cytospin A [Ciona savignyi] --------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bf ---- 7e-021     CAA11444.1 intermediate filament protein C1 [Branchiostoma floridae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Bb ---- 6e-028     BAC16746.1 myosin heavy chain [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 1e-036     FAA00138.1 TPA: zinc finger protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 5e-039     NP_505094.1 Myosin N-terminal SH3-like domain and Myosin head (motor domain) and IQcalmodulin-binding motif and M protein repeat and Myosin tail family member[Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 2e-040     NP_001084034.1 nonmuscle myosin heavy chain b [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 6e-044     NP_010225.1 involved intracellular protein transport, coiled-coil protein necessary forprotein transport from ER to Golgi; Uso1p [Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-044     XP_782330.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                  PROTEIN --- Dm ---- 8e-047     NP_724048.1 CG5020-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                             PREDICTED - Dr ---- 5e-097     XP_692492.1 PREDICTED: similar to uveal autoantigen with coiled-coil domains and ankyrin repeats isoform 2 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                PROTEIN --- Xl ---- 0          AAH77750.1 LOC445880 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                    PROTEIN --- Xt ---- 0          CAJ82589.1 uveal autoantigen with coiled-coil domains and ankyrin repeats [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                        PROTEIN --- Mm ---- 0          NP_082559.1 nuclear membrane binding protein NUCLING [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                       PREDICTED - Gg ---- 0          XP_413937.2 PREDICTED: similar to uveal autoantigen with coiled-coil domains and ankyrin repeats [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                    PROTEIN --- Hs ---- 0          NP_001008225.1 uveal autoantigen with coiled-coil domains and ankyrin repeats isoform 2 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABJ5308.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------TAA---------------------------------------------------------------TAATGA------------------ATG------------------TAA---------TAG---TAG---------TAGTAA---------------------------------------TAAATG---------------------------------------------------------------------------------------ATG------------------------------------TAG---------------------ATG---------------------TGA---------------------------TGA------------ATGTAA---------------------------------TAG------------------TGA---------TGA------ATGTGATAA---------------------------------------------------------------TAA------------------TGA------------------------------------TAG---------TGA---------TAA---------------------TAG---TGA---------------------------------------------------------------------TAA------------TAG---TAG---------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------ATG------------TAG---------------------------------------ATG---------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  3   1   2       bld Liv1      out                       CAAR11112.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCATGGGGCTTCTGTTAATGCAAAAGATGGGGATGGAAGGGCTCCTGTGGCTCTTGCAACCCAGATGTGTCGCCCTGCCATTTGTCAACTTNTAATAGAAAAAGGAGCAGACATTAATTCCAGAGACAAGCAGAATAAGACGCCCCTCATGCTGGGCTGTGAGTATGGCTGCAAGGAGGCAGTGGATGTCTTATTGAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGACTGTGCATATTATAGCAGAATTGGAGATAACCTGGAGATCCTAGCCATGATCAAAACAGCCATGGAGAATTCACCTCAAGGGCTAGATCCTGTCCGAAGGATTGTCTCTCTGCGTACGAGAAAGACAAAGCAAAACTCAGTGGAAGAGGGTAGTGTCGTATCTAAGGAGAAATCGCTGGATCTGGAAGCTGAGAATGAGAACTTACGGGAGAGGCTTCGGAAAATACAGCATGAGCAGAGAAGTCTCTTTGAGAAAGTGGAGGGATTACAACTTCAGCTCAACCAGGAGCAAATGATGTCTGATGACCTAGAGAATGAGAAGGAGCATTTGAAATCTATTCTAG
  5   1   2       bld Hrt1      in                         CAAQ9520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATCGCTGGATCTGGAAGCTGAGAATGAGAACTTACTGGAGAGGCTTCGGAAAATACAGCATGAGCAGAGAAGTCTCTTTGAGAAAGTGGAGGGATTACAACTTCAGCTCAACCAGGAGCAAATGATGTCTGATGACCTAGAGAATGAGAAGGAGCATTTGAAATCTATTCTAGAAGGAAAAGAAAAAGAACTAGAAGAATGTCTGAGAACCATGGAAGGTTTGAGGGGGAAAGTGAGATATTATGAGCAGAAGAATTATTTGGCACAGAGCAGCCCATTCGGTAATGGTAAAGAAGAGGTTGTGATGAAACAGAATTCTATATTGGGTGTGGACCCACAGCTTGCAGCTCACCTGCCGGCCAGGTCTCAGCTGCGGCCACTGGAGCTCCCAGGAGAAAATACAGATCAGCGCCATGAACTGGAAACTATACGTAGATACTATGAAGCTGCAAGAGATGAGACAATAAAGTTGCAACAGGAGCTATCAAGGAGATCTTCTGAATGTGTGGCGCTTGTCTCAGAGAGGGATCGATGCAAGGTGGAGTCTGACCAGCAAATTCACCAACTAGAGGATGCGTTGCGAGATGTACAGAAAAGAATGTTAGACTCTGAGGGGAAGGTCAAACAAATGCAAACGCATTTTCTAGCCCTAAAGGATCACCTGACTCAGGAAGCCCTGAGTGGTAGTTCTCGTGCTGAGGACATGGAGGAGCAGTTGAGAGAAGTCAAAGGGAAATACGAGGGAGCATCGGCTGAGGTTGGTAAACTAAGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGC
  5   1   2       bld Te4       in                         CAAN2679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAACTTCAGCTCAACCAGGAGCAAATGATGTCTGATGACCTAGAGAATGAGAAGGAGCATTTGAAATCTATTCTAGAAGGAAAAGAAAAAGAACTAGAAGAATGTCTGAGAACCATGGAAGGTTTGAGGGGGAAAGTGAGATATTATGAGCAGAAGAATTATTTGGCACAGAGCAGCCCATTCGGTAATGGTAAAGAAGAGGTTGTGATGAAACAGAATTCTATATTGGGTGTGGACCCACAGCTTGCAGCTCACCTGCCGGCCAGGTCTCAGCTGCGGCCACTGGAGCTCCCAGGAGAAAATACAGATCAGCGCCATGAACTGGAAACTATACGTAGATACTATGAAGCTGCAAGAGATGAGACAATAAAGTTGCAACAGGAGCTATCAAGGAGATCTTCTGAATGTGTGGCGCTTGTCTCAGAGAGGGATCGATGCAAGGTGGAGTCTGACCAGCAAATTCACCAACTAGAGGATGCGTTGCGAGATGTACAGAAAAGAATGTTAGACTCTGAGGGGAAGGTCAAACAAATGCAAACGCATTTTCTAGCCCTAAAGGATCACCTGACTCAGGAAGCCCTGAGTGGTAGTTCTCGTGCTGAGGACATGGAGGAGCAGTTGAGAGAAGTCAAAGGGAAATACGAGGGAGCATCGGCTGAGGTTGGTAAACTAAGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGCAGAGAGGATGCCCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGGGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTCTGT
  3   1   2       bld Gas       ?                     TGas096b18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAACCATGGAAGGTTTGAGGGGGAAAGTGAGATATTATGAGCAGAAGAATTATTTGGCACAGAGCAGCCCATTCGGTAATGGTAAAGAAGAGGTTGTGATGAAACAGAATTCTATATTGGGTGTGGACCCACAGCTTGCAGCTCACCTGCCGGCCAGGTCTCAGCTGCGGCCACTGGAGCTCCCAGGAGAAAATACAGATCAGCGCCATGAACTGGAAACTATACGTAGATACTATGAAGCTGCAAGAGATGAGACAATAAAGTTGCAACAGGAGCTATCAAGGAGATCTTCTGAATGTGTGGCGCTTGTCTCAGAGAGGGATCGATGCAAGGTGGAGTCTGACCAGCAAATTCACCAACTAGAGGATGCGTTGCGAGATGTACAGAAAAGAATGTTAGACTCTGAGGGGAAGGTCAAACAAATGCAAACGCATTTTCTAGCCCTAAAGGATCACCTGACTCAGGAAGCCCTGAGTGGTAGTTCTCGTGCTGAGGACATGGAGGAGCAGTTGAGAGAAGTCAAAGGGAAATACGAGGGAGCATCGGCTGAGGTTGGTAAACTAAGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGCAGAGAGGATGCCCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGGGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTCTGTCACCACGGACAAGTTTGAGAACATGCGATGTCTGCTTACCAATGAAGTGAATGAGAAGTCCCGGGCATTAGAGATGGCTGAAGCGGAATTGACACAAGTNAACAAGAGCTGAAACTGCACACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ9520.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTGAGGGGGAAAGTGAGATATTATGAGCAGAAGAATTATTTGGCACAGAGCAGCCCATTCGGTAATGGTAAAGAAGAGGTTGTGATGAAACAGAATTCTATATTGGGTGTGGACCCACAGCTTGCAGCTCACCTGCCGGCCAGGTCTCAGCTGCGGCCACTGGAGCTCCCAGGAGAAAATACAGATCAGCGCCATGAACTGGAAACTATACGTAGATACTATGAAGCTGCAAGAGATGAGACAATAAAGTTGCAACAGGAGCTATCAAGGAGATCTTCTGAATGTGTGGCGCTTGTCTCAGAGAGGGATCGATGCAAGGTGGAGTCTGACCAGCAAATTCACCAACTAGAGGATGCGTTGCGAGATGTACAGAAAAGAATGTTAGACTCTGAGGGGAAGGTCAAACAAATGCAAACGCATTTTCTAGCCCTAAAGGATCACCTGACTCAGGAAGCCCTGAGTGGTAGTTCTCGTGCTGAGGACATGGAGGAGCAGTTGAGAGAAGTCAAAGGGAAATACGAGGGAGCATCGGCTGAGGTTGGTAAACTAAGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGCAGAGAGGATGCCCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGGGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTCTGTCACCACGGACAAGTTTGAGAACATGCGATGTCTGCTTACCAATGAAGTGAATGAGAAGTCCCGGGCATTAGAGATGGCTGAAGCGGAATTGACACAAGTACAACAAGAGCTTGAAACTGCACACAGAGAAAAAAAAAAAAA
  3   1   2      seed Fat1      out                        CABC6045.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGCAGAAGAATTATTTGGCACAGAGCAGCCCATTCGGTAATGGTAAAGAAGAGGTTGTGATGAAACAGAATTCTATATTGGGTGTGGACCCACAGCTTGCAGCTCACCTGCCGGCCAGGTCTCAGCTGCGGCCACTGGAGCTCCCAGGAGAAAATACAGATCAGCGCCATGAACTGGAAACTATACGTAGATACTATGAAGCTGCAAGAGATGAGACAATAAAGTTGCAACAGGAGCTATCAAGGAGATCTTCTGAATGTGTGGCGCTTGTCTCAGAGAGGGATCGATGCAAGGTGGAGTCTGACCAGCAAATTCACCAACTAGAGGATGCGTTGCGAGATGTACAGAAAAGAATGTTAGACTCTGAGGGGAAGGTCAAACAAATGCAAACGCATTTTCTAGCCCTAAAGGATCACCTGACTCAGGAAGCCCTGAGTGGTAGTTCTCGTGCTGAGGACATGGAGGAGCAGTTGAGAGAAGTCAAAGGGAAATACGAGGGAGCATCGGCTGAGGTTGGTAAACTAAGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGCAGAGAGGATGCCCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGGGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTCTGTCACCACGGACAAGTTTGAGAACATGCGATGTCTGCTTACCAATGAAGTGAATGAGAAGTCCCGGGCATTAGAGATGGCTGAAGCGGAATTGACACAAGTACAACAAGAGCTTGAAACTGCAC
  5   1   2       bld Te3       in                         CAAM4699.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTATTTGGCACAGAGCAGCCCATTCGGTAATGGTAAAGAAGAGGTTGTGATGAAACAGAATTCTATACTGGGTGTGGACCCACAGCTTGCAGCTCACCTGCCGGCCAGGTCTCAGCTGCGGCCACTGGAGCTCCCAGGAGAAAATACAGATCAGCGCCATGAACTGGAAACTATACGTAGATACTATGAAGCTGCAAGAGATGAGACAATAAAGTTGCAACAGGAGCTATCAAGGAGATCTTCTGAATGTGTGGCGCTTGTCTCAGAGAGGGATCGATGCAAGGTGGAGTCTGACCAGCAAATTCACCAACTAGAGGATGCGTTGCGAGATGTACAGAAAAGAATGTTAGACTCTGAGGGGAAGGTCAAACAAATGCAAACGCATTTTCTAGCCCTAAAGGATCACCTGACTCAGGAAGCCCTGAGTGGTAGTTCTCGTGCTGAGGACATGGAGGAGCAGTTGAGAGAAGTCAAAGGGAAATACGAGGGAGCATCGGCTGAGGTTGGTAAACTACGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGCAGAGAGGATGCCCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGAGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTCTGTCACCACGGACAAGTTTGAGAACATGCGATGTCTGCTTACCAATGAAGTGAATGAGAAGTCCCGGGCATTAGAGATGGCTGAAGCGGAATTGACANCAGTACAACAAGAGCTTGAAACTG
  3   1   2       bld Egg       out                   TEgg032g21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAATGGTAAAGAAGAGGTTGTGATGAAACAGAATTCTATATTGGGGTGGACCCACAGCTTGCAGCTCACCTGCCGGCCAGGTCTCAGCTGCGGCCACTGGAGCTCCCAGGAGAAAATACAGATCAGCGCCATGAACTGGAAACTATACGTAGATACTATGAAGCTGCAAGAGATGAGACAATAAAGTTGCAACAGGAGCTATCAAGGAGATCTTCTGAATGTGTGGCGCTTGTCTCAGAGAGGGATCGATGCAAGGTGGAGTCTGACCAGCAAATTCACCAACTAGAGGATGCGTTGCGAGATGTACAGAAAAGAATGTTAGACTCTGAGGGGAAGGTCAAACAAATGCAAACGCATTTTCTAGCCCTAAAGGATCACCTGACTCAGGAAGCCCTGAGTGGTAGTTCTCGTGCTGAGGACATGGAGGAGCAGTTGAGAGAAGTCAAAGGGAAATACGAGGGAGCATCGGCTGAGGTTGGTAAACTAAGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGCAGAGAGGATGCCCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGGGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTCTGTCACCACGGACAAGTTTGAGAACATGCGATGTCTGCTTACCAATGAAGTGAATGAGAAGTCCCGGGCATTAGAGATGGCTGAAGCGGAATTGACACAAGTACAACAAGAGCTTGAAACTGCACACAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te3       in                         CAAM4699.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAATGTGTGGCGCTTGTCTCAGAGAGGGATCGATGCAAGGTGGAGTCTGACCAGCAAATTCACCAACTAGAGGATGCGTTGCGAGATGTACAGAAAAGAATGTTAGACTCTGAGGGGAAGGTCAAACAAATGCAAACGCATTTTCTAGCCCTAAAGGATCACCTGACTCAGGAAGCCCTGAGTGGTAGTTCTCGTGCTGAGGACATGGAGGAGCAGTTGAGAGAAGTCAAAGGGAAATACGAGGGAGCATCGGCTGAGGTTGGTAAACTACGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGCAGAGAGGATGCCCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGAGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTTTGTCACCACGGACAAGTTTGAGAACATGCGATGTTTGCTTACCAATGAAGTGAATGAGAAGTCCCGGGCATTAGAGATGGCTGAAGCGGAATTGACACAAGTACAACAAGAGCTTGAAACTGCCCCCAGGG
  5   1   2       bld Ovi1      in                         CABI4795.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGGTGGAGTCTGACCAGCAAATTCACCAACTAGAGGATGCGTTGCGAGATGTACAGAAAAGAATGTTAGACTCTGAGGGGAAGGTCAAACAAATGCAAACGCATTTTCTAGCCCTAAAGGATCACCTGACTCAGGAAGCCCTGAGTGGTAGTTCTCGTGCTGAGGACATGGAGGAGCAGTTGAGAGAAGTCAAAGGGAAATACGAGGGAGCATCGGCTGAGGTTGGTAAACTACGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGCAGAGAGGATGCCCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGAGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTCTGTCACCACGGACAAGTTTGAGAACATGCGATGTCTGCTTACCAATGAAGTGAATGAGAAGTCCCGGGCATTAGAGATGGCTGAAGCGGAATTGACACAAGTACAACAAGAGCTTGAAACTGCACACAGAGAAAAGAAAAGAACAGAAGCCAAATTAGATATGTTGAGGAAGGAAGTTGAAGAAATGAATGTTAAGAATCACAGCTTTGGACGAGAGGGTGAAAAACTGCAAGCAGAAAAGGTTCTGCTGCTGCGGCAAATTGAGGATCTTACTGCACAAATAAAGAGCCAACACGTGCCAGCTGAGCTTCATGCCGAGACCAAAAGAGCCTTAGAAGTAACCATTTCTCAGCTTAACCAGAGACTAGCAGAATCTGAAAAGACTCACAGAAAGTCTGAAA
  3   1   2       bld Ovi1      in                         CABI1495.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGACTCTGAGGGGAAGGTCAAACAAATGCAAACGCATTTTCTAGCCCTAAAGGATCACCTGACTCAGGAAGCCCTGAGTGGTAGTTCTCGTGCTGAGGACATGGAGGAGCAGTTGAGAGAAGTCAAAGGGAAATACGAGGGAGCATCGGCTGAGGTTGGTAAACTACGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGCAGAGAGGATGCCCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGAGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTCTGTCACCACGGACAAGTTTGAGAACATGCGATGTCTGCTTACCAATGAAGTGAATGAGAAGTCCCGGGCATTAGAGATGGCTGAAGCGGAATTGACACAAGTACAACAAGAGCTTGAAACTGCACACAGAGAAAAGAAAAGAACAGAAGCCAAATTAGATATGTTGAGGAAGGAAGTTGAAGAAATGAATGTTAAGAATCACAGCTTTGGACGAGAGGGTGAAAAACTGCAAGCAGAAAAGGTTCTGCTGCTGCGGCAAATTGAGGATCTTACTGCACAAATAAAGAGCCAACACGTGCCAGCTGAGCTTCATGCCGAGACCAAAAGAGCCTTAGAAGTAACCATTTCTCAGCTTAACCAGAGACTAGCAGAATCTGAAAAGACTCACAGAAAGTCTGAAATGGATATGGAGAAACTGC
  5   1   2       bld Ovi1      in                         CABI1495.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGACTCTGAGGGGAAGGTCAAACAAATGCAAACGCATTTTCTAGCCCTAAAGGATCACCTGACTCAGGAAGCCCTGAGTGGTAGTTCTCGTGCTGAGGACATGGAGGAGCAGTTGAGAGAAGTCAAAGGGAAATACGAGGGAGCATCGGCTGAGGTTGGTAAACTACGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGCAGAGAGGATGCCCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGAGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTCTGTCACCACGGACAAGTTTGAGAACATGCGATGTCTGCTTACCAATGAAGTGAATGAGAAGTCCCGGGCATTAGAGATGGCTGAAGCGGAATTGACACAAGTACAACAAGAGCTTGAAACTGCACACAGAGAAAAGAAAAGAACAGAAGCCAAATTAGATATGTTGAGGAAGGAAGTTGAAGAAATGAATGTTAAGAATCACAGCTTTGGACGAGAGGGTGAAAAACTGCAAGCAGAAAAGGTTCTGCTGCTGCGGCAAATTGAGGATCTTACTGCACAAATAAAGAGCCAACACGTGCCAGCTGAGCTTCATGCCGAGACCAAAAGAGCCTTAGAAGTAACCATTTCTCAGCTTAACCAGAGACTAGCAGAATCTGAAAAGACTCACAGAAAGTCTGAAATGGATATGGAGAAACTGCAAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA       in                   TTpA064j23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCACCTGACTCAGGAAGCCCTGAGTGGGTAGTTCTCGTGCTGAGGACATGGAGGAGCAGTTGAGAGAAGTCAAAGGGAAATACGAGGGAGCATCGGCTGAGGTTGGTAAACTACGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGCAGAGAGGATGCCCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGAGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTCTGTCACCACGGACAAGTTTGAGAACATGCGATGTCTGCTTACCAATGAAGTGAATGAGAAGTCCCGGGCATTAGAGATGGCTGAAGCGGAATTGACACAAGTACAACAAGAGCTTGAAACTGCACACAGAGAAAAGAAAAGAACAGAAGCCAAATTAGATATGTTGAGGAAGGAAGTTGAAGAAATGAATGTTAAGAATCACAGCTTTGGACGAGAGGGTGAAAAACTGCAAGCAGAAAAGGTTCTGCTGCTGCGGCAAATTGAGGATCTTACTGCACAAATAAAGAGCCAACACGTGCCAGCTGAGCTTCATGCCGAGACCAAAAGAGCCTTAGAAGTAACCATTTCTCAGCTTAACCAGAGACTAGCAGAATCTGAAAAGACTCACAGAAAGTCTGAAATGGATATGGAGAAACTGCAGAAAGAGAAGAAAGTATTAACTGANAATATATCTCTGCTTCAGGCTTCAAGTACCCCTAAAGAGATACATGANAGAGAGCTTACGTCCATGANAGCAAAGGCCAAAGAGCTAGAAAGGCAACTGGCTGAGGCACAGAGAAAACGTGAGGAGGAGACTGCTAGAGCATGTAGT
  5   1   2       bld Neu0                               IMAGE:6994110                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCTGAGGTTGGTAAACTAAGAAATCAGCTGCGCCACAATGAACTACTGGTACAAGAGCTACGCAGAGAGGATGCCCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGGGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTCTGTCACCACGGACAAGTTTGAGAACATGCGATGTCTGCTTACCAATGAAGTGAATGAGAAGTCCCGGGCATTAGAGATGGCTGAAGCGGAATTGACACAAGTACAACAAGAGCTTGAAACTGCACACAGAGAAAAGAAAAGAACAGAAGCCAAATTAGATATGTTGAGGAAGGAAGTTGAAGAAATGAATGTTAAGAATCACAGCTTTGGACGAGAGGGTGAAAAACTGCAAGCAGAAAAGGTTCTGCTGCTGCGGCAAATTGAGGATCTTACTGCACAAATAAAGAGCCAACACGTGCCAGCTGAGCTTCATGCCGAGACCAAAAGAGCCTTAGAAGTAACCATTTCTCAGCTTAACCTGAGACTAGCAGAATCTGAAAAGACTCACAGAAAGTCTGAAATGGGAATGGAGAAACTGCTGAAAGAGAAGAAAGTATTAACCTGAAAAATATATCTCCTGCTTCCGGCTTTCTAAGTACCCCTTAAAGAGAATCCATGGAAAGAGAGGCTTACCGTCCATTGTAAACCCAAAGGCCCAAAGACGCTAAGCAAAGGGCAACTTGGGCCGCAAGGCCACCCAAGCAAAACACCTGGGTGGAGGGAATACCTGGCTTAGAAGCCAAGGTTAGTTCCTTCCCGTTTTGGCAAGAACCCCCCCCCTTTTTTATGGGCAGGTAATTTTTCCTTGCCGCACTGTAACCCACCCCCCCCTCCCCAGAGGCCCCCGCTGTCCCATATTGACACGAACCACAAGTGTGGGCATTTGGGAATCAAGGTAACTCTGCAGGCG
  3   1   2       bld Egg       out                   TEgg032i16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGCTTGCGTAAGGAGAATCGCAGGCTGCAAGATGAGGTGGCTGTCTGTGAAGAAGAAAGGGATCGCGCAGAACGCGTGACACAGGAGGCCAGAGAGCAGCTTGCCCTTTCTGTCACCACGGACAAGTTTGAGAACATGCGATGTCTGCTTACCAATGAAGTGAATGAGAAGTCCCGGGCATTAGAGATGGCTGAAGCGGAATTGACACAAGTACAACAAGAGCTTGAAACTGCACACAGAGAAAAGAAAAGAACAGAAGCCAAATTAGATATGTTGAGGAAGGAAGTTGAAGAAATGAATGTTAAGAATCACAGCTTTGGACGAGAGGGTGAAAAACTGCAAGCAGAAAAGGTTCTGCTGCTGCGGCAAATTGAGGATCTTACTGCACAAATAAAGAGCCAACACGTGCCAGCTGAGCTTCATGCCGAGACCAAAAGAGCCTTAGAAGTAACCATTTCTCAGCTTAACCAGAGACTAGCAGAATCTGAAAAGACTCACAGAAAGTCTGAAATGGATATGGAGAAACTGCAGAAAGAGAAGAAAGTATTAACTGAAAATATATCTCTGCTTCAGGCTTCAAGTACCCCTAAAGAGATACATGAAAGAGAGCTTACGTCCATGAAAGCAAAGGCCAAAGAGCTAGAAAGGCAACTGGCTGAGGCACAGAGAAAACGTGAGGAGGAGACTGCTAGAGCATGTAGTCTTCAGTTGGAGAACACCAGTTTTAGGGAGGATTATCTGCCACTGACCACCCACCACAAGGCCACTTCCATGCTGACCAGTGAGCTTGACAAGACTAAAGAAGATCTGGCAACACTTAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-CABJ5308.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACTACAAGCACAGGCAGACAGAGAATCTCTCAAGCGGGCAGATTTGCAAGCAGAGATGAAAAGCATTGTTAGAGAGCGTGAAGAACTGCAAGGGCAGCTGAAAACCAGAACAGAAGAGCTATCAGATTTGCAGGCCCAGATGCGCAAGCTGAAAATTCAGGTAGATAATGAATATGTGAAGCTTAAAGTACACGAAGAAAAAATATTGGAACTGCAAAAGCAAAAAGAACAAATACTGCAAGAGTTGTCTCAAGCCCATGCCAAGAACCAGCAGTCACAAGAGGAAGTGCTGAGACTTCAGACTGCGATCCGCGGGCAGAAAGAGGAGCTGGATACACTGCAGCACTGTATTTCAGAGAAGTACGCTCCACTGGCCAGTATAGAAGAAAGAGAGCAGAGCTTTCAGAAATCACTTGGTGCGCTAGAGAAAGAACTGGAGAAGGAGCGCTGCAGAAGCAGAGAGATTCAGCACAAGCTGGAGCAGCATAAACAGGATGCCCAAGACTTCCAGAAAAAATTGGAGTCTGCAAAATTAGTGTTACAACAGGAGAAAGCTGCTCAGGAGCAGGAGAAGCTTGCACTGCAGAGCCAGTTGGCAGAAACGCACGCTTTGCTTCTTCAATTACAGAAGTCTGAGGCTGAGATGAAGCAGAAACAGCAAGAACTCCGGGAGCAGAACTTAAAGGCTCAAAATAAAATCGGTGAGATGAAAGATCAGCTAAGGAACCAGTACATTCCCATTCAAGAGCATGAGGACCTAAAGGCTATTCTAAGCACAAAAGCATCTCTGGAGGTACAGCTGAAAGAACATATGGGTCTGTATGAAAAGGAACTGGAGAAAGTAAAGAGTCTTGAAAAAGAGCTTGAGAAACAGAAAGATGGTTCTCTTCCCCTTGTGCTCCATGCCCAGGAGGTGCAGGCCTGGCAGAAGAGACAAGCGGAAACACAGAAAAGGCTGCAGGAGAAGGAGGAAGCAGCGCAGGCAGCAGAGCAGCAGCTTAAACAGCTCAAGGATGAACTACACACACTCCGCCTCAACTTGCAGGAGGCTGAGCAAGAGAAAGAAGATTGCACTGCTGCAAGGATAGAACTGGAGCAGAAAGTAGCTCAGATGGAGCAGAGCAGCAGCAAGGGCAATGAAGAGGCCACGCAAATGAGCCAAGAGCTGCAGAAATCACAAGAGGAGAGTGTGAAATTAAGAGAGAAAAGCAGTGTCATTGAACATGAAATTTCCCAGCTCAAAGGAAGGTACGACGAATCTCTGGCCACAATAGAAGAGCTAAAGAGTCGAATCCTGTCGTCAGCCAAAGACCTTAAAGACAAGGACAAAGAGATCTCTGCTCTCGTAAATGATGTGGAGAGGCTGAAAATAGCTAAGGCCCAGATGACAGAAGTTGTTGGGAAGAAACTGTCGTATGAGATCCTGCAGTCTCAGGTGGTGTCTCTGCAGCGCCAACTAGAGGAAACTCAGCAGAAGCACCAAGACATCATTGCCATCTACCGCTCACACCTGCTTAGTGCTGCCCAGGGTCACATGGATGCTGATGTCCAAGATGCCTTGTTACAGATTATCCACATGCGGCAAGAGCTCGTCTTCTAAAACCTTCACTTCTTTTGTTATGTGAATAGAGGCCAGGGACTTACTCAATGTACATTAAACCAGTAATGATTAAATATACATATAATTATGGGAGACCAAAATACAAAATAAACAAAAAATTAGGTATAGGAAGTGGATTAGTAACAGAGGTCAAACATTGGAGCACAAAGAAGATGGGGTAAATAAATGGATGTGTATGGGAAGGTGAATAGAAGGGAGGGTTTGTGTAGGGGAGAAGGATATGTAAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008226019                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCACAGGCAGACAGAGAATCTCTCAAGCGGGCAGATTTGCAAGCAGAGATGAAAAGCATTGTTAGAGAGCGTGAAGAACTGCAAGGGCAGCTGAAAACCAGAACAGAAGAGCTATCAGATTTGCAGGCCCAGATGCGCAAGCTGAAAATTCAGGTAGATAATGAATATGTGAAGCTTAAAGTACACGAAGAAAAAATATTGGAACTGCAAAAGCAAAAAGAACAAATACTGCAAGAGTTGTCTCAAGCCCATGCCAAGAACCAGCAGTCACAAGAGGAAGTGCTGAGACTTCAGACTGCGATCCGCGGGCAGAAAGAGGAGCTGGATACACTGCAGCACTGTATTTCAGAGAAGTACGCTCCACTGGCCAGTATAGAAGAAAGAGAGCAGAGCTTTCAGAAATCACTTGGTGCGCTAGAGAAAGAACTGGAGAAGGAGCGCTGCAGAAGCAGAGAGATTCAGCACAAGCTGGAGCAGCATAAACAGGATGCCCAAGACTTCCAGAAAAAATTGGAGTCTGCAAAATTAGTGTTACAACAGGAGAAAGCTGCTCAGGAGCAGGAGAAGCTTGCACTGCAGAGCCAGTTGGCAGAAACGCACGCTTTGCTTCTTCAATTACAGAAGTCTGAGGCTGAGATGAAGCAGAAACAGCAAGAACTCCGGGAGCAGAACTTAAAGGCTCAAAATAAAATCGGTGAGATGAAAGATCAGCTAAGGAACCAGTACATTCCCATTCAAGAGCATGAGGACCTAAAGGCTATTCTAAGCACAAAAGCATCTCTGGAGGTACAGCTGAAAGAACATATGGGTCTGTATGAAAAGGAACTGGAGAAAGTAAAGAGTCTTGAAAAAGAGCTTGAGAAACAGAAAGATGGTTCTCTTCCCCTTGTGCTCCATGCCCAGGAGGTGCAGGCCTGGCAGAAGAGACAAGCGGAAACACAGAAAAGGCTGCAGGAGAAGGAGGAAGCAGCGCAGGCAGCAGAGCAGCAGCTTAAACAGCTCAAGGATGAACTACACACACTCCGCCTCAACTTGCAGGAGGCTGAGCAAGAGAAAGAAGATTGCACTGCTGCAAGGATAGAACTGGAGCAGAAAGTAGCTCAGATGGAGCAGAGCAGCAGCAAGGGCAATGAAGAGGCCACGCAAATGAGCCAAGAGCTGCAGAAATCACAAGAGGAGAGTGTGAAATTAAGAGAGAAAAGCAGTGTCATTGAACATGAAATTTCCCAGCTCAAAGGAAGGTACGACGAATCTCTGGCCACAATAGAAGAGCTAAAGAGTCGAATCCTGTCGTCAGCCAAAGACCTTAAAGACAAGGACAAAGAGATCTCTGCTCTCGTAAATGATGTGGAGAGGCTGAAAATAGCTAAGGCCCAGATGACAGAAGTTGTTGGGAAGAAACTGTCGTATGAGATCCTGCAGTCTCAGGTGGTGTCTCTGCAGCGCCAACTAGAGGAAACTCAGCAGAAGCACCAAGACATCATTGCCATCTACCGCTCACACCTGCTTAGTGCTGCCCAGGGTCACATGGATGCTGATGTCCAAGATGCCTTGTTACAGATTATCCACATGCGGCAAGAGCTCGTCTTCTAAAACCTTCACTTCTTTTGTTATGTGAATAGAGGCCAGGGACTTACTCAATGTACATTAAACCAGTAATGATTAAATATACATATAATTATGGGAGACCAAAATACAAAATAAACAAAAAATTAGGTATAGGAAGTGGATTAGTAACAGAGGTCAAACATTGGAGCACAAAGAAGATGGGGTAAATAAATGGATGTGTATGGGAAGGTGAATAGAAGGGAGGGTTTGTGTAGGGGAGAAGGATATGTAAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Te4       in                         CAAN5995.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTTCTCAGCTTAACCAGAGACTAGCAGAATCTGAAAAGACTCACAGAAAGTCTGAAATGGATATGGAGAAACTGCAGAAAGAGAAGAAAGTATTAACTGAAAATATATCTCTGCTTCAGGCTTCAAGTACCCCTAAAGAGATACATGAAAGAGAGCTTACGTCCATGAAAGCAAAGGCCAAAGAGCTAGAAAGGCAACTGGCTGAGGCACAGAGAAAACGTGAGGAGGAGACTGCTAGAGCATGTAGTCTTCAGTTGGAGAACACCAGTTTTAGGGAGGATTATCTGCCACTGACCACCCACCACAAGGCCACTTCCATGCTGACCAGTGAGCTTGACAAGACTAAAGAAGATCTGGCAACACTTAAAAAACAAGTTGAAAAAGAATGTGGAGAAAAGGCTGTACTAGAGTCAGAGCTTCAGGCTGAGTGTTCAAAACACGCAGCACTACAAGCACAGGCAGACAGAGAATCTCTCAAGCGGGCAGATTTGCAAGCAGAGATGAAAAGCATTGTTAGAGAGCGTGAAGAACTGCAAGGGCAGCTGAAAACCAGAACAGAAGAGCTATCAGATTTGCAGGCCCAGATGCGCAAGCTGAAAATTCAGGTAGATAATGAATATGTGAAGCTTAAAGTACACGAAGAAAAAATATTGGAACTGCAAAAGCAAAAAGAACAAATACTGCAAGAGTTGTCTCAAGCCCATGCCAAGAACCAGCAGTCACAAGAGGAAGTGCTGAGACTTCAGACTGCGATCCGCGGGCAGAAAGAGGAGCTGGATACACTGCAGCACTGTATTTCA
  5   1   2       bld Te1       in                         CBWN4491.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAACGCGCAGCACTACAAGCACAGGCAGACAGAGAATCTCTCAAGCGGGCAGATTTGCAAGCAGAGATGAAAAGCATTGTTAGAGAGCGTGAAGAACTGCAAGGGCAGCTGAAAACCAGAACAGAAGAGCTATCAGATTTGCAGGCCCAGATGCGCAAGCTGAAAATTCAGGTAGATAATGAATATGTGAAGCTTAAAGTACACGAAGAAAAAATATTGGAACTGCAAAAGCAAAAAGAACAAATACTGCAAGAGTTGTCTCAAGCCCATGCCAAGAACCAGCAGTCACAAGAGGAAGTGCTGAGACTTCAGACTGCGATCCGCGGGCAGAAAGAGGAGCTGGATACACTGCAGCACTGTATTTCAGAGAAGTACGCTCCACTGGCCAGTATAGAAGAAAGAGAGCAGAGCTTTCAGAAATCACTTGGTGCTCTAGAGAAAGAACTGGAGAAGGAGCGCTGCAGAAGCAGAGAGATTCAGCACAAGCTGGAGCAGCATAAACAGGATGCCCAAGACTTCCAGAAAAAATTGGAGTCTGCAAAATTAGTGTTACAACAGGAGAAAGCTGCTCAGGAGCAGGAGAAGCTTGCACTGCAGAGCCAGTTGGCAGAAACGCACGCTTTGCTTCTTCAATTACAGAAGTCTGAGGCTGAGATGAAGCAGAAACAGCAAGAACTCCGGGAGCAGAACTTAAAGGCTCAAAATAAAATCGGTGAGATGAAAGATCAGCTAA
  5   1   2       bld Tad5                                 XZT39669.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGAAGCTTAAAGTACACGAAGAAAAAATATTGGAACTGCAAAAGCAAAAAGAACAAATACTGCAAGAGTTGTCTCAAGCCCATGCCAAGAACCAGCAGTCACAAGAGGAAGTGCTGAGACTTCAGACTGCGATCCGCGGGCAGAAAGAGGAGCTGGATACACTGCAGCACTGTATTTCAGAGAAGTACGCTCCACTGGCCAGTATAGAAGAAAGAGAGCAGAGCTTTCAGAAATCACTTGGTGCGCTAGAGAAAGAACTGGAGAAGGAGCGCTGCAGAAGCAGAGAGATTCAGCACAAGCTGGAGCAGCATAAACAGGATGCCCAAGACTTCCAGAAAAAATTGGAGTCTGCAAAAGTAGTGTTACAACAGGAGAAAGCTGCTCAGGAGCAGGAGAAGCTTGCACTGCAGAGCCAGTTGGCAGAAACGCACGCTTTGCTTCTTCAATTACAGAAGTCTGAGGCTGAGATGAAGCAGAAACAGCAAGAACTCCGGGAGCAGAACTTAAAGGCTCAAAATAAAATCGGTGAGATGAAAGATCAGCTAAGGAACCAGTACATTCCCATTCAAGAGCATGAGGACCTAAAGGCTATTCTAAGCACAAAAGCATCTCTGGAGGTACAGCTGANAGAACATATGGGTCTGTATGAAAAGGAACTGGAGAAAGTAAAGAGTCTTGAAAAAGAGCTTGAGAAACAGAAAGATGGTTCTCTTCCCCTTGTGCTCCATGCCCAGGAGGTGCAGGCCTGGCAGAAGAGACAAGCGGAAA
  5   1   2       bld Ovi1      in                         CABI4706.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTATAGAAGAAAGAGAGCAGAGCTTTCAGAAATCACTTGGTGCGCTAGAGAAAGAACTGGAGAAGGAGCGCTGCAGAAGCAGAGAGATTCAGCACAAGCTGGAGCAGCATAAACAGGATGCCCAAGACTTCCAGAAAAAATTGGAGTCTGCAAAATTAGTGTTACAACAGGAGAAAGCTGCTCAGGAGCAGGAGAAGCTTGCACTGCAGAGCCAGTTGGCAGAAACGCACGCTTTGCTTCTTCAATTACAGAAGTCTGAGGCTGAGATGAAGCAGAAACAGCAAGAACTCCGGGAGCAGAACTTAAAGGCTCAAAATAAAATCGGTGAGATGAAAGATCAGCTAAGGAACCAGTACATTCCCATTCAAGAGCATGAGGACCTAAAGGCTATTCTAAGCACAAAAGCATCTCTGGAGGTACAGCTGAAAGAACATATGGGTCTGTATGAAAAGGAACTGGAGAAAGTAAAGAGTCTTGAAAAAGAGCTTGAGAAACAGAAAGATGGTTCTCTTCCCCTTGTGCTCCATGCCCAGGAGGTGCAGGCCTGGCAGAAGAGACAAGCGGAAACACAGAAAAGGCTGCAGGAGAAGGAGGAAGCAGCGCAGGCAGCAGAGCAGCAGCTTAAACAGCTCAAGGATGAACTACACACACTCCGCCTCAACTTGCAGGAGGCTGAGCAAGAGAAAGAAGATTGCACTGCTGCAAGGATAGAACTGGAGCAGAAAGTAGCTCAGATGGAGCAGAGCAGCAGCAAGGGCAATGAACAGGCCACGCANATGAGCCAAGAGCTGCAGAAATCACAAGAGGAGAGTGTGAAATTAAGAGAGAAAAG
  5   1   2       bld Gas       in                   TGas135l12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGGGCAGAAACAGCAAGAACTCCGGGAGCAGAACTTAAAGGCTCAAAATAAAATCGGTGAGATGAAAGATCAGCTAAGGAACCAGTACATTCCCATTCAAGAGCATGAGGACCTAAAGGCTATTCTAAGCACAAAAGCATCTCTGGAGGTACAGCTGAAAGAACATATGGGTCTGTATGAAAAGGAACTGGAGAAAGTAAAGAGTCTTGAAAAAGAGCTTGAGAAACAGAAAGATGGTTCTCTTCCCCTTGTGCTCCATGCCCAGGAGGTGCAGGCCTGGCAGAAGAGACAAGCGGAAACACAGAAAAGGCTGCAGGAGAAGGAGGAAGCAGCGCAGGCAGCAAAGCAGCAGCTTAAACAGCTCAAGGATGAACTACACACACTCCGCCTCAACTTGCAGGAGGCTGAGCAAGAGAAAGAAGATTGCACTGCTGCAAGGATAGAACTGGAGCAGAAAGTAGCTCAGATGGAGCAGAGCAGCAGCAAGGGCAATGA
  5   1   2       bld Gas                            TGas034b03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGGGCAGAAACAGCAANAACTCCGGGAGCAGAACTTAAAGGCTCAAAATAAAATCGGTGAGATGAAAGATCAGCTAAGGAACCAGTACATTCCCATTCAAGAGCATGAGGACCTAAAGGCTATTCTAAGCACAAAAGCATCTCTGGAGGTACAGCTGAAAGAACATATGGGTCTGTATGAAAAGGAACTGGAGAAAGTAAAGAGTCTTGAAAAAGAGCTTGAGAAACAGAAAGATGGTTCTCTTCCCCTTGTGCTCCATGCCCAGGAGGTGCAGGCCTGGCAGAAGAGACAAGCGGAAACACAGAAAAGGCTGCAGGAGAAGGAGGAAGCAGCGCAGGCAGCAGAGCAGCAGCTTAAACAGCTCAAGGATGAACTACACACACTCCGCCTCAACTTGCAGGAGGCTGAGCAAGAGAAAGAAGATTGCACTGCTGCAAGGATAGAACTGGAGCAGAAAGTAGCTCAGATGGAGCAGAGCAGCAGCAAGGGCAATGAACAGGCCACGCAAATGAGCCAAGAGCTGCAGAAATCACAAGAGGAGAGTGTGAAATTAAGAGAGAAAAGCAGTGTCATTGAACATGAAATTTCCCAGCTCAAAGGAAGGTACGACGAATCTCTGGCCACAATAGAAGAGCTAAAGAGTCGAATCCTGTCGTCAGC
  5   1   2       bld Hrt1      in                          CAAQ496.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGAACTCCGGGAGCAGAACTTAAAGGCTCAAAATAAAATCGGTGAGATGAAAGATCAGCTAAGGAACCAGTACATTCCCATTCAAGAGCATGAGGACCTAAAGGCTATTCTAAGCACAAAAGCATCTCTGGAGGTACAGCTGAAAGAACATATGGGTCTGTATGAAAAGGAACTGGAGAAAGTAAAGAGTCTTGAAAAAGAGCTTGAGAAACAGAAAGATGGTTCTCTTCCCCTTGTGCTCCATGCCCAGGAGGTGCAGGCCTGGCAGAAGAGACAAGCGGAAACACAGAAAAGGCTGCAGGAGAAGGAGGAAGCAGCGCAGGCAGCAGAGCAGCAGCTTAAACAGCTCAAGGATGAACTACACACACTCCGCCTCAACTTGCAGGAGGCTGAGCAAGAGAAAGAAGATTGCACTGCTGCAAGGATAGAACTGGAGCAGAAAGTAGCTCAGATGGAGCAGAGCAGCAGCAAGGGCAATGAAGAGGCCACGCAAATGAGCCAAGAGCTGCAGAAATCACAAGAGGAGAGTGTGAAATTAAGAGAGAAAAGCAGTGTCATTGAACATGAAATTTCCCAGCTCAAAGGAAGGTACGACGAATCTCTGGCCACAATAGAAGAGCTAAAGAGTCGAATCCTGTCGTCAGCCAAAGACCTTAAAGACAAGGACAAAGAGATCTCTGCTCTCGTAAATGATGTGGAGAGGCTGAAAATAGCTAAGGCCCAGATGACAGAAGTTGTTGGGAAGAAACTGTCGTATGAGATCCTGCAGTCTCAGGTGGTGTCTCTGCAGCGCCAACTAGAGGAAACTCAGCAGAAGCACCAAGACATCATTGGCATCTACCGCTCACACCTGCTTAGTGCTG
  3   1   2       bld Ovi1      in                         CABI4706.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCTTGAGAAACAGAAAGATGGTTCTCTTCCCCTTGTGCTCCATGCCCAGGAGGTGCAGGCCTGGCAGAAGAGACAAGCGGAAACACAGAAAAGGCTGCAGGAGAAGGAGGAAGCAGCGCAGGCAGCAGAGCAGCAGCTTAAACAGCTCAAGGATGAACTACACACACTCCGCCTCAACTTGCAGGAGGCTGAGCAAGAGAAAGAAGATTGCACTGCTGCAAGGATAGAACTGGAGCAGAAAGTAGCTCAGATGGAGCAGAGCAGCAGCAAGGGCAATGAACAGGCCACGCAAATGAGCCAAGAGCTGCAGAAATCACAAGAGGAGAGTGTGAAATTAAGAGAGAAAAGCAGTGTCATTGAACATGAAATTTCCCAGCTCAAAGGAAGGTACGACGAATCTCTGGCCACAATAGAAGAGCTAAAGAGTCGAATCCTGTCGTCAGCCAAAGACCTTAAAGACAAGGACAAAGAGATCTCTGCTCTCGTAAATGATGTGGAGAGGCTGAAAATAGCTAAGGCCCAGATGACAGAAGTTGTTGGGAAGAAACTGTCGTATGAGATCCTGCAGTCTCAGGTGGTGTCTCTGCAGCGCCAACTAGAGGAAACTCAGCAGAAGCACCAAGACATCATTGCCATCTACCGCTCACACCTGCTTAGTGCTGCCCAGGGTCACATGGATGCTGATGTCCAAGATGCCTTGTTACAGATTATCCACATGCGGCAAGAGCTCGTCTTCTAAAACCTTCACTTCTTTTGTTATGTGAATAGAGGCCAGGGACTTACTCAATGTACATTAAACCAGTAATGATTAAATATACATATAATTATGGGAGACCAAAATAC
  5   1   2       bld Ski1      in                         CABJ5308.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAAACAGAAAGATGGTTCTCTTCCCCTTGTGCTCCATGCCCAGGAGGTGCAGGCCTGGCAGAAGAGACAAGCGGAAACACAGAAAAGGCTGCAGGAGAAGGAGGAAGCAGCGCAGGCAGCAGAGCAGCAGCTTAAACAGCTCAAGGATGAACTACACACACTCCGCCTCAACTTGCAGGAGGCTGAGCAAGAGAAAGAAGATTGCACTGCTGCAAGGATAGAACTGGAGCAGAAAGTAGCTCAGATGGAGCAGAGCAGCAGCAAGGGCAATGAAGAGGCCACGCAAATGAGCCAAGAGCTGCAGAAATCACAAGAGGAGAGTGTGAAATTAAGAGAGAAAAGCAGTGTCATTGAACATGAAATTTCCCAGCTCAAAGGAAGGTACGACGAATCTCTGGCCACAATAGAAGAGCTAAAGAGTCGAATCCTGTCGTCAGCCAAAGACCTTAAAGACAAGGACAAAGAGATCTCTGCTCTCGTAAATGATGTGGAGAGGCTGAAAATAGCTAAGGCCCAGATGACAGAAGTTGTTGGGAAGAAACTGTCGTATGAGATCCTGCAGTCTCAGGTGGTGTCTCTGCAGCGCCAACTAGAGGAAACTCAGCAGAAGCACCAAGACATCATTGCCATCTACCGCTCACACCTGCTTAGTGCTGCCCAGGGTCACATGGATGCTGATGTCCAAGATGCCTTGTTACAGATTATCCACATGCGGCAAGAGCTCGTCTTCTAAAACCTTCACTTCTTTTGTTATGTGAATAGAGGCCAGGGACTTACTCAATGTACATTAAACCAGTAATGATTAAATATACATATAATTATGGGAGACCAAAATACAAAATAAACAAAAAATTAGGTATAGGAAGTGGATTAGTAACAGA
  3   1   2       bld Te4       in                         CAAN2679.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGAAGAGCCAAGCGGAAACACAGAAAAGGCTGCAGGAGAAGGAGGAAGCAGCGCAGGCAGCAGAGCAGCAGCTTAAACAGCTCAAGGATGAACTACACACACTCCGCCTCAACTTGCAGGAGGCTGAGCAAGAGAAAGAAGATTGCACTGCTGCAAGGATAGAACTGGAGCAGAAAGTAGCTCAGATGGAGCAGAGCAGCAGCAAGGGCAATGAAGAGGCCACGCAAATGAGCCAAGAGCTGCAGAAATCACAAGAGGAGAGTGTGAAATTAAGAGAGAAAAGCAGTGTCATTGAACATGAAATTTCCCAGCTCAAAGGAAGGTACGACGAATCTCTGGCCACAATAGAAGAGCTAAAGAGTCGAATCCTGTCGTCAGCCAAAGACCTTAAAGACAAGGACAAAGAGATCTCTGCTCTCGTAAATGATGTGGAGAGGCTGAAAATAGCTAAGGCCCAGATGACAGAAGTTGTTGGGAAGAAACTGTCGTATGAGATCCTGCAGTCTCAGGTGGTGTCTCTGCAGCGCCAACTAGAGGAAACTCAGCAGAAGCACCAAGACATCATTGCCATCTACCGCTCACACCTGCTTAGTGCTGCCCAGGGTCACATGGATGCTGATGTCCAAGATGCCTTGTTACAGATTATCCACATGCGGCAAGAGCTCGTCTTCTAAAACCTTCACTTCTTTTGTTATGTGAATAGAGGCCAGGGACTTACTCAATGTACATTAAACCAGTAATGATTAAATATACATATAATTATGGGAGACCAAAATAC
  5   1   2       bld Ski1      in                         CABJ9156.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCGGCACGAGGCCACAATAGAAGAGCTAAAGAGTCGAATCCTGTCGTCAGCCAAAGACCTTAAAGACAAGGACAAAGAGATCTCTGCTCTCGTAAATGATGTGGAGAGGCTGAAAATAGCTAAGGCCCAGATGACAGAAGTTGTTGGGAAGAAACTGTCGTATGAGATCCTGCAGTCTCAGGTGGTGTCTCTGCAGCGCCAACTAGAGGAAACTCAGCAGAAGCACCAAGACATCATTGCCATCTACCGCTCACACCTGCTTAGTGCTGCCCAGGGTCACATGGATGCTGATGTCCAAGATGCCTTGTTACAGATTATCCACATGCGGCAAGAGCTCGTCTTCTAAAACCTTCACTTCTTTTTTTATGTGAATAGAGGCCAGGGACTTACTCAATGTACATTAAACCAGTAATGATTAAATATACATATAATTATGGGAGACCAAAATACAAAATAAACAAAAAATTAGGTATAGGAAGTGGATTAGTAACAGAGGTCAAACATTGGAGCACAAAGAAGATGGGGTAAATAAATGGATGTGTATGGGAAGGTGAATAGAAGGGAGGGTTTGTGTAGGGGAGAAGGATATGTAAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGA
  5   1   2       bld Eye       in                         CCAX8920.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGTTGTTGGGAAGAAACTGTCGTATGAGATCCTGCAGTCTCAGGTGGTGTCTCTGCAGCGCCAACTAGAGGAAACTCAGCAGAAGCACCAAGACATCATTGCCATCTACCGCTCACACCTGCTTAGTGCTGCCCAGGGTCACATGGATGCTGATGTCCAAGATGCCTTGTTACAGATTATCCACATGCGGCAAGAGCTCGTCTTCTAAAACCTTCACTTCTTTTGTTATGTGAATAGAGGCCAGGGACTTACTCAATGTACATTAAACCAGTAATGATTAAATATACATATAATTATGGGAGACCAAAATACAAAATAAACAAAAAATTAGGTATAGGAAGTGGATTAGTAACAGAGGTCAAACATTGGAGCACAAAGAAGATGGGGTAAATAAATGGATGTGCATGGGAAGGTGAATAGAAGGGAGGGTTTGTGTAGGGGAGAAGGATATGTAAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAGAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGTGAGATTTGAAGC
  5   1   2       bld Tail      in                          CBSW966.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTAAATATACATATAATTATGGGAGACCAAAATACAAAATAAACAAAAAATTAGGTATAGGAAGTGGATTAGTAACAGAGGTCAAACATTGGAGCACAAAGAAGATGGGGTAAATAAATGGATGTGCATGGGAAGGTGAATAGAAGGGAGGGTTTGTGTAGGGGAGAAGGATATGTAAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAGAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAG
  5   1   2       bld Egg       in                   TEgg010d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAATACAAAATAAACAAAAAATTAGGTATAGGAAGTGGATTAGTAACAGAGGTCAAACATTGGAGCACAAAGAAGATGGGGTAAATAAATGGATGTGTATGGGAAGGTGAATAGAAGGGAGGGTTTGTGTAGGGGAGAAGGATATGTAAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGT
  5   1   2       bld Tad5      in                         XZT27611.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGGATTAGTAACAGAGGTCAAACATTGGAGCACAAAGAAGATGGGGTAAATAAATGGATGTGTATGGGAAGGTGAATAGAAGGGAGGGTTTGTGTAGGGGAGAAGGATATGTAAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATG
  5   1   2       bld Hrt1      in                         CAAQ8257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAGGTGAATAGAAGGGAGGGTTTGTGTAGGGGAGAAGGATATGTAAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAAGCTAG
  5   1   2       bld Egg       out                 TEgg057i02.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAGAAGGATATGTAAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAATACTGCATAGCTGTAG
  3   1   2       bld Ski1      in                         CABJ5308.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATATGTAAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAACCTGAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG43580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTA
  5   1   2       bld Tad5                                 XZT60029.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTGACTTAATTGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGG
  3   1   2      seed Ski1      in                         CABJ9156.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAGGGTATAGTAATGTGATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAACCT
  3   1   2       bld Gas       in                    TGas135l12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTATAGTAATGTGATGGGTGGAGGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAGAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCCATGTTAATAAAATTAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       out                  TGas138h24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAGAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATG
  3   1   2       bld Gas       in                    TGas089d13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAGAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACGGTTCAATAAATAAACCATGTTAACCTGAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                  TGas089d13.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGGGTTGGAGGCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAGAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTACATACTGCATAGCT
  3   1   2       bld Ovi1 5g3  out                        CABI8298.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAACCT
  3   1   2       bld Gas       out                   TGas138h22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTAAAAGTTGCCTGTTGGGCTGTGTATAGCGAGAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAACCGAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ8257.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTTGTTGGGCCGTGTATAGCGAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATNTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTT
  3   1   2       bld TpA       in                    TTpA064j23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTGGGCTGTGTATAGCGAAAGGAAGAGCAGCAGGAGATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT27611.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATGAGCGAGAGTAAGGTAGAAAATTGATATTGGATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATNTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAACCTG
  3   1   2       bld Te1       in                         CBWN4491.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGATGAGCGAGAGTAAGGTAGAAAATGGATATTGGATTGATGGCATGTAATGCTGGGTATGTAAGTGAGTACAGGGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATNTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCATTAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGCGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGATCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT65045.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAACCTGAAAAAAAAAAAAAAAGG
  3   1   2       bld Ovi1      in                         CABI4795.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAACCGT
  3   1   2       bld Te4       in                         CAAN5995.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAACCTG
  3   1   2       bld Hrt1      in                          CAAQ496.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTGAGGGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAACCT
  5   1   2       bld Tad5      in                         XZT65045.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCATAAACGCTGGGTGAGGCAGAGAGGGTATGTAAGTGAGTACAGCGCACAGGGAAGGTACCAGAGAATAGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAAT
  3   1   2       chi Gas8      out                         st28a08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGCTGGGAATCGGAGTGTTCTGCTTGCTGGGGCTGGGAGTGCTGTACCATGTATACTCGGGCTTCCTCACCGGCAAGTTCTCAGCCTTCCTCCTGGGGGACAGAGCGGAGGATCCCGGGCCCGGGGAGGACACAGTGGATCTAAGGGAGCTGCTGGCTGTGTCGGTGCGGGCTGCGGAGCTTGGGGGGCTGGAGGTGAAGAAGGTCCGGGAAAGTAACTCGCTCAATGAGAAGGCAAAGGGCAAAACCATGGAGGGGGCGGACGACAAGATGACCAGTGGGGATGTGCTGTCCAATAAGAAAATCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATT
  3   1   2       bld Gas7      in                         XZG38687.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGCGTCCGGAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATTTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAAAAAAAAAAAAAAAGAAAGAAAAAAAAATT
  5   1   2       bld Gas7      in                         XZG38687.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGACGGCAGCACAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATTTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTaaaaaaaaaaaaaaaagaaagaaaaaaaaattaaagaaaaaaaaaaaaaaaG
  3   1   2       bld TpA       ?                    TTpA066o19.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGATCCACATACAATACAAGTTTTTGTATATTAATGCATCTTTTAGCTCAGGCGACATGTTTATTTTCACCCTTGTCCGCAAAACAGATTTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCATTAATAGAACTGAGAGTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACAATCGTGCCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCCATATTTATTTTAGATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGGTGGTCTGACAGAAATTCCATGCCAACTAAATAGTGCATCGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCCGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATATAATCTATTCATTTCTAGAGGCAGGAAGAGCTTGCTCAGTCCTATTTATAAAAAGCATTTGTGACACATTCAAACATAACCATGTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                        CABE12785.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAACCTG
  5   1   2       bld Ova1      in                        CABE12785.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAATTTGAGGTGAGATTTGAAGCCGCATGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAACCTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye       in                         CCAX8920.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTTTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTTAAACCTG
  3   1   2       bld Egg       in                    TEgg010d03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGATAAAAAGGGAAAGGATTTTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTAAACCTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tail      in                          CBSW966.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGGGGGATGTTTTAGGAGAACCACATACAATACTTGTTTTTGTATATTAATGCATCTTTTTGCTCAGCTGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATACTGAGCACCAAATTAACTTCAATATTACGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCTTGGCTGCATTTGTGTACAATTCAATAAATAAACCATGTAAACCTAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG43580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCACATACAATACCCGCTTTGGTATATTAATGCATCTTTTTGCTCAGCAGACATCTTTATTTTCACCCTTGTCCGCAAAACAGATCTTAGTTGTCATTCTGAGCACCAAATTAACTTCAATATTGCGGCCAAAAATAGAACTGAGACTTAGTGGGAAAAACCATTCCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTCCACTCCGGGTAAATAGCCGGTAAATAGACATAGAATTCTGTATTTATTTTATAAATATATTTTTTGAAGGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTTTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGGGGCAGGGC
  5   1   2       bld Gas0                                 dad32f02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGTAGAACTGAGACTTAGTGGGGAAAAACCATACCAGGCTCCAGAATACCAGTTTACACTCCTACCAGTTTACACTCCGAGTAAATAGACAGTAAATAGACATAGAATTCTATATTTATTTTATATATATATTTTTTGTATGGGTATTTTGATCACTTACTTCATGGAATGATCAGCTGGTCTGACAGAAATTCCATGCTAACTAAATACTGCATAGCTGTAGAGGTGGCAGGACCATACCATTATCCAGTATATGCTCATGTGCCTTTCTCTTTATTATGTCTTTACAACTGTTTCTAGCAGTGTTTTTGCTGCATCTCTATACAGTGCTATGGCTTTTTTGCTCTCATTGCCAGTATTTTTGCTCATGCCAGACAAAGGCTAGCCTGGCTTATTTTATCTTTTCATTTATAGAGGCAGGAAGATGTGTGCTCAGTCCTATTTCT

In case of problems mail me! (