Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABE5207.5.5                         72 END     1           1        1                XCAP-E

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 223.0    0Xt7.1-XZG63996.5                           46 PI      79        331      645                forkhead box D3 [Xenopus tropicalis]
     3 210.0    0Xt7.1-TTpA063f13.5                          8 PI      78        329      633                BF-2 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 94%

 1012153643 Xt7.1-TGas104b15.3.5 - 72 ESTs
                                                                       ........-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas104b15.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTTGGCCCTTTGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAACTACTGGACCCTGGACCCTGCCTCTGAGGACATGTTTGATAATGGGAGCTTCCTTAGAAGGCGGAAAAGGTTTAAGAGGCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATGAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008266273                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCTTTGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAACTACTGGACCCTGGACCCTGCCTCTGAGGACATGTTTGATAATGGGAGCTTCCTTAGAAGGCGGAAAAGGTTTAAGAGGCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATGAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            2     2    10    10    25    26    28    29    27    29    29    30    30    31    30    31    30    31    30    31    30    31    30    31    30    31    30    31    30    31    30    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    32    33    33    34    34    34    34    33    34    33    34    33    33    33    33    33    33    33    33    33    33    33    33    30    31    29    30    29    30    29    30    29    30    29    30    29    30    24    24    22    23    23    23    23    23    24    24    25    25    26    26    26    26    26    26    23    23    23    23    26    27    26    27    22    24    21    24    21    24    21    23    19    22    17    21    15    21    13    18    14    19    14    19    15    19    22    24    22    24    24    26    25    27    27    30    30    31    30    31    31    33    33    35    33    35    33    34    33    34    33    34    31    34    34    35    33    34    35    36    33    36    34    36    31    36    34    36    34    36    34    36    34    36    30    35    30    34    32    34    30    34    32    34    32    33    32    33    28    33    32    32    32    32    30    32    30    32    30    32    28    32    30    32    28    32    30    32    31    32    26    32    28    32    30    32    30    32    26    32    30    32    30    32    31    32    30    33    29    32    30    32    30    32    31    32    30    32    29    32    27    30    29    29    28    29    25    27    21    27    13    23    10    12     2     3
  5   1   2       e50                               Xt7.1-TGas104b15.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTTGGCCCTTTGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAACTACTGGACCCTGGACCCTGCCTCTGAGGACATGTTTGATAATGGGAGCTTCCTTAGAAGGCGGAAAAGGTTTAAGAGGCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATGAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       e50                                 Xt7.1-XZG55261.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCACCCTGGAACTATAATCCCTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCCCCCGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCCCTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGGGGATTCTGCCCCTAGGACTTTCTTGTGTCCAACCCCGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATTTAGCATCCCCTAAATTATAAGGTTGTCCGGGGAGATGATAGTTGCAGTTCCTTAACAGCTGAAGGGCCCCCCGTTGTAAATACCCCGCCCGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCCCCTGTGATGCTGGATGCCTGAATCCCTATGGATTGTATGTGTATTTAGGGACCCCGAAATGATGGCTGGGGGCTTCCCTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTTTTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCCCCTGAATAAAATC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -C-G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----T-----T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --G----C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---C---C----
                                               BLH ATG      49     892                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               BLH OVR      49      75                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               EST CLI      15      51                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               ORF LNG      49       4                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                                                       PROTEIN --- Br ---- 5e-017     CAB64779.1 winged helix nude [Branchiostoma lanceolatum] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Sc ---- 9e-022     NP_009991.2 Dosage-dependent suppressor of cmd1-1 mutation; shows homology to fork headfamily of DNA-binding proteins; Hcm1p [Saccharomyces cerevisiae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bb ==== 2e-045     BAD97363.1 forkhead protein FoxE4 [Branchiostoma belcheri] ==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 9e-049     NP_496411.1 UNCoordinated locomotion UNC-130, forkhead box D1 (37.3 kD) (unc-130)[Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Bf ---- 1e-054     AAN03853.1 winged helix/forkhead transcription factor [Branchiostoma floridae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 2e-055     NP_523814.1 forkhead domain 59A CG3668-PA [Drosophila melanogaster] ---------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Cs ---- 3e-056     BAB68347.1 forkhead protein FoxD [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 8e-058     BAE06435.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 5e-057     XP_001188749.1 PREDICTED: similar to forkhead transcription factor D [Strongylocentrotus purpuratus] ---------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Mm ---- 4e-058     XP_997137.1 PREDICTED: similar to forkhead box D3 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 4e-059     NP_036315.1 forkhead box D3 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN -== Gg ==== 6e-063     NP_990282.1 forkhead box D3 [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 2e-077     NP_571345.1 forkhead box D5; fork head domain protein 8 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          AAF34705.1 winged helix transcription factor XFD-12' [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 0          CAH64539.1 Fox protein [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas104b15.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------TAA---------------TGATAG------------------TGA---------------------------------------------------------------ATGTGA------ATG------------------------------------------ATGATG------------------------------------ATG------------------------------------------------------------------------------TGA---------------------------------------------TGA---------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  0   1   1           Gas  FL                     TGas140e03.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAACTACTGGACCCTGGACCCTGCCTCTGAGGACATGTTTGATAATGGGAGCTTCCTTAGAAGGCGGAAAAGGTTTAAGAGGCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTTCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTCTGCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATG
  5   1   2       e50                               Xt7.1-TGas104b15.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTTGGCCCTTTGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAACTACTGGACCCTGGACCCTGCCTCTGAGGACATGTTTGATAATGGGAGCTTCCTTAGAAGGCGGAAAAGGTTTAAGAGGCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATGAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224485                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCTTTGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAACTACTGGACCCTGGACCCTGCCTCTGAGGACATGTTTGATAATGGGAGCTTCCTTAGAAGGCGGAAAAGGTTTAAGAGGCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATGAAAAAAAAAAAAAAAAAA
  5   1   2   12  bld Gas7 5g3  in                         XZG20526.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTTGGCCCTTTGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCCACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCTTACCCTGA
  5   1   2   22  bld Gas7 5g                              XZG41058.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTTGGCCCTTTGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGA
  5   1   2   12  bld Gas7 5g3  in                         XZG22759.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTGGCCCTTTGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAA
  5   1   2   12  bld Gas7 5g3  in                         XZG34914.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTGGCCCTTTGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACA
  5   1   2       bld Neu  5g                        TNeu043m16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTTTGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggGCGGAAAAGTTTAAGAGGCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATC
  5   1   2   12  bld Gas7 5g3  in                         XZG51280.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTTTGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGANAATTTGACCATGCCAACTCACCTTTCTCCCTACCCAGACATAAAGAGAAAGTTCCTTTACCCTGACAGGGGTACACA
  5   1   2   12  bld Gas7 5g3  in                         XZG26726.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGNCAACTCACCTTTGCTCCCTACCAGACATAAAG
  5   1   2       bld Gas  5g3  in                   TGas104b15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGGAGACTACACATTCACAGAAAGCATCAGTGCTGGCAGTGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGGGTTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTGCTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCGTCTGTGATTTTATCAACAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCGGAACTCCATCAGGCGCAACCTGTGCCTTAATGACTGCTTTATTAAAATA
  5   1   2       bld Gas  5g3  in                   TGas067c17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttc
  5   1   2       bld Neu  5g3  in                   TNeu131m16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGCGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTATCAGCAGCAAGTTCCCTTACTAC
  5   1   2       bld Gas  5g3  in                   TGas115h11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTG
  5   1   2   12  bld Gas7 5g3  in                         XZG15949.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCA
  5   1   2       bld Gas  5g                        TGas012p05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAAC
  5   1   2       bld Gas  5g3  in                   TGas055d21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACTCACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagct
  5   1   2   12  bld Gas7 5g3  in                         XZG40898.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACA
  5   1   2   12 seed Gas7 5g3  in                         XZG43181.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GACTACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGA
  5   1   2       bld Gas  5g3  in                   TGas071h11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTATTAAAATACCAC
  5   1   2       bld Gas  5g3  in                   TGas071j15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACT
  5   1   2       bld Neu  5g3  in                   TNeu107l10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGGGATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGA
  5   1   2       bld Gas  FL   in                   TGas140e03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaataccacgggaaccaggaaatccagaaaaggcaactactggaccctggaccctgcctctgagacatgtttgataatgggagcttcc
  5   1   2   12  bld Gas7 5g3  in                          XZG4086.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TACCATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTCCTTACCCTGACCAGGGGGTACACA
  5   1   2   22  bld Gas7 5g                              XZG13321.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTTTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCCTACCAGACATAAAGAGGAAAGTTCCTTACCCTGACCA
  5   1   2   22  bld Gas7 5g                              XZG20614.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAA
  5   1   2   12  bld Gas7 5g3  in                         XZG65408.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAA
  5   1   2       bld Gas8 5g3  in                          st65f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAACTACTGGACCCTGGACCCTGCCTCTGAGGACATGTTTGATAATGGGAGCTTCCTTAGAAGGCGGAAAAGGTTTAAGAGGCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAA
  5   1   2       bld Gas8 5g3  in                          st67f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCACCAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAANCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAACTACTGGACCCTGGACCCTGCCTCTGAGGACATGTTTGATAATGGGAGCTTCCTTA
  5   1   2       bld Gas1 5g   ?                      NISC_mq02c12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCACAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAATACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGTCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttcctT
  5   1   2   32  bld Gas7 5x3  out                        XZG41657.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCC
  5   1   2       bld Gas8 5g3  in                          st66f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAAAGCATCAGTGCTAGCAATGAGCCTTAGCCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCCATCAGGCACAACCTGTCCCTTAATGACTGCTTTATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAACTACTGGACCCTGGACCCTGCCTCTGAGGACATGTTTGATAATGGGAGCTTCCTTAGAAGGC
  5   1   2       bld Gas7      in                         XZG32862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGGAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACC
  5   1   2       bld Gas       in                   TGas107m17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGTCTGGTGCCCACCATGACCCCCAGGATTATCCGGTAGTATCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGATTCCTGCAGTCTAAAGTCACACTTTTACCTACAGCCAACACATTCAGAGATGGGGGACAGTGGCATTCTGAGCCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCTGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatggGAG
  5   1   2       bld Gas7                                 XZG51667.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTAAAGACTCCCCCGCCACCCCATCTGGTGGCAAAGCCAAAAGGGCCCTTGTAAAGCCCCCTTATTCTTATATTGCTCTAATCACTATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTATAACTGGTGGAATCTG
  5   1   2       bld Gas7      in                         XZG57250.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAGAGCCCACACAAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCCACTAGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTTATGT
  5   1   2       bld Gas7                                 XZG17964.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGAAACTGACTCTCAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGG
  5   1   2       bld Gas       in                   TGas064b23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCCTGCTtggcagaactccatcaggcacaacctgtcccttaatgactgctttattaaaataccacgggaaccaggaaatccaggaaaaggcaactactggaccctggaccctgcctctgaggacatgtttgataatgggagcttccttagaaggcggaaaaggtttaagaggCACCAGCAGGAGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTTCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTCTGCTATCCAATGCCCAGGGCACCAGGC
  5   1   2       bld Gas                            TGas135f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTTCTTTAAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCCCACTGGAAGTAGAGGCGCTTATTGCAGAAGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTG
  3   1   2       chi Gas       in                    TGas107m17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCCGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7                                 XZG21277.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGATGGACTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGACCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGGAGAGGCCAAATTCCGTGCT
  5   1   2       bld Gas7      in                         XZG55261.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTGTGATGTACAACCCACTGCCTTACTACAGACCCTACAGTACCATCCAACCACAGCAAGTGCTCCAGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTT
  3   1   2       bld Gas                             TGas086d10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAGACTCCAGTGGCATGCATGGCATACCAGAAAATTTGACCATGCCAACTCACCTTNGCTCCCTACCCCAGACATAAAGAGGAAAGTTCCTTACCCCTGACCAGGGGGTACACAGGGGGGTTGAAGCCCTGGATGCTGATAACCAACCCCCCCAATAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGGTTCTACTCACATGAATAAAATCATTCAAATGAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas104b15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas115h11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTGCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTANCTNCANCATGAATAAAATTTCATTCAAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  FL   in                    TGas140e03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAGACTCCAGTGGCATGCATGGCAATACCAGAAAATTTGACCATGCCAACTCACCTTTCTCCCTACCCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTCTGCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAA
  3   1   2       bld Gas  5g3  in                    TGas055d21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCCAAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATTTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas067c17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGACATAAAGAGGAAAGTTCCTTACCCTGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCCAATAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas071j15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGACCAGGGGGTACACAGGGGGTTTGAAGCCCTGGATGCTGATAACCACCCCCAAATAATCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTTTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTTTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTTTGCCACTAGGACTTTTTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATTTGCATTTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCCCCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTTTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATTTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTTTACTCACATGAATAAAATCATTCAAAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu107l10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACACAGGGGGTTGAAAGCCCTGGATGCTGATAACCACCCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATGAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8 5g3  in                          st65f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GNTTGNAGCCCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTA
  5   1   2       bld Gas       in                  TGas091f03.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTCTGCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCT
  3   1   2       bld Gas       in                    TGas091f03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTGGATGCTGATAACCACCCCAATAAGTCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTGCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCCCCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACAAGGGTAAAATCATTCCAATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8 5g3  in                          st67f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAGGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCNTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGNGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTANTTATTGTCAAAGACAGGTTTATCCAATNTGCATGTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTNGCAGNTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCNTGAATCGCTATGGATTGTATGNGTATTTAGAGACNCTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTNNGTAATGTCATTCGTTTGCTNTTATGTCNTATTTTTCTGTTAATATTTAATGTAAATAGAAANNTAATCATACTGAATT
  3   1   2       bld Gas8 5g3  in                          st66f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATGCAACTTT
  3   1   2       bld Gas       in                    TGas064b23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTCTGCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu131m16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas071h11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGCAAATGTTCATTTAGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTTTCCCAGCTGTGGTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTTTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTTTGCCACTAGGACTTTTTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATTTGCATTTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCCCCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTTTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTTTACTCACATGAATAAAATCCTTCAAATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                          XZG4086.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTATTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTC
  3   1   2       bld Gas7 5g3  in                         XZG43181.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGAGAACATCATGAGGAAACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATG
  3   1   2       bld Gas7 5g3  in                         XZG40898.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATGAGGAAACCCAAGGATCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATG
  3   1   2       bld Gas7 5g3  in                         XZG34914.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCCCCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATG
  3   1   2       bld Gas7 5g3  in                         XZG51280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTCTGCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCCCCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCCTTCAAATGG
  3   1   2       bld Gas7 5g3  in                         XZG22759.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCCAAGGAGCCAGAGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAAGG
  5   1   2       bld Gas7      in                         XZG57003.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCCAAGTTTTTCAACCTTTAACCCACACTGGAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAAT
  3   1   2       bld Gas7      in                         XZG32862.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCACCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGTACATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACACTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAAGTGAAAAAC
  3   1   2       bld Gas7 5g3  in                         XZG26726.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCCCTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCCCCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCCCATGTGATGCTGGATGCTTGAATCGCTATGGATTGTATGTGTATTTAGAGACCCTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCCCATGAATAAAATCCTTCCAATGG
  3   1   2       bld Gas7 5g3  in                         XZG15949.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGCCCAGGGCACCAGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCACTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGATTCTGCCACTAGGACTTTCTTGTGTCCAACCCAGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATTTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTGCAGTTCATTAACAGCTGAAGGGCCCCCAGTTGTAAATACCTCGACAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCCCATGTGATGCTGGATGCCTGAATCGCTATGGATTGTATGTGTATTTAGAGACCCTGAAATGATGGCTGAGGACTTCACTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCCCCTGAATAAAATCATTCAAATGGAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG65408.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAATACACCCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCCCTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGGGGATTCTGCCCCTAGGACTTTCTTGTGTCCACCCCAGAGATTTTCATTTTATTTATTGTCAAAGCCAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCAGGGGAGATGATAGTTCCAGTTCATTACCAGCTGAAGGGCCCCCAGTTGTAAATCCCTCGCCAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCCCATGTGATGCGGGATGCTTGAATCCCTATGGATTGTATGTGTATTTAGAGCCCCTGAAATGATGGCTGAGGACTTCCCTTGGCCCCTGTGGGCAACGGGTATCCAGTTTTGTAATGCCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAAGGTAAATAGAAATGTAATCTATTGAATTTTTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCCCAGGAATAAAACCTTTC
  5   1   2       chi Gas7      in                          XZG5994.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCACATGAATAAAATCATTCAAATGAATATACGGACTGTAGATATTTCTTTCCATATACAAACATTCATATAAACTTTACTTTCCATCATCACTTTACATCATAATCTTAATTTGTGCAATTTCAGGTTCTTTAGCACAATATTTTCACAGCTTTCTGTCTGTCTGTCAACATACTTGTTTATCTATCTATCTATCTATCTATCTATCATCTATCTATCCATCTTTCTCTATCTATATAAAATATACTTTATAGCCTTTTGTTAAATTGTTATTGCAGCGTGGAACCAGTCTTTCCAAAACCAGGTTATAGGTTAACCCTGCTGATCTTAAAAGTACAATATAAATTTTCAGCATAGCAAGAACATAACTAACACTAAACTGCCCATCATTTCTCTACAACAAATGTAACAAATGAATAGGGAGTAAAAACTGTGGGAGGTTCATTATTTGAAGTATTTAATTTTGGGGGAAATGTAATTAAACGTCACACAGTTTAAGATATAACAACAATAAATTCAAATTAACATTTCCTATGCCCGATAATATTTAATATAAAATTTTATCACTGAAGCCAGTACTCATACCCGTACATGAATATTATTTTAGATACTTCATACACTAATTTTCTCTAAAT
  3   1   0       add Gas7      in                          XZG5994.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGCCCGATAATATTTAATATAAAATTTTATCACTGAAGCCAGTACTCATACCCGTACATGAATATTATTTTAGATACTTCATACACTAATTTTCTCTAAATAAAAATATGTGTCAGACCAAAATCTTCATTTCACATTCTGCAAATGAAGCCACTAATAGGTTATACAGCAGAAAGTTACAGGCAAAGGCTGTGCATTTCTCTAAATGATTTTAATCATACTTTTTGTTGGGTTTTATTTCACTATAAGATCCTCTGGATTTATGATGTGCCGATTATAAGGAAGAGATAGCTTCCCACGACATCTAGGTTTGGGGGTTTACAGCCGATGGATATCAGCTGTTGCTTGTGCTTATGGGGTCTTTAAAAAATACAGGGCACAGTCCAGCAGTAGGAATTCTACATTTTTTAGAGGTCCATGGGACTTATGTAAAGTAAATTGCAACACCTGCTGATTAGTTGCTACAGATCACTTCAAGGTCCAATTGAGCCCCTGTGAGTCCTCAGTACGTCAATGGTAATTTTTTTCCAGTTATTTCATTTTAATTGTTGCTATGTGACACTTCACTGGTATTGTTTTACTGAATATCTGGTGAGGTAGCTGTGTTAATGTCACTTTCCTTTTTTAATGGAGCCTGGGGGTGTAGAAGGAAAGTAAACTTGCAGACCACTTGGGGATTGGTCTTTGAAAAATGTTTGTTTTGCAAGAAACATAAAGTTTTATCTGTACTACCTTCTTC
  5   1   2       e50                                 Xt7.1-XZG55261.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCACCCTGGAACTATAATCCCTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCCCCCGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCCCTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGGGGATTCTGCCCCTAGGACTTTCTTGTGTCCAACCCCGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATTTAGCATCCCCTAAATTATAAGGTTGTCCGGGGAGATGATAGTTGCAGTTCCTTAACAGCTGAAGGGCCCCCCGTTGTAAATACCCCGCCCGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCCCCTGTGATGCTGGATGCCTGAATCCCTATGGATTGTATGTGTATTTAGGGACCCCGAAATGATGGCTGGGGGCTTCCCTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTTTTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCCCCTGAATAAAATC
                                                  Xt7.1-CHK-1008247041                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGAACTATAATCCCTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCCCCCGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCCCTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGGGGATTCTGCCCCTAGGACTTTCTTGTGTCCAACCCCGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATTTAGCATCCCCTAAATTATAAGGTTGTCCGGGGAGATGATAGTTGCAGTTCCTTAACAGCTGAAGGGCCCCCCGTTGTAAATACCCCGCCCGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCCCCTGTGATGCTGGATGCCTGAATCCCTATGGATTGTATGTGTATTTAGAGACCCCGAAATGATGGCTGGGGGCTTCCCTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTTTTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCCCCTGAATAAAATCCTTCCA
  3   1   2       bld Gas7      in                         XZG55261.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCACCCTGGAACTATAATCCCTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCCCCCGGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCCCTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGGGGATTCTGCCCCTAGGACTTTCTTGTGTCCAACCCCGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATTTAGCATCCCCTAAATTATAAGGTTGTCCGGGGAGATGATAGTTGCAGTTCCTTAACAGCTGAAGGGCCCCCCGTTGTAAATACCCCGCCAGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCCCCTGTGATGCTGGATGCCTGAATCCCTATGGATTGTATGTGTATTTAGAGACCCTGAAATGATGGCTGGGGGCTTCCCTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAAAGTAATCTATTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCCCCTGAATAAAATCCTTCCAATGG
  3   1   2      seed Gas7      in                         XZG57003.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTATAATCACTTATTGCAGAGGCCAAATTCCTGCCTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTTTCCTATCCAATGCCCAGGGCCCCAGGCAATACAACCTCATAAAATTCCCTGGGGGTTACTGAAGTAAGTCCCTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGGGGATTCTGCCCCTAGGACTTTCTTGTGTCCAACCCCGAGATTTTCATTTTATTTATTGTCAAAGACAGGTTTATCCAATCTGCATCTAGCATCCCCTAAATTATAAGGTTGTCCGGGGAGATGATAGTTGCAGTTCCTTAACAGCTGAAGGGCCCCCCGTTGTAAATACCCCGACCGTCATAAGTACTTGTGTGAGAGCCCCAAGTGGCCCCTGTGATGCTGGATGCCTGAATCCCTATGGATTGTATGTGTATTTAGAGACCCCGAAATGATGGCTGGGGGCTTCCCTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCATTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTTTTGAATTATTTATTATGAAATTTATTGCAACTTTTCGCTTCTACTCCCAGGAATAAAATCCTTCCAATGG
  3   1   2       bld Gas7      in                         XZG57250.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGTTAACCTATCCCCTGGCCCTTTCCTTTCCAATGCCCAGGGCCCCCGGCAATACAACCTCATAAAATTCCCCGGGGGTTACTGAAGTAAGTCCCTTTGGGTTTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGGTTTTTCCTTATAACTGGGGGGTTTTGCCCCTAGGGCTTTTTTGTGTCCCACCCCGGGATTTTCCTTTTTTTTTTTGTCAAAGACAGGTTTTTCCAATTTGCATTTAGCATCCCCTAAATTTTAAGGTTGTCCGGGGGGATGATAGTTGCAGTTCCTTAACAGCGGAAGGGCCCCCCGTTGTAAATACCCCGCCCGTCATAAGGACTTGGGGGGGAGCCCCCAGTGGCCCATGGGATGCTGGATGCCTGAATCCCTATGGGTTGTATGGGTTTTTAGGGACCCCGAAATGATGGGTGGGGGCTTCCCTTGGCCCCTGTGGGCAACGGGGATGCCGTTTTGTAAAGTCCTTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGGAAAAAGAAAAGTAATCTTTTGAATTTTTTTTTTTGAAATTTTTTGCAACTTTTCGCT
  3   1   2       bld Gas7 5g3  in                         XZG20526.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCAATACAACCTCATAAAATTCCCTGGGTGTTACTGAAGTAAGTCCCTTTGGGTCTCACATAGCCCCTGTACTGCCCTACCCATATCCTTTCAGGATTTTTCCTTATAACTGGTGGGTTCTGCCCCTAGGACTTTCTTGTGTCCCACCCCGAGATTTTCATTTTTTTTTTTGTCAAAGACAGGTTTTTCCAATCTGCATTTAGCATCCCCTAAATTATAAGGTTGTCCGGGGGGATGATAGTTGCCGTTCCTTAACAGCTGAAGGGCCCCCCGTTGTAAATACCCCGCCCGTCATAAGTACTTGTGTGGGAGCCCCAAGTGGCCCCTGTGATGCCGGATGCCTGAATCCCTATGGATTGTATGTGTATTTAGGGACCCCGAAATGATGGCTGGGGGCTTCCCTTGGCCCCTGTGGGCAACGGGTATGCAGTTTTGTAATGTCCTTTGTTTGCTTTTATGTCTTATTTTTCTGTTAATATTTAATGTAAATAGAAATGTAATCTTTTGAATTTTTTTTTTTGAAATTTATTGCAACTTTTCGCTTCTACTCCCCGGAATAAAATCCTTCCAAGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)