Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012153635 Xt7.1-TNeu116m24.3.5 - 70 ESTs
                                                                       ......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu116m24.3.5                           GCAGGTCATGTGATTAGCAGCTGAGGGTTCTACGGGTGTGCCATGGCAGAGCTTAGTGGTACTGGGTATTGGGCGCTGGATACCATGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGAAGGGGAAGTGCGGGAGAGGATGCTGGTCGCGTATTATAGATATAGCGCAGCAAGATCCTCTGTCGATTCAAACATGGATGATATCTGCAAGCTACTTAGAAGTACAGGCTACTCCAGCCAGCCAGGCGCTAAAAGACCCCCAAACTACCCCGAGAGCTACTTCAGCCGCGTGCCAATTAGTGAAACCTTTATCAGCATGGTGATTGGCAGATTAAGATCAGATGATATCTATAACCAAGTGTCTGCCTATCCATTGCCAGAGCACCGTAGTACGGCACTTGCCACGCAGGCTGCCATTTTGTATGTGATTCTCTACTTCCACCCACCAACTCTGCACACTCACCAAGCCAAAATGAGAGAAATAGTGGATAAGTATTTCCCAGATAACTGGGTTATCAGCATCTATATGGGGATCACTGTGAATCTGATGGAAGTGTGGGAGCCCTACAAGGCTGCAAAGACTGCTTTGAATTACACACTGGACCTGCCCAATATCAAGGAGCAGGCTTCCAGGTATGCAAAAATCATTGAGAGCCTGCACCCCCAGGTTCAGCAGTTCCTGAAGGAGGGCTTTCTCCGAGAGGAGTTTGTACTGGATAACATCCCCAAGCTGCTGAATTGTCTGCGGGACTGCAATGTCGCCATCCGATGGCTCATGCTTCACACAGCTGATTCTGCTTATGATCCAAACAACAAACGGCTTCGCCAGGTAAAAGATCAGGTTCTTGCTGATTCCAAGTACAACCCCAAGATTCTGTTCCAGTTGCTGCTGGATACTGCACAGTTTGAGTTCCTTCTGAAGGAGATGTTCAAACAGATGCTGTCAGAGAAGCAAAACAAGTGGGAAAGCTATAAGAAAGAAGGATCAGAAAGAATGACGGAGCTGGCAGATGTTTTCTCTGGCGTCAAACCCCTCACCAGGGTAGAGAAAAATGAACACTTGCAAGCCTGGTTCAGAGAGATCGCCAAGCAAATTCACTCCTTAAATTATGATGATTCCACTGCTGCTGGGAGGAAGACCGTTCAGCTCATCCAGGCTCTTGAAGAGGTCCAAGAATTCCATCAGCTGGAGACAAACCTTCAGGTGTGCCAGTTCTTGGCTGATACCCGCAAGTTCCTCCATCAAATGATCCGCACCATTAACATTAAAGAGGAGGTTCTGATCACTATGCAGATTGTGGGTGACCTCTCGTATGCCTGGCAGCTGATTGACAGCTTCACAGCAATCATGCAAGAGAGTATCAGAGCCAACCCGTCCATGGTTACCAAGCTGAGGGCCACTTTCCTTAAGCTGGCCTCTGCACTTGATTTGCCCTTGCTACGCATCAATCAGGCAAACAGCCCTGACCTACTCAGTGTATCCCAGTACTACTCAGGAGAGCTGGTTTTCTATGTCAGGAAGGTTCTGCAGATCATCCCGGAGAGCATGTTCACTTCCCTAGCCAAGATCATCAAGTTACAGACACATGACATTATCGAAGTGCCAACCCGATTGGACAAGGACAAACTGAGAGACTACGCTCAGCTTGGGGCTAGATATGAGGTTGCCAAGTTGACCAATGCCATTTCAATCTTTACTGAAGGAATTCTAATGATGAAGACTACACTTGTAGGCATAATCAAGGTGGATCCAAAGCAGCTTTTGGAGGATGGGATCAGGAAGGAGTTGGTTAAAAGAGTTGCTGTTGCTCTACACAAAGGGCTTATCTTCAACTCCAGAGCAAAGCCCAGCGAACTGCTGCCAAAGCTGAAAGACATGGCTGCCACCATGGATGGATTCCATCGCTCCTTCGAGTACATACAAGACTACGTCAGCATTTATGGCTTGAAAATTTGGCAGGAGGAAGTATCCCGTATTGTTAATTACAACGTAGAACAGGAATGCAACAACTTCCTAAGAACAAAGATTCAAGACTGGCAGAGCATGTATCAGTCAACTCACATCCCTATTCCCAAATTTCCTCCTGTGGATGAATCAATGACGTTTATAGGACGTCTGTGTCGGGAAATCCTGAGAATTACTGATCCGAAGGTTACGTGTTACATAGATCAGATGAACACGTGGTACGACATGAAAACTCACCAGGAAGTCACTAATAACCACCTCTTCTCAGAGATCAACGATTCACTGGGAACTTTTGGCTTAAATGGCTTGGACAGGTTACTTTGCTTTATGATAGTGAAGGAACTGCAGAACTTCATCCTCTTGTATCAGAGGTTAATTCTGAGGGATAAAAGTGCCCAGGAGACATTACGGGCCTTACAGAAGGTAGTTACTCCAGTTAAAGGGATTGTAGCTAATTCTGCCAAAATATACTCTGCTGCCATTGCAAAAACCCAGAAAATCTGGCCTGCTTATCTTGATGCTATAATGAAGGTTGGACAGATGCAAGTGTTAAGACAACAGATTGCCAATGAGTTAAACTACTCGTGTAAATTTGACTCTAAGCACCTGGCAGGAGCCCTAGAGAACTTTAATGAAGCCATATTGGCTGACATACAAGCCCACTACCAGGACCCGAGCCTTCCCTGCCCACGAGAAGACAACACGCTCCTATATGAGATCACTGCATACCTGGAAGCAGCTGGGACACACAACCCCTTGAACAAAATTTACATTACTACCAAGCAGCTCTCTTTCTTCCCTATTGTGAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008265364                                 CATGTGATTAGCAGCTGAGGGTTCTACGGGTGTGCCATGGCAGAGCTTAGTGGTACTGGGTATTGGGCGCTGGATACCATGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGAAGGGGAAGTGCGGGAGAGGATGCTGGTCGCGTATTATAGATATAGCGCAGCAAGATCCTCTGTCGATTCAAACATGGATGATATCTGCAAGCTACTTAGAAGTACAGGCTACTCCAGCCAGCCAGGCGCTAAAAGACCCCCAAACTACCCCGAGAGCTACTTCAGCCGCGTGCCAATTAGTGAAACCTTTATCAGCATGGTGATTGGCAGATTAAGATCAGATGATATCTATAACCAAGTGTCTGCCTATCCATTGCCAGAGCACCGTAGTACGGCACTTGCCACGCAGGCTGCCATTTTGTATGTGATTCTCTACTTCCACCCACCAACTCTGCACACTCACCAAGCCAAAATGAGAGAAATAGTGGATAAGTATTTCCCAGATAACTGGGTTATCAGCATCTATATGGGGATCACTGTGAATCTGATGGAAGTGTGGGAGCCCTACAAGGCTGCAAAGACTGCTTTGAATTACACACTGGACCTGCCCAATATCAAGGAGCAGGCTTCCAGGTATGCAAAAATCATTGAGAGCCTGCACCCCCAGGTTCAGCAGTTCCTGAAGGAGGGCTTTCTCCGAGAGGAGTTTGTACTGGATAACATCCCCAAGCTGCTGAATTGTCTGCGGGACTGCAATGTCGCCATCCGATGGCTCATGCTTCACACAGCTGATTCTGCTTATGATCCAAACAACAAACGGCTTCGCCAGGTAAAAGATCAGGTTCTTGCTGATTCCAAGTACAACCCCAAGATTCTGTTCCAGTTGCTGCTGGATACTGCACAGTTTGAGTTCCTTCTGAAGGAGATGTTCAAACAGATGCTGTCAGAGAAGCAAAACAAGTGGGAAAGCTATAAGAAAGAAGGATCAGAAAGAATGACGGAGCTGGCAGATGTTTTCTCTGGCGTCAAACCCCTCACCAGGGTAGAGAAAAATGAACACTTGCAAGCCTGGTTCAGAGAGATCGCCAAGCAAATTCACTCCTTAAATTATGATGATTCCACTGCTGCTGGGAGGAAGACCGTTCAGCTCATCCAGGCTCTTGAAGAGGTCCAAGAATTCCATCAGCTGGAGACAAACCTTCAGGTGTGCCAGTTCTTGGCTGATACCCGCAAGTTCCTCCATCAAATGATCCGCACCATTAACATTAAAGAGGAGGTTCTGATCACTATGCAGATTGTGGGTGACCTCTCGTATGCCTGGCAGCTGATTGACAGCTTCACAGCAATCATGCAAGAGAGTATCAGAGCCAACCCGTCCATGGTTACCAAGCTGAGGGCCACTTTCCTTAAGCTGGCCTCTGCACTTGATTTGCCCTTGCTACGCATCAATCAGGCAAACAGCCCTGACCTACTCAGTGTATCCCAGTACTACTCAGGAGAGCTGGTTTTCTATGTCAGGAAGGTTCTGCAGATCATCCCGGAGAGCATGTTCACTTCCCTAGCCAAGATCATCAAGTTACAGACACATGACATTATCGAAGTGCCAACCCGATTGGACAAGGACAAACTGAGAGACTACGCTCAGCTTGGGGCTAGATATGAGGTTGCCAAGTTGACCAATGCCATTTCAATCTTTACTGAAGGAATTCTAATGATGAAGACTACACTTGTAGGCATAATCAAGGTGGATCCAAAGCAGCTTTTGGAGGATGGGATCAGGAAGGAGTTGGTTAAAAGAGTTGCTGTTGCTCTACACAAAGGGCTTATCTTCAACTCCAGAGCAAAGCCCAGCGAACTGCTGCCAAAGCTGAAAGACATGGCTGCCACCATGGATGGATTCCATCGCTCCTTCGAGTACATACAAGACTACGTCAGCATTTATGGCTTGAAAATTTGGCAGGAGGAAGTATCCCGTATTGTTAATTACAACGTAGAACAGGAATGCAACAACTTCCTAAGAACAAAGATTCAAGACTGGCAGAGCATGTATCAGTCAACTCACATCCCTATTCCCAAATTTCCTCCTGTGGATGAATCAATGACGTTTATAGGACGTCTGTGTCGGGAAATCCTGAGAATTACTGATCCGAAGGTTACGTGTTACATAGATCAGATGAACACGTGGTACGACATGAAAACTCACCAGGAAGTCACTAATAACCACCTCTTCTCAGAGATCAACGATTCACTGGGAACTTTTGGCTTAAATGGCTTGGACAGGTTACTTTGCTTTATGATAGTGAAGGAACTGCAGAACTTCATCCTCTTGTATCAGAGGTTAATTCTGAGGGATAAAAGTGCCCAGGAGACATTACGGGCCTTACAGAAGGTAGTTACTCCAGTTAAAGGGATTGTAGCTAATTCTGCCAAAATATACTCTGCTGCCATTGCAAAAACCCAGAAAATCTGGCCTGCTTATCTTGATGCTATAATGAAGGTTGGACAGATGCAAGTGTTAAGACAACAGATTGCCAATGAGTTAAACTACTCGTGTAAATTTGACTCTAAGCACCTGGCAGGAGCCCTAGAGAACTTTAATGAAGCCATATTGGCTGACATACAAGCCCACTACCAGGACCCGAGCCTTCCCTGCCCACGAGAAGACAACACGCTCCTATATGAGATCACTGCATACCTGGAAGCAGCTGGGACACACAACCCCTTGAACAAAATTTACATTACTACCAAGCAGCTCTCTTTCTTCCCTATTGTGAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTAAAAAAAA
                                                      consensus depths                                2     2     3     3     3     4     4     5     6     9     7    10     7    10     9    11    10    11    11    12    11    12    11    12    11    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    13    12    13    12    13    11    12    11    12     9    10     8     9     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     6     7     5     6     5     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     5     5     5     5     4     4     4     4     4     4     4     4     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     4     4     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     8     9    10    11    10    11    10    11     9    11     9    12    10    14    10    13    12    14    12    14    10    14    13    15    16    19    16    19    17    22    17    22    22    26    23    26    28    31    31    34    30    34    33    35    34    35    35    36    37    38    37    38    38    40    38    40    39    41    39    41    39    41    39    41    38    41    38    41    38    41    38    41    29    40    28    40    28    39    28    39    29    39    31    39    31    39    31    39    31    39    30    39    31    39    31    39    31    39    31    39    31    39    31    39    31    39    31    39    31    39    31    39    31    38    31    38    31    38    30    37    30    37    29    37    29    37    29    38    28    38    28    38    27    37    27    37    26    34    26    34    26    34    26    34    26    34    26    34    26    34    26    34    26    34    26    34    24    34    24    34     8    12     6     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAGCAAATGGCATTTATTAAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGCACATTGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTTTGCTCACACACAACAATAGTACATAGTACTGTAAATCTAATCACATCGTTCTATTGACCAGCCTTGATGCCTATGTGTGGGACTTCACAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATACATAGTTGAATTTAAATGTCATACACAGTTGGAGGCCTTGGGGAATACTGCGGAGCATAAAAATACATTGGACACCTGTATCCAGCCCATAGGCCTCCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCATTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----------C-
                                               BLH ATG     218    1749                           
                                               BLH MIN     218     230                           
                                               BLH MPR     218     230                           
                                               BLH OVR     218      12                           
                                               CDS MIN     218     230                           
                                               EST CLI      38      10                           
                                               ORF LNG     218       6                           
                                                                                                                                                                                                                                                                                                                                             PREDICTED - Ce ---- 7e-054     NP_491784.1 putative protein of eukaryotic origin (115.3 kD) (1G767) [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PREDICTED = ?? ==== 2e-067     XP_702247.1 PREDICTED: hypothetical protein XP_697155 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PREDICTED = Sp ==== 0          XP_789826.2 PREDICTED: similar to MGC89323 protein [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                              PROTEIN === Dm ==== 0          NP_648840.1 CG12272-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PREDICTED = Dr ==== 0          NP_956477.1 hypothetical protein MGC55908 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PREDICTED = Mm ==== 0          NP_705776.2 hypothetical protein MGC31278 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PREDICTED = Hs ==== 0          NP_055661.2 hypothetical protein LOC9897 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PREDICTED = Gg ==== 0          XP_418441.2 PREDICTED: hypothetical protein [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 0          AAH75486.1 MGC89323 protein [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu116m24.3.5                                         TAG------------------------------------TAG------------------------------------------------ATG---------------------------------------------------------------------------------TGA---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------TGA---------TGA---------------------------TGA---------------------------------------ATG---------------TAG------------------------TAA---------------ATG---------------------TAG---------------------ATG------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------TAA------------------------------------------ATG------------------------------------------ATG------------------------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   1           Gas1 FL                     IMAGE:6987428.FL-MGC                                                                                            GTATTGGGCGCTGGATACCATGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGAAGGGGAAGTGCGGGAGAGGATGCTGGTCGCGTATTATAGATATAGCGCAGCAAGATCCTCTGTCGATTCAAACATGGATGATATCTGCAAGCTACTTAGAAGTACAGGCTACTCCAGCCAGCCAGGCGCTAAAAGACCCCCAAACTACCCCGAGAGCTACTTCAGCCGCGTGCCAATTAGTGAAACCTTTATCAGCATGGTGATTGGCAGATTAAGATCAGATGATATCTATAACCAAGTGTCTGCCTATCCATTGCCAGAGCACCGTAGTACGGCACTTGCCACGCAGGCTGCCATTTTGTATGTGATTCTCTACTTCCACCCACCAACTCTGCACACTCACCAAGCCAAAATGAGAGAAATAGTGGATAAGTATTTCCCAGATAACTGGGTTATCAGCATCTATATGGGGATCACTGTGAATCTGATGGAAGTGTGGGAGCCCTACAAGGCTGCAAAGACTGCTTTGAATTACACACTGGACCTGCCCAATATCAAGGAGCAGGCTTCCAGGTATGCAAAAATCATTGAGAGCCTGCACCCCCAGGTTCAGCAGTTCCTGAAGGAGGGCTTTCTCCGAGAGGAGTTTGTACTGGATAACATCCCCAAGCTGCTGAATTGTCTGCGGGACTGCAATGTCGCCATCCGATGGCTCATGCTTCACACAGCTGATTCTGCTTATGATCCAAACAACAAACGGCTTCGCCAGGTAAAAGATCAGGTTCTTGCTGATTCCAAGTACAACCCCAAGATTCTGTTCCAGTTGCTGCTGGATACTGCACAGTTTGAGTTCCTTCTGAAGGAGATGTTCAAACAGATGCTGTCAGAGAAGCAAAACAAGTGGGAAAGCTATAAGAAAGAAGGATCAGAAAGAATGACGGAGCTGGCAGATGTTTTCTCTGGCGTCAAACCCCTCACCAGGGTAGAGAAAAATGAACACTTGCAAGCCTGGTTCAGAGAGATCGCCAAGCAAATTCACTCCTTAAATTATGATGATTCCACTGCTGCTGGGAGGAAGACCGTTCAGCTCATCCAGGCTCTTGAAGAGGTCCAAGAATTCCATCAGCTGGAGACAAACCTTCAGGTGTGCCAGTTCTTGGCTGATACCCGCAAGTTCCTCCATCAAATGATCCGCACCATTAACATTAAAGAGGAGGTTCTGATCACTATGCAGATTGTGGGTGACCTCTCGTATGCCTGGCAGCTGATTGACAGCTTCACAGCAATCATGCAAGAGAGTATCAGAGCCAACCCGTCCATGGTTACCAAGCTGAGGGCCACTTTCCTTAAGCTGGCCTCTGCACTTGATTTGCCCTTGCTACGCATCAATCAGGCAAACAGCCCTGACCTACTCAGTGTATCCCAGTACTACTCAGGAGAGCTGGTTTTCTATGTCAGGAAGGTTCTGCAGATCATCCCGGAGAGCATGTTCACTTCCCTAGCCAAGATCATCAAGTTACAGACACATGACATTATCGAAGTGCCAACCCGATTGGACAAGGACAAACTGAGAGACTACGCTCAGCTTGGGGCTAGATATGAGGTTGCCAAGTTGACCAATGCCATTTCAATCTTTACTGAAGGAATTCTAATGATGAAGACTACACTTGTAGGCATAATCAAGGTGGATCCAAAGCAGCTTTTGGAGGATGGGATCAGGAAGGAGTTGGTTAAAAGAGTTGCTGTTGCTCTACACAAAGGGCTTATCTTCAACTCCAGAGCAAAGCCCAGCGAACTGCTGCCAAAGCTGAAAGACATGGCTGCCACCATGGATGGATTCCATCGCTCCTTCGAGTACATACAAGACTACGTCAGCATTTATGGCTTGAAAATTTGGCAGGAGGAAGTATCCCGTATTGTTAATTACAACGTAGAACAGGAATGCAACAACTTCCTAAGAACAAAGATTCAAGACTGGCAGAGCATGTATCAGTCAACTCACATCCCTATTCCCAAATTTCCTCCTGTGGATGAATCAATGACGTTTATAGGACGTCTGTGTCGGGAAATCCTGAGAATTACTGATCCGAAGGTTACGTGTTACATAGATCAGATGAACACGTGGTACGACATGAAAACTCACCAGGAAGTCACTAATAACCACCTCTTCTCAGAGATCAACGATTCACTGGGAACTTTTGGCTTAAATGGCTTGGACAGGTTACTTTGCTTTATGATAGTGAAGGAACTGCAGAACTTCATCCGCTTGTATCAGAGGTTAATTCTGAGGGATAAAAGTGGCCAGGAGACATTACGGGCCTTACAGAAGGTAGTTACTCCAGTTAAAGGGATTGTAGCTAATTCTGCCAAAATATACTCTGCTGCCATTGCAAAAACCCAGAAAATCTGGCCTGCTTATCTTGATGCTATAATGAAGGTTGGACAGATGCAAGTGTTAAGACAACAGATTGCCAATGAGTTAAACTACTCGTGTAAATTTGACTCTAAGCACCTGGCAGGAGCCCTAGAGAACTTTAATGAAGCCATATTGGCTGACATACAAGCCCACTACCAGGACCCGAGCCTTCCCTGCCCACGAGAAGACAACACGCTCCTATATGAGATCACTGCATACCTGGAAGCAGCTGGGACACACAACCCCTTGAACAAAATTTACATTACTACCAAGCAGCTCTCTTTCTTCCCTATTGTGAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGGGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAAATGGCATTTATTAAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGCACATTGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTTTGCTCACACACAACAATAGTACATAGTACTGTAAATCTAATCACATCGTTCTATTGACCAGCCTTGATGCCTATGTGTGGGACTTCACAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATACATAGTTGAATTTAAATGTCATACACAGTTGGAGGCCTTGGGGAATACTGCGGAGCATAAAAATACATTGGACACCTGTATCCAGCCCATAGGCCTCCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCATTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1         - Te4       in                        CAAN10800.5p CCGCGTCACATGACTTCTGTGCTTTGGCAGGTCATGTGATTAGCAGCTGAGGGTTCTACGGGTGTGCCATGGCAGAGCTTAGTGGTACTGGGTATTGGGCGCTGGATACCATGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAG
  5   1   1   12    - Gas7 5g3  in                         XZG28785.5p ..........................GCAGGTCATGTGATTAGCAGCTGAGGGTTCTACGGGTGTGCCATGGCAGAGCTTAGTGGTACTGGGTATTGGGCGCTGGATACCATGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGAAGGGGAAGTG
  5   1   1   14    - Te3  5g3  in                         CAAM6198.5p ....................................TGATTAGCAGCTGAGGGTTCTACGGGTGTGCCATGGCAGAGCTTAGTGGTACTGGGTATTGGGCGCTGGATACCATGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGAAGGGGAAGTGCGGGAGAGGATGCTGGTCGCGTATTATAGATATAGCGCAGCAAGATCCTCTGTCGATTCAAACATGGATGATATCTGCAAGCTACTTAGAAGTACAGGCTACTCCAGCCAGCCAGGCGCTAAAAGACCCCCCAACTACCCCGAGAGCTACTTCA
  5   1   1       chi AbdN 5x                            IMAGE:7025078                                               TGAGGGTTCTACGGGTGTGCCATGGCAGAGCTTAGTGGTACTGGGTATTGGGCGCTGGATACCATGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGTTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAACCATTTCTGCCCATTGTCCCCCCTGGAAACCCTTTCCTAACGGAACTGGTCCCGCCTCTCGAAATTTGTTTCCCAGGGGGTTCCCCCTTAAAACACAAGCCAATTCCCCCAAAATTTTGGGGGAAAATCCCCTTTCCGAATTTTTAGTTTCCCTCCAAGGGGCCCCTAGAGTCTTTTTTGGGGGGAAAACTGGAAAACCCCAACCCAAAACTCTCCCCGAACCCCGGGAGAAAAGAATTTCCCCGGGAAAACCCCCTCTGGGGGATTCTCCCCCCCGTTTTTTTTTTTTTGGCCCCTTTTAAAAACCCCCCCCCCCCATTTTTTTTTTTTTTTTTTTTTTACACCCCGGTTTTTTTTGGGGGGGTTTTTTTTTTTTGGGGGGGGGGTTTTTTTTTTTTTTTAAAAAAAAAACCCGCGAAAAAAAAAGTTGGTTTTTTCTCTTCTTCGGGGGGGGGGGGGGGGAAAAAACACCCCCCCTTTTTTTTTTTGTGGGGGGCGGGGCCCGCTCCCCCCTCTCTCTAACGGAGGGGGGGGAGAGAACCCCGCCCCCCCTTTTTTTTTTCCCCCCTCCCCACAAAAATAAAATATGTAGGGGGGGGG
  5   1   1   24    - Te3  5g                              CAAM9359.5p ......................................................TCTACGGGTGTGCCATGGCAGAGCTTAGTGGTACTGGGTATTGGGCGCTGGATACCATGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGA
  5   1   1   14    - Te4  5g3  in                         CAAN2718.5p ................................................................TGCCATGGCAGAGCTTAGTGGTACTGGGTATTGGGCGCTGGATACCATGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCANACCCTGGAAACTGTGCTTCTCAATGNNAGACGGAAACAGCTGCTTTGTGAGGCGCTGTACCTGTAC
  5   1   1   14    - Te4  5g3  in                         CAAN9441.5p ..................................................................CATGGCAGAGCTTAGTGGTACTGGGTATTGGGCGCTGGATACCAGTGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGAAGGGGAAGTGCGGGAGAGGATGCTGGTCGCGTATTATAGATATAGCGCAGCAAGATCCTCTGTCGATTCANACATGGATGATATCTGCAAGCTACTTAGAAGTACAGGCTACTCCAGCCAGCCAGGCGCT
  5   1   1         - Gas1 FL                            IMAGE:6987428                                                                         GAAAATTTCCCCTGGGGATGTATTAGGGCGCTGGATACCTGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGAAGGGGAAGTGCGGGAGAGGATGCTGGTCGCGTATTATAGATATAGCGCAGCAAGATCCTCTGTCGATTCAAACATGGATGATATCTGCTAGCTACTTAGAAGTACAGGGTACTCCAGCCAGCCAGGCGCTAAAAGACCCTCCAC
  5   1   1         - Te4       in                        CAAN11596.5p                                                                         CAGAGCTTAGTGGTACTGGGTATTGGGCGCTGGATACCATGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGAAGGGGAAGTGCGGGAGAGGATGCTGGTCGCGTATTATAGATATAGCGCAGCAAGATCCTCTGTCGATTCAAACATGGATGATATCTGCAAGCTACTTAGAAGTACAGGCTACTCCAGCCAGCCAGGCGCTA
  5   1   1         - Lun1      in                         CABD2224.5p                                                                                    GGTACTGGGTATTGGGCGCTGGATACCATGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGAAGGGGAAGTGCGGGAGAGGATGCTGGTCGCGTATTATAGATATAGCGCAGCAAGATCCTCTGTCGATTCAAACATGGATGATATCTGCAAGCTACTTAGAAGTACAGGCTACTCCAGCCAGCCAGGCGCTAAAAGACCCCCAAACTACCCTGAGAGCTACTTCAGCCGCGTGCCAATTAGTGAAACCTTTATCAGCATGGTGATTGGCAGATTNAGATCAGATGATATCTATAACCAAGTGTCTGCCTATCCATTGCCAGAGCA
  5   1   1   10    - Te1  5g3  in                         CBWN8462.b1 .......................................................................................................GGATACCATGGCAACGGCTCTGCCCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAG
  5   1   1         - Lun1      in                         CABD7755.5p                                                                                                                               CCTGATGCAATCTGGGGAAGAGGAAGAGACCACTTTCTCCTCACAGCAAGGGACCCCTGGTTTAGTAGAGAGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGAAGGGGAAGTGCGGGAGAGGATGCTGGTCGCGTATTATAGATATAGCGCAGCAAGATCCTCTGTCGATTCAAACATGGATGATATCTGCAAGCTACTTAGAAGTACAGGCTACTCCAGCCAGCCAGGCGCTAAAAGACCCCCAAACTACCCTGAGAGCTACTTCAGCCGCGTGCCAATTAGTGAAACCTTTATCAGCATGGTGATTGGCAGATTAAGATCAGATGATATCTATAACCAAGTGTCTGCCTATCCATTGCCAGAGCACCGTAGTACGGCACTTGCCACGCAGGCTGCCATTTTGTATGTGATTCTCTACTTCCACCCACCAACTCTGCACACT
  5   1   1   14    - Te4  5g3  in                         CAAN7709.5p ....................................................................................................................................................................................................AGATATTTCCTTCTGATTTGATTCTTGGAGCTGCGGAGTGTAAGCAAGATGGTTGATTTCCTGGCAGAAAATAACCTGTGCGGGCAAGCCATTCTGCGCATTGTCTCCCGTGGAAACGCTATCATAGCGGAACTGTTACGGCTCTCGGAATTTGTTCCCAGTGTGTTCCGCCTTAAAGACAAAGCAGATCAGCAGAAGTATGGAGATATCATATTCGATTTTAGTTACTTCAAGGGGCCTGAGGTCTGTGAGGGGAGACTGGAAGCCAAACCAGAGCTCCAGGACCTGGATGAGGAATTCCGTGAAAACAACATAGAGATACTAACAAGATTTTATTTGGCCTTTGAAAGCGTACACAAGTATATTGTTGATTTGAACAGGTATTTGGAGGATCTTAATGAAGGCATTTACATTCAGCAAACCCTGGAAACTGTGCTTCTCAATGAGGACGGAAAACAGCTGCTTTGTGAGGCGCTGTACCTGTACGGTGTGATGCTGCTGGTTATAGACCAGAAGATCGAAGGGGAAGTGCGGGAGAGGATGCTGGTCGCGTATTATAGATATAGCGCAGCAAGATCCTCTGTCGATTCAAACATGGATGATATCTGCAAGCTACTTAGAAGTACAGGCTACTCCAGCCAGCCAGGCGCTAAAAGACCCCCAAACTACCCCGAGAGCTACTTCAGCCGCGTGCCAATTAGTGAAACCTTTATCAGCATGGTGATTGGCAGATTAAGATCAGATGATATCTATAACCAAGTGTCTGCCTATCCATTGCCAGAGCACCGTAGTACGGCACTTGCCACGCAGGCTGCCATTTTGTATGTGATTCTCTACTTCCACCCCACAACTCTGCACACTC
  5   1   1         - Tad5      in                         XZT69594.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGCGGGAGAGGATGCTGGTCGCGTATTATAGATATAGCGCAGCAAGATCCTCTGTCGATTCAAACATGGATGATATCTGCAAGCTACTTAGAAGTACAGGCTACTCCAGCCAGCCAGGCGCTAAAAGACCCCCAAACTACCCCGAGAGCTACTTCAGCCGCGTGCCAATTAGTGAAACCTTTATCAGCATGGTGATTGGCAGATTAAGATCAGATGATATCTATAACCAAGTGTCTGCCTATCCATTGCCAGAGCACCGTAGTACGGCACTTGCCACGCAGGCTGCCATTTTGTATGTGATTCTCTACTTCCACCCACCAACTCTGCACACTCACCAAGCCAAAATGAGAGAAATAGTGGATAAGTATTTCCCAGATAACTGGGTTATCAGCATCTATATGGGGATCACTGTGAATCTGATGGAAGTGTGGGAGCCCTACAAGGCTGCAAAGACTGCTTTGAATTACACACTGGACCTGCCCAATATCAAGGAGCAGGCTTCCAGGTATGCAAAAATCATTGAGAGCCTGCACCCCCAGGTTCAGCAGTTCCTGAAGGAGGGCTTTCTCCGAGAGGAGTTTGTACTGGATAACATCCCCAAGCTGCTGAATTGTCTGCGGGACTGCAATGTCGCCATCCGATGGCTCATGCTTCACACAGCTGATTCTGCTTATGATCCAAACAACAAACGGCTTCGCCAGGTAAAAGATCAGGTTCTTGCTGATTCCAAGTACAACCCCAAGATTCTGTTCCAGTTGCTGCTGGATACTGCACAGTTTGAGTTCCT
  5   1   1         - Fat1      in                        CABC10575.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTATATGGGGATCACTGTGAATCTGATGGAAGTGTGGGAGCCCTACAAGGCTGCAAAGACTGCTTTGAATTACACACTGGACCTGCCCAATATCAAGGAGCAGGCTTCCAGGTATGCAAAAATCATTGAGAGCCTGCACCCCCAGGTTCAGCAGTTCCTGAAGGAGGGCTTTCTCCGAGAGGAGTTTGTACTGGATAACATCCCCAAGCTGCTGAATTGTCTGCGGGACTGCAATGTCGCCATCCGATGGCTCATGCTTCACACAGCTGATTCTGCTTATGATCCAAACAACAAACGGCTTCGCCAGGTAAAAGATCAGGTTCTTGCTGATTCCAAGTACAACCCCAAGATTCTGTTCCAGTTGCTGCTGGATACTGCACAGTTTGAGTTCCTTCTGAAGGAGATGTTCAAACAGATGCTGTCAGAGAAGCAAAACAAGTGGGAAAGCTATAAGAAAGAAGGATCAGAAAGAATGACGGAGCTGGCAGATGTTTTCTCTGGCGTCAAACCCCTCACCAGGGTAGAGAAAAATGAACACTTGCAAGCCTGGTTCAGAGAGATCGCCAAGCAAATTCACTCCTTAAATTATGATGATTCCACTGCTGCTGGGAGGAAGACCGTTCAGCTCATCCAGGCTCTTGAAGAGGTCCAAGAATTCCATCAGCTGGAGACAAACCTTCAGGTGTGCCAGTTCTTGGCTGATACCCGCAAGTTCCTCCATCAAATGATCCGCACCATTAACATTAAAGAGGAGGTTCTGATCACTATGCAGATTGTGGGTGACCTCTCGTATGCCTGGCAGCTGATTGACAGCTTCACAGCAATCATGCAAGAGAGTATC
  5   1   1         - Te4       in                         CAAN3363.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGTGAATCTGATGGAAGTGTGGGAGCCCTACAAGGCTGCAAAGACTGCTTTGAATTACACACTGGACCTGCCCAATATCAAGGAGCAGGCTTCCAGGTATGCAAAAATCATTGAGAGCCTGCACCCCCAGGTTCAGCAGTTCCTGAAGGAGGGCTTTCTCCGAGAGGAGTTTGTACTGGATAACATCCCCAAGCTGCTGAATTGTCTGCGGGACTGCAATGTCGCCATCCGATGGCTCATGCTTCACACAGCTGATTCTGCTTATGATCCAAACAACAAACGGCTTCGCCAGGTAAAAGATCAGGTTCTTGCTGATTCCAAGTACAACCCCAAGATTCTGTTCCAGTTGCTGCTGGATACTGCACAGTTTGAGTTCCTTCTGAAGGAGATGTTCAAACAGATGCTGTCAGAGAAGCAAAACAAGTGGGAAAGCTATAAGAAAGAAGGATCAGAAAGAATGACGGAGCTGGCAGATGTTTTCTCTGGCGTCAAACCCCTCACCAGGGTAGAGAAAAATGAACACTTGCAAGCCTGGTTCAGAGAGATCGCCAAGCAAATTCACTCCTTAAATTATGATGATTCCACTGCTGCTGGGAGGAAGACCGTTCAGCTCATCCAGGCTCTTGAAGAGGTCCAAGAATTCCATCAGCTGGAGACAAACCTTCAGGTGTGCCAGTTCTTGGCTGATACCCGCAAGTTCCTCCATCAAATGATCCGCACCATTAACATTAAAGAGGAGGTTCTGATCACTATGCAGATTGTGGGTGACCTCTCGTATGCCTGGCAGCTGATTGACAGCTTCACAGCAATCATGCAAGAGAGTATCAG
  5   1   1         - Te4       in                        CAAN11863.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCTACAAGGCTGCAAAGACTGCTTTGAATTACACACTGGACCTGCCCAATATCAAGGAGCAGGCTTCCAGGTATGCAAAAATCATTGAGAGCCTGCACCCCCAGGTTCAGCAGTTCCTGAAGGAGGGCTTTCTCCGAGAGGAGTTTGTACTGGATAACATCCCCAAGCTGCTGAATTGTCTGCGGGACTGCAATGTCGCCATCCGATGGCTCATGCTTCACACAGCTGATTCTGCTTATGATCCAAACAACAAACGGCTTCGCCAGGTAAAAGATCAGGTTCTTGCTGATTCCAAGTACAACCCCAAGATTCTGTTCCAGTTGCTGCTGGATACTGCACAGTTTGAGTTCCTTCTGAAGGAGATGTTCAAACAGATGCTGTCAGAGAAGCAAAACAAGTGGGAAAGCTATAAGAAAGAAGGATCAGAAAGAATGACGGAGCTGGCAGATGTTTTCTCTGGCGTCAAACCCCTCACCAGGGTAGAGAAAAATGAACACTTGCAAGCCTGGTTCAGAGAGATCGCCAAGCAAATTCACTCCTTAAATTATGATGATTCCACTGCTGCTGGGAGGAAGACCGTTCAGCTCATCCAGGCTCTTGAAGAGGTCCAAGAATTCCATCAGCTGGAGACAAACCTTCAGGTGTGCCAGTTCTTGGCTGATACCCGCAAGTTCCTCCATCAAATGATCCGCACCATTAACATTAAAGAGGAGGTTCTGATCACTATGCAGATTGTGGGTGACCTCTCGTATGCCTGGCAGCTGATTGACAGCTTCACAGCAATCATGNCAGAGAGTATCAGAGCCAACCCGTCCATGGTTACCAAGCTG
  5   1   1         - Gas7      in                         XZG59431.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGGCAGATGTTTTCTCTGGCGTCAAACCCCTCACCAGGGTAGAGAAAAATGAACACTTGCAAGCCTGGTTCAGAGAGATCGCCAAGCAAATTCACTCCTTAAATTATGATGATTCCACTGCTGCTGGGAGGAAGACCGTTCAGCTCATCCAGGCTCTTGAAGAGGTCCAAGAATTCCATCAGCTGGAGACAAACCTTCAGGTGTGCCAGTTCTTGGCTGATACCCGCAAGTTCCTCCATCAAATGATCCGCACCATTAACATTAAAGAGGAGGTTCTGATCACTATGCAGATTGTGGGTGACCTCTCGTATGCCTGGCAGCTGATTGACAGCTTCACAGCAATCATGCAAGAGAGTATCAGAGCCAACCCGTCCATGGTTACCAAGCTGAGGGCCACTTTCCTTAAGCTGGCCTCTGCACTTGATTTGCCCTTGCTACGCATCAATCAGGCAAACAGCCCTGACCTACTCAGTGTATCCCAGTACTACTCAGGAGAGCTGGTTTTCTATGTCAGGAAGGTTCTGCAGATCATCCCGGAGAGCATGTTCACTTCCCTAGCCAAGATCATCAAGTTACAGACACATGACATTATCGAAGTGCCAACCCGATTGGACAAGGACAAACTGAGAGACTACGCTCAGCTTGGGGCTAGATATGAGGTTGCCAAGTTGACCAATGCCATTTCAATCTTTACTGAAGGAATTCTAATGATGAAGACTACACTTGTAGGCATAATCAAGGTGGATCCAAAGCAGCTTTTGGAGGATGGGATCAG
  5   1   1         - Lun1      in                         CABD6750.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAACCTTCAGGTGTGCCAGTTCTTGGCTGATACCCGCAAGTTCCTCCATCAAATGATCCGCACCATTAACATTAAAGAGGAGGTTCTGATCACTATGCAGATTGTGGGTGACCTCTCGTATGCCTGGCAGCTGATTGACAGCTTCACAGCAATCATGCAAGAGAGTATCAGAGCCAACCCGTCCATGGTTACCAAGCTGAGGGCCACTTTCCTTAAGCTGGCCTCTGCACTTGATTTGCCCTTGCTACGCATCAATCAGGCAAACAGCCCTGACCTACTCAGTGTATCCCAGTACTACTCAGGAGAGCTGGTTTTCTATGTCAGGAAGGTTCTGCAGATCATCCCGGAGAGCATGTTCACTTCCCTAGCCAAGATCATCAAGTTACAGACACATGACATTATCGAAGTGCCAACCCGATTGGACAAGGACAAACTGAGAGACTACGCTCAGCTTGGGGCTAGATATGAGGTTGCCAAGTTGACCAATGCCATTTCAATCTTTACTGAAGGAATTCTAATGATGAAGACTACACTTGTAGGCATAATCAAGGTGGATCCAAAGCAGCTTTTGGAGGATGGGATCAGGAAGGAGTTGGTTAAAAGAGTTGCTGTTGCTCTACACAAAGGGCTTATCTTCAACTCCAGAGCAAAGCCCAGCGAACTGCTGCCAAAGCTGAAAGACATGGCTGCCACCATGGATGGATTCCATCGCTCCTTCGAGTACATACAAGACTACGTCAGCATTTATGGCTTGAAAATTTGGCAGGAGGAAGTATCCCGTATTGTTAATTACNACGTAGAACAGGAATGCAA
  5   1   1         - Te3       in                        CAAM14898.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTCAGGTGTGCCAGTTCTTGGCTGATACCCGCAAGTTCCTCCATCAAATGATCCGCACCATTAACATTAAAGAGGAGGTTCTGATCACTATGCAGATTGTGGGTGACCTCTCGTATGCCTGGCAGCTGATTGACAGCTTCACAGCAATCATGCAAGAGAGTATCAGAGCCAACCCGTCCATGGTTACCAAGCTGAGGGCCACTTTCCTTAAGCTGGCCTCTGCACTTGATTTGCCCTTGCTACGCATCAATCAGGCAAACAGCCCTGACCTACTCAGTGTATCCCAGTACTACTCAGGAGAGCTGGTTTTCTATGTCAGGAAGGTTCTGCAGATCATCCCGGAGAGCATGTTCACTTCCCTAGCCAAGATCATCAAGTTACAGACACATGACATTATCGAAGTGCCAACCCGATTGGACAAGGACAAACTGAGAGACTACGCTCAGCTTGGGGCTAGATATGAGGTTGCCAAGTTGACCAATGCCATTTCAATCTTTACTGAAGGAATTCTAATGATGAAGACTACACTTGTAGGCATAATCAAGGTGGATCCAAAGCAGCTTTTGGAGGATGGGATCAGGAAGGAGTTGGTTAAAAGAGTTGCTGTTGCTCTACACAAAGGGCTTATCTTCAACTCCAGAGCAAAGCCCAGCGAACTGCTGCCAAAGCTGAAAGACATGGCTGCCACCATGGATGGATTCCATCGCTCCTTCGAGTACATACAAGACTACGTCAGCATTTATGGCTTGAAATTTGGCAGGAGGAGTATCCCGTATTG
  5   1   1         - Brn4      in                         CAAL6260.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGCTTCACAGCAATCATGCAAGAGAGTATCAGAGCCAACCCGTCCATGGTTACCAAGCTGAGGGCCACTTTCCTTAAGCTGGCCTCTGCACTTGATTTGCCCTTGCTACGCATCAATCAGGCAAACAGCCCTGACCTACTCAGTGTATCCCAGTACTACTCAGGAGAGCTGGTTTTCTATGTCAGGAAGGTTCTGCAGATCATCCCGGAGAGCATGTTCACTTCCCTAGCCAAGATCATCAAGTTACAGACACATGACATTATCGAAGTGCCAACCCGATTGGACAAGGACAAACTGAGAGACTACGCTCAGCTTGGGGCTAGATATGAGGTTGCCAAGTTGACCAATGCCATTTCAATCTTTACTGAAGGAATTCTAATGATGAAGACTACACTTGTAGGCATAATCAAGGTGGATCCAAAGCAGCTTTTGGAGGATGGGATCAGGAAGGAGTTGGTTAAAAGAGTTGCTGTTGCTCTACACAAAGGGCTTATCTTCAACTCCAGAGCAAAGCCCAGCGAACTGCTGCCAAAGCTGAAAGACATGGCTGCCACCATGGATGGATTCCATCGCTCCTTCGAGTACATACAAGACTACGTCAGCATTTATGGCTTGAAAATTTGGCAGGAGGAAGTATCCCGTATTGTTAATTACAACGTAGAACAGGAATGCAACAACTTCCTAAGAACAAAGATTCAAGACTGGCAGAGCATGTATCAGTCAACTCACATCCCTATTCCCAAATTTCCTCCTGTGGATGAATCAATGACGTTTATAGGACGTCTGTGTCGGGAAATCCTGAGAATTACTGATCCGAAGGNTACGTGTTACATAGATCAGATGAACACGTGGTACGACATGAAAACT
  5   1   1         - Gas7      in                         XZG19427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTTGATTTGCCCTTGCTACGCATCAATCAGGCAAACAGCCCTGACCTACTCAGTGTATCCCAGTACTACTCAGGAGAGCTGGTTTTCTATGTCAGGAAGGTTCTGCAGATCATCCCGGAGAGCATGTTCACTTCCCTAGCCAAGATCATCAAGTTACAGACACATGACATTATCGAAGTGCCAACCCGATTGGACAAGGACAAACTGAGAGACTACGCTCAGCTTGGGGCTAGATATGAGGTTGCCAAGTTGACCAATGCCATTTCAATCTTTACTGAAGGAATTCTAATGATGAAGACTACACTTGTAGGCATAATCAAGGTGGATCCAAAGCAGCTTTTGGAGGATGGGATCAGGAAGGAGTTGGTTAAAAGAGTTGCTGTTGCTCTACACAAAGGGCTTATCTTCAACTCCAGAGCAAAGCCCAGCGAACTGCTGCCAAAGCTGAAAGACATGGCTGCCACCATGGATGGATTCCATCGCTCCTTCGAGTACATACAAGACTACGTCAGCATTTATGGCTTGAAAATTTGGCAGGAGGAAGTATCCCGTATTGTTAATTACAACGTAGAACAGGAATGCAACAACTTCCTAAGAACAAAGATTCAAGACTGGCAGAGCATGTATCAGTCAACTCACATCCCTATTCCCAAATTTCCTCCTGTGGATGAATCAATGACGTTTATAGGACGTCTGTGTCGGGAAATCCTGAGAATTACTGAT
  5   1   1         - Sto1      in                         CABG2865.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCTGACCTACTCAGTGTATCCCAGTACTACTCAGGAGAGCTGGTTTTCTATGTCAGGAAGGTTCTGCAGATCATCCCGGAGAGCATGTTCACTTCCCTAGCCAAGATCATCAAGTTACAGACACATGACATTATCGAAGTGCCAACCCGATTGGACAAGGACAAACTGAGAGACTACGCTCAGCTTGGGGCTAGATATGAGGTTGCCAAGTTGACCAATGCCATTTCAATCTTTACTGAAGGAATTCTAATGATGAAGACTACACTTGTAGGCATAATCAAGGTGGATCCAAAGCAGCTTTTGGAGGATGGGATCAGGAAGGAGTTGGTTAAAAGAGTTGCTGTTGCTCTACACAAAGGGCTTATCTTCAACTCCAGAGCANAGCCCAGCGAACTGCTGCCAAAGCTGAAAGACATGGCTGCCACCATGGATGGATTCCATCGCTCCTTCGAGTACATACAAGACTACGTCAGCATTTATGGCTTT
  5   1   1         - Tad5      in                         XZT23812.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCTAGCCAAGATCATCAAGTTACAGACACATGACATTATCGAAGTGCCAACCCGATTGGACAAGGACAAACTGAGAGACTACGCTCAGCTTGGGGCTAGATATGAGGTTGCCAAGTTGACCAATGCCATTTCAATCTTTACTGAAGGAATTCTAATGATGAAGACTACACTTGTAGGCATAATCAAGGTGGATCCAAAGCAGCTTTTGGAGGATGGGATCAGGAAGGAGTTGGTTAAAAGAGTTGCTGTTGCTCTACACAAAGGGCTTATCTTCAACTCCAGAGCAAAGCCCAGCGAACTGCTGCCAAAGCTGAAAGACATGGCTGCCACCATGGATGGATTCCATCGCTCCTTCGAGTACATACAAGACTACGTCAGCATTTATGGCTTGAAAATTTGGCAGGAGGAAGTATCCCGTATTGTTAATTACAACGTAGAACAGGAATGCAACAACTTCCTAAGAACAAAGATTCAAGACTGGCAGAGCATGTATCAGTCAACTCACATCCCTATTCCCAAATTTCCTCCTGTGGATGAATCAATGACGTTTATAGGACGTCTGTGTCGGGAAATCCTGAGAATTACTGATCCGAAGGTTACGTGTTACATAGATCAGATGAACACGTGGTACGACATGAAAACTCACCAGGAAGTCACTAATAACCACCTCTTCTCAGAGATCAACGATTCACTGGGAACTTTTGGCTTANATGGCTTGGACAGGTTACTTTGCTTTATGATAGTGAAGGAACTGCAGAACTTCATCCTCTTGTATCAGAGGTTAATTCTGAGGGATAAAAGTGCCCAGGAGACATTAC
  5   1   1         - Te5       in                         CAAO1591.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGAATGCAACAACTTCCTAAGAACAAAGATTCAAGACTGGCAGAGCATGTATCAGTCAACTCACATCCCTATTCCCAAATTTCCTCCTGTGGATGAATCAATGACGTTTATAGGACGTCTGTGTCGGGAAATCCTGAGAATTACTGATCCGAAGGTTACGTGTTACATAGATCAGATGAACACGTGGTACGACATGAAAACTCACCAGGAAGTCACTAATAACCACCTCTTCTCAGAGATCAACGATTCACTGGGAACTTTTGGCTTAAATGGCTTGGACAGGTTACTTTGCTTTATGATAGTGAAGGAACTGCAGAACTTCATCCTCTTGTATCAGAGGTTAATTCTGAGGGATAAAAGTGCCCAGGAGACATTACGGGCCTTACAGAAGGTAGTTACTCCAGTTAAAGGGATTGTAGCTAATTCTGCCAAAATATACTCTGCTGCCATTGCAAAAACCCAGAAAATCTGGCCTGCTTATCTTGATGCTATAATGAAGGTTGGACAGATGCAAGTGTTAAGACAACAGATTGCCAATGAGTTAAACTACTCGTGTAAATTTGACTCTAAGCACCTGGCAGGAGCCCTAGAGAACTTTAATGAAGCCATATTGGCTGACATACAAGCCCACTACCAGGACCCGAGCCTTCCCTGCCCACGAGAAGACAACACGCTCCTATATGAGATCACTGCATACCTGGAAGCAGCTGGGACACACAACCCCTTGAACAAAATTTACATTACTACCAAGCAGCTCTCTTTCTTTCCTATTGTGAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGACCCTAGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGG
  5   1   1         - Gas7                                  XZG9316.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGAACACGTGGTACGACATGAAAACTCACCAGGAAGTCACTAATAACCACCTCTTCTCAGAGATCAACGATTCACTGGGAACTTTTGGCTTAAATGGCTTGGACAGGTTACTTTGCTTTATGATAGTGAAGGAACTGCAGAACTTCATCCTCTTGTATCAGAGGTTAATTCTGAGGGATAAAAGTGCCCAGGAGACATTACGGGCCTTACAGAAGGTAGTTACTCCAGTTAAAGGGATTGTAGCTAATTCTGCCAAAATATACTCTGCTGCCATTGCAAAAACCCAGAAAATCTGGCCTGCTTATCTTGATGCTATAATGAAGGTTGGACAGATGCAAGTGTTAAGACAACAGATTGCCAATGAGTTAAACTACTCGTGTAAATTTGACTCTAAGCACCTGGCAGGAGCCCTAGAGAACTTTAATGAAGCCATATTGGCTGACATACAAGCCCACTACCAGGACCCGAGCCTTCCCTGCCCACGAGAAGACAACACGCTCCTATATGAGATCACTGCATACCTGGAAGCAGCTGGGACACACAACCCCTTGAACAAAATTTACATTACTACCAAGCAGCTCTCTTTCTTTCCTATTGTGAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGACANAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTG
  5   1   1         - Eye       in                         CCAX2565.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCTTAAATGGCTTGGACAGGTTACTTTGCTTTATGATAGTGAAGGAACTGCAGAACTTCATCCGCTTGTATCAGAGGTTAATTCTGAGGGATAAAAGTGGCCAGGAGACATTACGGGCCTTACAGAAGGTAGTTACTCCAGTTAAAGGGATTGTAGCTAATTCTGCCAAAATATACTCTGCTGCCATTGCAAAAACCCAGAAAATCTGGCCTGCTTATCTTGATGCTATAATGAAGGTTGGACAGATGCAAGTGTTAAGACAACAGATTGCCAATGAGTTAAACTACTCGTGTAAATTTGACTCTAAGCACCTGGCAGGAGCCCTAGAGAACTTTAATGAAGCCATATTGGCTGACATACAAGCCCACTACCAGGACCCGAGCCTTCCCTGCCCACGAGAAGACAACACGCTCCTATATGAGATCACTGCATACCTGGAAGCAGCTGGGACACACAACCCCTTGAACAAAATTTACATTACTACCAAGCAGCTCTCTTTCTTCCCTATTGTGAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTG
  5   1   1         - Sto1      in                         CABG3969.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTTACAGAAGGTAGTTACTCCAGTTAAAGGGATTGTAGCTAATTCTGCCAAAATATACTCTGCTGCCATTGCAAAAACCCAGAAAATCTGGCCTGCTTATCTTGATGCTATAATGAAGGTTGGACAGATGCAAGTGTTAAGACAACAGATTGCCAATGAGTTAAACTACTCGTGTAAATTTGACTCTAAGCACCTGGCAGGAGCCCTAGAGAACTTTAATGAAGCCATATTGGCTGACATACAAGCCCACTACCAGGACCCGAGCCTTCCCTGCCCACGAGAAGACAACACGCTCCTATATGAGATCACTGCATACCTGGAAGCAGCTGGGACACACAACCCCTTGAACAAAATTTACATTACTACCAAGCAGCTCTCTTTCTTCCCTATTGTGAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATNTGGGAGGGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAAATGGCATTTATTAAGGGGTTGC
  5   1   1         - Sto1      in                         CABG7270.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAAATATACTCTGCTGCCATTGCAAAAACCCAGAAAATCTGGCCTGCTTATCTTGATGCTATAATGAAGGTTGGACAGATGCAAGTGTTAAGACAACAGATTGCCAATGAGTTAAACTACTCGTGTAAATTTGACTCTAAGCACCTGGCAGGAGCCCTAGAGAACTTTAATGAAGCCATATTGGCTGACATACAAGCCCACTACCAGGACCCGAGCCTTCCCTGCCCACGAGAAGACAACACGCTCCTATATGAGATCACTGCATACCTGGAAGCAGCTGGGACACACAACCCCTTGAACAAAATTTACATTACTACCAAGCAGCTCTCTTTCTTCCCTATTGTGAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGGGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATG
  5   1   1         - Neu       in                   TNeu116m24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATACCTGGAAGCAGCTGGGACACACAACCCCTTGAACAAAATTTACATTACTACCAAGCAGCTCTCTTTCTTTCCTATTGTGAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTATGCCGATGTGCTAGTGCCCATATTAATGTGGATG
  5   1   1         - Tail      in                         CBSW5842.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTGAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGGGGCTGAAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAAATGGCATTTATTAAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACCTTGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTTTGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCGTTCTATTGACCAGCCTTGATGCCTATGTGTGGGACTTCACAATTTATATTGTAG
  5   1   1         - Tad5                                 XZT41076.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTA
  5   1   1         - Tad5                                 XZT44296.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAATTTCCTGTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATANAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGT
  5   1   1         - Gas7      in                         XZG56512.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCCTGGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCT
  5   1   1         - Tad5                                 XZT32895.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTCGCCCAGTTGCCAAAGCTGCAGTATAACAAGAACCTAGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGGGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAAATGGCATTTATTAAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGCACATTGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTTTGCTCACACACAACAATAGTACATAGTACTGTAAATCTAATCACATCGTTCTATTGACCAGCCTTGATGCCTATGTGTGGGACTTCACAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATACATAGTTGAATTTAAATGTCATACACAGTTGGAGGCCTTGNGGAATACTGCGGAGCATAAAAATACATGGACACCTGTATCCAGCCCATAGGCCTCCAGTTGGGCAGCTCTGT
  3   1   1         - Neu       in                    TNeu116m24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGAATGACATGCAGGAAGCCGGCAGATCCGATTGATGGGTTCCATNGGTACTCGGCCTGCTAACACTGCTCAGCAGTTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTAAAAAAAAAAAAAAAAAA
  3   1   1         - Fat1      in                        CABC10575.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGCAGATCCGATTGATGGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATNGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGGGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAAATGGCATTTATTAAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGCACATTGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTTTGCTCACACACAACAATAGTACATAGTACTGTAAATCTAATCACATCGTTCTATTGACCAGCCTTGATGCCTATGTGTGGGACTTCACAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATACATAGTTGAATTTAAATGTCATACACAGTTGGAGGCCTTGGGGAATACTGCGGAGCATAAAAATACATTGGACACCTGTATCCAGCCCATAGGCCTCCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCATTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGT
  3   1   1         - Lun1      in                         CABD7755.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGATCCGATTGATTGGGTTCCATTGGTACTCGGCCTGCTAACACTGCTCAAGCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTGTT
  3   1   1         - Sto1      in                         CABG7270.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTGGTACTCGGCCTGCTAACACTGCTCAGCAGTTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGGGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAAATGGCATTTATTAAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGCACATTGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTTTGCTCACACACAACAATAGTACATAGTACTGTAAATCTAATCACATCGTTCTATTGACCAGCCTTGATGCCTATGTGTGGGACTTCACAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATACATAGTTGAATTTAAATGTCATACACAGTTGGAGGCCTTGGGGAATACTGCGGAGCATAAAAATACATTGGACACCTGTATCCAGCCCATAGGCCTCCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCATTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTAACCTGAAA
  3   1   1         - Te4       in                        CAAN11863.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGTTCCATTCCCGTTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTT
  3   1   1         - Lun1      in                         CABD6750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTACACTGAGCAGTTTCTGGCCCTGATAGGGCATTTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGGGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAAATGGCATTTATTAAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGCACATTGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTTTGCTCACACACAACAATAGTACATAGTACTGTAAATCTAATCACATCGTTCTATTGACCAGCCTTGATGCCTATGTGTGGGACTTCACAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATACATAGTTGAATTTAAATGTCATACACAGTTGGAGGCCTTGGGGAATACTGCGGAGCATAAAAATACATTGGACACCTGTATCCAGCCCATAGGCCTCCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCATTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTT
  3   1   1         - Brn4      in                         CAAL6260.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTTACACTGAGCAGTTTCTGGCCNTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTT
  3   1   1         - Sto1      in                         CABG3969.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTACACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGGGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAAATGGCATTTATTAAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGCACATTGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTTTGCTCACACACAACAATAGTACATAGTACTGTAAATCTAATCACATCGTTCTATTGACCAGCCTTGATGCCTATGTGTGGGACTTCACAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATACATAGTTGAATTTAAATGTCATACACAGTTGGAGGCCTTGGGGAATACTGCGGAGCATAAAAATACATTGGACACCTGTATCCAGCCCATAGGCCTCCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCATTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTT
  5   1   1         - Gas7      out                        XZG33759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTGAGCAGTTTCTGGCCCTGATAGGGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTTGTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAATACATCTCTTTTCAGTAATAAAATGAATA
  3   1   1         - Te4       in                        CAAN11596.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTGATAGAGCAATTTATCCGTTCGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTAACCTG
  3   1   1         - Te3  5g3  in                         CAAM6198.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATAGGGCAATTTATCCGTTCGTCATGGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTT
  3   1   1         - Tad5      in                         XZT69594.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGATAGGGCAATTTATCCGTTCGTCATTGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTAAAAAAAAAAAAAAAAGG
  3   1   1         - Tad5                                 XZT47351.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTCATTGGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTT
  3   1   1         - Te4       in                         CAAN3363.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCATGGGAACAAAGCACAGCCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGT
  3   1   1         - Te4  5g3  in                         CAAN7709.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCATTGAACAAAGCACCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTTTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTT
  3   1   1         - Lun1      in                         CABD2224.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACAAAGCCCCAGCCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTC
  5   1   1         - Te4       in                         CAAN8823.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGGGTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAATACATCTCTTTTCAGTAATAAAATGAATACTTG
  3   1   1         - Te4       in                         CAAN8823.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTAACCTGAAAAAAAAAAAAAAAGA
  3   1   1         - Te4  5g3  in                         CAAN9441.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGATCCCAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGCATACTTGTT
  3   1   1         - Te4       in                        CAAN10800.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTGNAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTT
  3   1   1         - Te5       in                         CAAO1591.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTTTTATGCTCACACCCAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTT
  3   1   1         - Tad5      in                         XZT23812.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAATGCCGGCTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTT
  3   1   1         - Gas7      in                         XZG19427.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCTGATGTTGTGGGTGCACTTATGTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTAAAAAAAAAAAAAAAGG
  3   1   1         - Gas7      in                         XZG59431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGATGTTGTGGGTGCACTTATGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACCCCCAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACCCCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTACCCTG
  5   1   1         - Neu       in                   TNeu131p17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATCCCCGGGTGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGC
  3   1   1         - Neu       in                    TNeu131p17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATCCCCGGGTGTTTCTTGAAGATTATGTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7 5g3  in                         XZG28785.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACTTATGTTTCTTGAAGATTAGTTTCATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCTAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACACTCTGCAGCAGATGATTTAATATTGCACTCAATTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTAAAAAAAAAAAAAAAGG
  3   1   1         - Eye       in                         CCAX2565.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTTGCTAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGGGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAAATGGCATTTATTAAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGCACATTGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTTTGCTCACACACAACAATAGTACATAGTACTGTAAATCTAATCACATCGTTCTATTGACCAGCCTTGATGCCTATGTGTGGGACTTCACAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATACATAGTTGAATTTAAATGTCATACACAGTTGGAGGCCTTGGGGAATACTGCGGAGCATAAAAATACATTGGACACCTGTATCCAGCCCATAGGCCTCCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCATTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTA
  3   1   1         - Te3       in                        CAAM14898.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAAACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTT
  3   1   1         - Gas7      in                         XZG56512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACTGCCAAGAAGGGTTGTCGAAGCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACACTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTT
  3   1   1         - Gas                             TGas117l11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCACATGTGCCTAATTTCATTTTTGATGAATTCCGGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGGGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAAATGGCATTTATTAAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGCACATTGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTTTGCTCACACACAACAATAGTACATAGTACTGTAAATCTAATCACATCGTTCTATTGACCAGCCTTGATGCCTATGTGTGGGACTTCACAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATACATAGTTGAATTTAAATGTCATACACAGTTGGAGGCCTTGGGGAATACTGCGGAGCATAAAAATACATTGGACACCTGTATCCAGCCCATAGGCCTCCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCATTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTTAGTAATAAAATGAATACTGTTAACCGAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAAAAA
  3   1   1         - Tail      in                         CBSW5842.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGGGGCTGAAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAAATGGCATTTATTAAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACCTTGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTTTGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCGTTCTATTGACCAGCCTTGATGCCTATGTGTGGGACTTCACAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCATACACAGTTGGAGGCCTTGGGGAATACTGCGGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTCCAGTTGGGCAGCTCTTTAATAGATAATATGCACTCTCTGCAGCAGATGATTTAATATTGCACTCATTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTAAAAAAAAAAAAAAA
  3   1   1         - Te1  5g3  in                         CBWN8462.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACGATACAGTGACCCCCAGGGTGAACGGCTATTTGGGAGTGGCTGAAAAAATGAAGTACGGATTTACTAACTCTGGGATGTGCAACTTTGCAAATGAGCAGGGGTTGCACCTAGTGCCGATGTGCTAGGTGCCCATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACACTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGTTAACCTGAAAAAAAAAAAAAAA
  3   1   1         - Te4  5g3  in                         CAAN2718.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATATTAATGTGGATGTGGCACAATGAGGAAGTCTATTGCTATTGGCTAGGCACTGAATACAGGTTTTCTTATGCTCACACACAACAATAGTATTACATAGTACTGTAAATCTAATCACATCATTCTATTGACCAGCCTTAATGCCTATGTGTGGGACTTCTCAATTTATATTGTAGGTCAGTTCTCCCTAGCTTTTCCCAGATATTGCACTAAATATCCAATATGTCCACTGCCTGGAGCTGAGTTGAATTTAAATGTCACAGTTGGAGGCCTTGGGGAATATTGCAGAGCATAAAAATACATTGAACACCTGTATCCAGCCCATAGGCCTTCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCAGTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTGT
  3   1   1         - Sto1      in                         CABG2865.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGAATACTGCGGAGCATAAAAATACATTGGACACCTGTATCCAGCCCATAGGCCTCCAGTTGGGCAGCTCTGTAATAGATAATATGCACATTCTGCAGCAGATGATTTAATATTGCACTCATTTATGTTTAGATTCTTGTTCATAGATGTGAGGGATACATCATTTTTCATGATCTTGTCCTTTAAATACATCTCTTTTCAGTAATAAAATGAATACTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)