Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 28 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-st26c10.3                            12 END     1           1        8                novel zinc finger protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 91%

 1012153660 Xt7.1-TNeu118k03.3.5 - 64 ESTs
                                                                       .....-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu118k03.3.5                                                                                                                              CAGGCACCTGGCCACAGCATTGTTAGTCATGTGTAGCATCAAGGCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGGTTCCAAAACCGCAGAGCCAAAGAAAGGAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATGTTCTGTGCAGAGTGATTCCAGTTCAGCCAGTCCAAACCCACTTTGTGACTCTGTGGTACATACGGATATGTCAGGTTCCTTATACCAGCCGCCACCAATTGCACTCAATGGTCTCTAGCAGAGAAGGATGTGTCTGCAAGAATGTCACTCCGTTCCAAAGAACTGCAAGCTTTGGCAGTATTAAGTGAACACTGATTGTTACACAGGCATAAGACCTACAAGTCATCACCACAGTGTGATAAATACTATACATCCATTTATCCTTTGTTCCACTGGATCCAATGCAACCATTGGGTTTGTGATTCATGAAGCCTTTGACTACAGAAGATACGTGAGAAGGGGTTTGCTTTTATTGACCTGGAAGCCCTTATGCAGTTGAAGCTATTCCTGGGAAATGCACCACAAATGTGTAATAGAAATCTGAAGCCGTGTATCGAAAAAAATTCAGTGATCAATTACAGACTCGGAATAGGAAACCAAACTGTTGTGTTGGCATCAGCCTAACATAGCAAGATTGTACAAAGCCTTAATGGAAACTGAACTCTAGGTCTTCCTATCGTCTTTATTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008265370                                                                                                                                    CCTGGCCACAGCATTGTTAGTCATGTGTAGCATCAAGGCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGGTTCCAAAACCGCAGAGCCAAAGAAxGxAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATGTTCTGTGCAGAGTGATTCCAGTTCAGCCAGTCCAAACCCACTTTGTGACTCTGTGGTACATACGGATATGTCAGGTTCCTTATACCAGCCGCCACCAATTGCACTCAATGGTCTCTAGCAGAGAAGGATGTGTCTGCAAGAATGTCACTCCGTTCCAAAGAACTGCAAGCTTTGGCAGTATTAAGTGAACACTGATTGTTACACAGGCATAAGACCTACAAGTCATCACCACAGTGTGATAAATACTATACATCCATTTATCCTTTGTTCCACTGGATCCAATGCAACCATTGGGTTTGTGATTCATGAAGCCTTTGACTACAGAAGATACGTGAGAAGGGGTTTGCTTTTATTGACCTGGAAGCCCTTATGCAGTTGAAGCTATTCCTGGGAAATGCACCACAAATGTGTAATAGAAATCTGAAGCCGTGTATCGAAAAAAATTCAGTGATCAATTACAGACTCGGAATAGGAAACCAAACTGxxxxxxTGGCATCAGCCTAACATAGCAAGATTGTACAAAGCCTTAATGGAAACTGAACTCTAGGTCTTCCTATCGTCTTTATTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAxxxxxAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                   2     2     2     2     2     2     2     3     6     6     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    10    11     8    10     8    10     6     8     6     8     5     7     5     7     5     6     5     6     5     6     4     5     4     5     2     3     2     3     2     3     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     2     4     4     5     4     6     4     6     4     6     5     7     6     8     7     8     8     9     8     9     9    10     9    10     9    11     9    12     9    12     9    12    10    13    10    15    10    15    11    16    12    17    14    20    16    23    18    24    18    24    18    24    23    29    25    33    26    33    26    33    26    33    30    36    30    36    35    41    37    41    37    41    37    41    36    40    35    39    34    42    35    42    36    46    37    47    36    47    38    47    38    47    38    47    38    48    39    49    38    49    38    49    37    49    39    49    38    49    38    49    36    48    33    46    42    46    41    46    40    46    42    46    41    46    40    43    38    43    38    43    40    43    39    43    39    43    30    43    29    42    30    42    30    42    30    42    28    40    27    39    26    37    26    36    25    34    24    33    23    32    21    30    15    23    14    22    14    22    13    21     5    15     5     5
  5   1   2  SIG                                       Xt7.1-st18n13.3                                                                                                                           CTGCAGGCACCTGGCCACAGCATTGTTAGTCATGTGTAGCATCAAGGCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGGTTCCAAAACCGCAGAGCCAAAGAAAGGAAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATGTTCTGTGCAGAGTGATTCCAGTTCAGCCAGTCCAAACCCACTTTGTGACTCTGTGGTACATACGGATATGTCAGGTTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTT
  5   1   2  SIG                                    Xt7.1-TGas114e20.3                                                                                                                                                                   ATCAAGGCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAAACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGGTTCCAAAACCGCAGAGCCAAAGAAAGGAAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATGTTCTGTGCAGAGTGATTCCAGTTCAGCCAGTCCAAACCCACTTTGTGACTCTGTGGTACATACGGATATGTCAGGTTCCTTATACCAGCCGCCACCAATTGCACTCAATGGTCTCTAGCAGAGAAGGATGTGTCTGCAAGAATGTCACTCCGTTCCAAAGAACTGCAAGCTTTGGCAGTATTAAGTGAACACTGATTGTTACACAGGCATAAGACCTACAAGTCATCACCACAGTGTGATAAATACTATACATCCATTTATCCTTTGTTCCACTGGATCCAATGCAACCATTGGGTTTGTGATTCATGAAGCCTTTGACTACAGAAGATACGTGAGAAGGGGTTTGCTTTTATTGACCTGGAAGCCCTTATGCAGTTGAAGCTATTCCTGGGAAATGCACCACAAATGTGTAATAGAAATCTGAAGCCGTGTATCGAAAAAAATTCAGTGATCAATTACAGACTCGGAATAGGAAACCAAACTGTTGTGTTAAGTTTTCTTTACATAGCAAGATTGTACAAAGCCTTAATGGAAACTGA------------------------------------------------------------------------------------GCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACCAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTGAAAAAAAAAAAAAA
  5   1   2  SIG                                       Xt7.1-XZG1110.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGCGTTGGCTGAAATACGCCAGTACTTGCAAAGCAAGCTATTCCTATGGATACGCAAAGGCAGCTGCCAGACCTAGTGGAAATACGCGGCGTTTTTTGCTATTTCACACTATTAGCACCATGGCAACGGGATTTGCTTACGTCACCAGTACTAGGCTGAAAAACGCCATGTGTGGCTTGTGCGGCGTTTTTAGGCTGAGAAAAAACGCAGCGTAAAAACGCCACGTGTGGCATCAGCCTAACATAGCAAGATTGTACAAAGCCTTAATGGAAACTGAACTCTAGGTCTTCCTATCGTCTTTATTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGACTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTGAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TNeu118k03.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCCTATCGTCTTATTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGCTCCATTGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTGAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTAAATCCTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTCTGGGGCAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAA
                                                                   SNP                                                                                                                                                                                                                  ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --C---------
                                               BLH ATG     166     584                                                                                                                              
                                               BLH MIN     166      68                                                                                                                              
                                               BLH OVR     166      31                                                                                                                              
                                               EST CLI      37      16                                                                                                                              
                                               ORF LNG     166       1                                                                                                                              
                                                                       PROTEIN --- Dm ---- 1e-024     NP_476954.1 caudal CG1759-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Ci ---- 6e-028     BAE06346.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                         PREDICTED - Sp ---- 9e-030     XP_789158.2 PREDICTED: similar to transcription factor Cad [Strongylocentrotus purpuratus] ----------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 5e-045     NP_005184.1 caudal type homeo box transcription factor 4 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 4e-045     NP_031700.1 caudal type homeo box 4 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dr ---= 6e-057     NP_571184.1 caudal homeobox 1 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Gg ---= 2e-066     XP_420293.1 PREDICTED: similar to caudal-type homeobox protein CDXB [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === ?? ==== 2e-104     NP_001080720.1 caudal type homeo box 4 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 1e-116     AAH55999.2 Cdx4 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 5e-123     AAL14634.1 cad3 [Silurana tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu118k03.3.5                                                                                                                                                          ATG---------------------TAA------------------------------TGA------------------------------------------------------------------------------ATG------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------TGA---------------------TAA------------------------TGATAA---------------------------------------ATG---------------TGA---ATG------------------------TGA------------------TGA------------------------------------------------------TAATAG------------------------------------------------------------------------------------------TAG------------------TAA------------------------------------------TAA---------------------------------ATGTGA------------------------------------------------------------TGA---ATG------------------------------------TAG------------------------------------TAA------------------TGA---------------------------------ATG---------------------------------------ATG------------------------TGA------TAA------------------------------------TGA---------------------TAA------------TAG------TAA------------------TAG---------ATG---------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------ATG---------------------------------------------------------------------ATG---------TAG---------------------ATG------------------------------------------------TGA------------------------------------------------------------------TAG---------------------------------------------TAG---------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2  SIG                                       Xt7.1-st18n13.3                                                                                                                           CTGCAGGCACCTGGCCACAGCATTGTTAGTCATGTGTAGCATCAAGGCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGGTTCCAAAACCGCAGAGCCAAAGAAAGGAAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATGTTCTGTGCAGAGTGATTCCAGTTCAGCCAGTCCAAACCCACTTTGTGACTCTGTGGTACATACGGATATGTCAGGTTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTT
                                                  Xt7.1-CHK-1008285384                                                                                                                                 GCACCTGGCCACAGCATTGTTAGTCATGTGTAGCATCAAGGCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGGTTCCAAAACCGCAGAGCCAAAGAAAGGAAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATGTTCTGTGCAGAGTGATTCCAGTTCAGCCAGTCCAAACCCACTTTGTGACTCTGTGGTACATACGGATATGTCAGGTTCCTTATA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATT
  0   1   1           Gas  FL                     TGas108b24.FL-Sanger                                                                                                                                                                                CCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGGTTCCAAAACCGCAGAGCCAAAGAAAGGAAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATGTTCTGTGCAGAGTGATTCCAGTTCAGCCAGTCCAAACCCACTTTGTGACTCTGTGGTACATACGGATATGTCAGGTTCCTTATACCAGCCGCCACCAATTGCACTCAATGGTCTCTAGCAGAGAAGGATGTGTCTGCAAGAATGTCACTCCGTTCCAAAGAACTGCAAGCTTTGGCAGTATTAAGTGAACACTGATTGTTACACAGGCATAAGACCTACAAGTCATCACCACAGTGTGATAAATACTATACATCCATTTATCCTTTGTTCCACTGGATCCAATGCAACCATTGGGTTTGTGATTCATGAAGCCTTTGACTACAGAAGATACGTGAGAAGGGGTTTGCTTTTATTGACCTGGAAGCCCTTATGCAGTTGAAGCTATTCCTGGGAAATGCACCACAAATGTGTAATAGAAATCTGAAGCCGTGTATCGAAAAAAATTCAGTGATCAATTACAGACTCGGAATAGGAAACCAAACTGTTGTGTTAAGTTTTCTTTACATAGCAAGATTGTACAAAGCCTTAATGGAAACTGAACTCTAGGTCTTCCTATCGTCTTTATTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTGATAAAAAAAAAAAAAAAAAA
  5   1   2       ext Gas1 5g                            IMAGE:6986547                                                                                                                           CTGCAGGCACCTGGCCACAGCATTGTTAGTCATGTGTAGCATCAAGGCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAAGGTAAAATC
  5   1   3        nb Neu  5g                        TNeu011k23.p1kSP6                                                                                                                              CAGGCACCTGGCCACAGCATTGTTAGTCATGTGTAGCATCAAGGCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGACCTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGTGCAGAATTACGCATCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGA
  5   1   3        nb Neu  5g                        TNeu015c03.p1kSP6                                                                                                                                                             TAGCATCAAGGGGCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGACCTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTCATTACAGCAGATATATCACTAT
  5   1   4      seed Gas8      in                          st18n13.5p                                                                                                                                                                        GGCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGACCTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGG
  5   1   2       add Gas1 5g3  in                     NISC_mq10a08.y1                                                                                                                                                                         GATCCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGGTTAGGTTTACCTTTTTACATTAAAGCAGAAAGGCAACCAGAAGAAAATATATGCAAGACGAGAACCAAAGAA
  5   1   2       add Gas  FL   in                   TGas108b24.p1kSP6                                                                                                                                                                               GCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATAC
  5   1   2   22  ext Gas7 PIPE                             XZG6877.5p ..............................................................................................................................................................................GGCCTACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGGTTCCAAAACCGCAGAGCCAAAGAAAGGAAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATGTTCTGTGCAGAGTGATTCCAGTTCAGCCAGTCCAAACCCACTTTGTGACTCTGTGGTACATACGGATATGTCAGGTTCCTTATAC
  5   1   3        nb Gas                            TGas048o22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                              CAATAACCACTCAGCGCAGNAATACGCATCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAATATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACTAAAGAAAAATACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTT
  5   1   3        nb Gas       out                  TGas140j14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGGTTCCAAAACCGCAGAGCCAAAGAAAGGAAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATG
  3   1   4      seed Gas8      in                          st18n13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTT
  5   1   2  SIG                                    Xt7.1-TGas114e20.3                                                                                                                                                                   ATCAAGGCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAAACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGGTTCCAAAACCGCAGAGCCAAAGAAAGGAAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATGTTCTGTGCAGAGTGATTCCAGTTCAGCCAGTCCAAACCCACTTTGTGACTCTGTGGTACATACGGATATGTCAGGTTCCTTATACCAGCCGCCACCAATTGCACTCAATGGTCTCTAGCAGAGAAGGATGTGTCTGCAAGAATGTCACTCCGTTCCAAAGAACTGCAAGCTTTGGCAGTATTAAGTGAACACTGATTGTTACACAGGCATAAGACCTACAAGTCATCACCACAGTGTGATAAATACTATACATCCATTTATCCTTTGTTCCACTGGATCCAATGCAACCATTGGGTTTGTGATTCATGAAGCCTTTGACTACAGAAGATACGTGAGAAGGGGTTTGCTTTTATTGACCTGGAAGCCCTTATGCAGTTGAAGCTATTCCTGGGAAATGCACCACAAATGTGTAATAGAAATCTGAAGCCGTGTATCGAAAAAAATTCAGTGATCAATTACAGACTCGGAATAGGAAACCAAACTGTTGTGTTAAGTTTTCTTTACATAGCAAGATTGTACAAAGCCTTAATGGAAACTGA------------------------------------------------------------------------------------GCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACCAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTGAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008285376                                                                                                                                                                         GCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAAACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGGTTCCAAAACCGCAGAGCCAAAGAAAGGAAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATGTTCTGTGCAGAGTGATTCCAGTTCAGCCAGTCCAAACCCACTTTGTGACTCTGTGGTACATACGGATATGTCAGGTTCCTTATACCAGCCGCCACCAATTGCACTCAATGGTCTCTAGCAGAGAAGGATGTGTCTGCAAGAATGTCACTCCGTTCCAAAGAACTGCAAGCTTTGGCAGTATTAAGTGAACACTGATTGTTACACAGGCATAAGACCTACAAGTCATCACCACAGTGTGATAAATACTATACATCCATTTATCCTTTGTTCCACTGGATCCAATGCAACCATTGGGTTTGTGATTCATGAAGCCTTTGACTACAGAAGATACGTGAGAAGGGGTTTGCTTTTATTGACCTGGAAGCCCTTATGCAGTTGAAGCTATTCCTGGGAAATGCACCACAAATGTGTAATAGAAATCTGAAGCCGTGTATCGAAAAAAATTCAGTGATCAATTACAGACTCGGAATAGGAAACCAAACTGTTGTGTTAAGTTTTCTTTACATAGCAAGATTGTACAAAGCCTTAATGGA------------------------------------------------------------------------------------------------CTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACCAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTGAAAAAAAAAAAAAAAAAAAA
  5   1   4      seed Gas  5g3  in                   TGas114e20.p1kSP6                                                                                                                                                                   ATCAAGGCACCGGCCTAACAGAGGTCATTTGTATCGCAACTCTCATATTGAACTACTGGGCACCATAGTTGCAGAAGTATTCTTAACAGGGTTGAGGATAAAGATGACCACCAAGGATCTCGCCTAGGAATGAACATCACATGTGGGAGACAGGCTATGCACAAGGACGTTACCATGTATCCACTTTCTGTAAGATCCGCCAGCAATAACCACTCAGCGCAGAATTACGCCTCTAACCAACCTTATTTCAACTATGTTACATATCATCATGTTCCACCTATGGATGAACAAGGGCAGCCCTGTGGAGTTTGGGGACCTCAGTATGGCTCACCAAGGGAGCAATGGAACTCTTATGGAGCTGGACCTTCCAACACAAATATGGCACAATCATCTGACTTATCACCTAACCAATTTGCCTATAATTCTTCTGGCTATAGCTCCCCGCATCCATCCGGCACTGGGATTTTACACTCTGTAGATTTGTCTCACACAGCTGCCAACTCACCCAGCGATCTTAGCCAGAATTCTTATGAATGGATGGGGAAAACCGTGCAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAATACCGGGTGGTGTACACTGAC
  5   1   2       ext Neu       in                   TNeu120o10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAATCGACTTCTACAGGCAAGACGAGAACCAAAGAAAAAACCGGGTGGTGTACACTGACCATCAGAGGCTGGAGCTGGAAAAAGAATTTCATTACAGCAGATATATCACTATCAGGCGGAAGACAGAGCTGGCAGCAAGCTTAAGACTCTCTGAAAGACAGGTAAAAATCTGGTTCCAAAACCGCAGAGCCAAAGAAAGGAAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATGTTCTGTGCAGAGTGATTCCAGTTCAGCCAGTCCAAACCCACTTTGTGACTCTGTGGTACATACGGATATGTCAGGTTCCTTATACCAGCCGCCACCAATTGCACTCAATGGTCTCTAGCAGAGAAGGATGTGTCTGCAAGAATGTCACTCCGTTCCAAAGAACTGCAAGCTTTGGCAGTATTAAGTGAACACTGATTGTTACACAGGCATAAGACCTACAAGTCATCACCACAGTGTGATAAATACTATACATCCATTTATCCTTTGTTCCACTGGATCCAATGCAACCATTGGTTGTGATTCATGAAGCCTTTGACT
  5   1   2       ext Neu       in                   TNeu106o17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGAAAGGAAACTGTTCAAGAAGAAAATGAATCAGTTTGACGGCATATGTTCTGTGCAGAGTGATTCCAGTTCAGCCAGTCCAAACCCACTTTGTGACTCTGTGGTACATACGGATATGTCAGGTTCCTTATACCAGCCGCCACCAATTGCACTCAATGGTCTCTAGCAGAGAAGGATGTGTCTGCAAGAATGTCACTCCGTTCCAAAGAACTGCAAGCTTTGGCAGTATTAAGTGAACACTGATTGTTACACAGGCATAAGACCTACAAGTCATCACCACAGTGTGATAAATACTATACATCCATTTATCCTTTGTTCCACTGGATCCAATGCAACCATTGGGTTTGTGATTCATGAAGCCTTTGACTACAGAAGATACGTGAGAAGGGGTTTGCTTTTATTGACCTGGAAGCCCTTATGCAGTTGAAGCTATTCCTGGGAAATGCACCACAAATGTGTAATAGAAATCTGAAGCCGTGTATCGAAAAAAATTCAGTGATCAATTACAGACTCGGAATAGGAAACCAAACTGTTGTGTTAAGTTTTCTTTACATAGCAAGATTGTACAAAGCCTTAATGGAAACTGAACTCT
  3   1   2       ext Neu       in                    TNeu120o10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACCAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTGAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Neu       in                    TNeu106o17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATGNGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTGAAAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Gas  5g3  in                    TGas114e20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGAACTAAAAATGTAAATATATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGACTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAANTGTAATTATTTAATAAAGAATAAAGAAGTTGAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                       Xt7.1-XZG1110.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGCGTTGGCTGAAATACGCCAGTACTTGCAAAGCAAGCTATTCCTATGGATACGCAAAGGCAGCTGCCAGACCTAGTGGAAATACGCGGCGTTTTTTGCTATTTCACACTATTAGCACCATGGCAACGGGATTTGCTTACGTCACCAGTACTAGGCTGAAAAACGCCATGTGTGGCTTGTGCGGCGTTTTTAGGCTGAGAAAAAACGCAGCGTAAAAACGCCACGTGTGGCATCAGCCTAACATAGCAAGATTGTACAAAGCCTTAATGGAAACTGAACTCTAGGTCTTCCTATCGTCTTTATTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGACTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTGAAAAAAAAAAA
                                                  Xt7.1-CHK-1008285380                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGGCTGAAATACGCCAGTACTTGCAAAGCAAGCTATTCCTATGGATACGCAAAGGCAGCTGCCAGACCTAGTGGAAATACGCGGCGTTTTTTGCTATTTCACACTATTAGCACCATGGCAACGGGATTTGCTTACGTCACCAGTACTAGGCTGAAAAACGCCATGTGTGGCTTGTGCGGCGTTTTTAGGCTGAGAAAAAACGCAGCGTAAAAACGCCACGTGTGGCATCAGCCTAACATAGCAAGATTGTACAAAGCCTTAATGGAAACTGAACTCTAGGTCTTCCTATCGTCTTTATTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGACTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTGAAAAAAAAAAAAAAAGG
  5   1   2       ext Gas7                                 XZG22419.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAgcgttggctgaaatacgccagtacttgcaaagcaagctattcctatggatacgcaaaggcagctgccagacctagtggaaatacgcggcgttttttgctatttcacactattagcaccatggcaacgggatttgcttacgtcaccagtactaggctgaaaaacgccatgtgtggcttgtgcggcgtttttaggctgagaaaaaacgcagcgtaaaaacgccacgtgtggcatcagcctAACATAGCAAGATTGTACAAAGCCTTAATGGAAACTGAACTCTAGGTCTTCCTATCGTCTTTATTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATCAAAATAGGCCCTGACATTTTGA
  5   1   4      seed Gas7      in                          XZG1110.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATTTTTGGGCAAAGATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAGAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTACGTAGCATCCTGCAGCAGTGAAATCTATGCGT
  5   1   2       ext Gas7      in                         XZG65291.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGACTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGC
  3   1   4      seed Gas7      in                          XZG1110.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGACTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTNA
  3   1   2       ext Gas7      in                         XZG65291.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGACTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTG
  3   1   2       ext Gas7      in                         XZG60539.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACGCGTCCGGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTAAAAAAAAAAAAAAAGG
  5   1   2       ext Gas7      in                         XZG60539.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTGAAAAAAAAAAAAAAAGG
  5   1   2  SIG                                    Xt7.1-TNeu118k03.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCCTATCGTCTTATTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGCTCCATTGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTGAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008285382                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCGTCTTxxTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGxxxCxxTGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTAAAAAAAAAAAA
  5   1   4   14 seed Gas7 5g3  in                         XZG27412.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGCCTTTGACTACAGAAGATACGTGAGAAGGGGTTTGCTTTTATTGACCTGGAAGCCCTTATGCAGTTGAAGCTATTCCTGGGAAATGCACCACAAATGTGTAATAGAAATCTGAAGCCGTGTATCGAAAAAAATTCAGTGATCAATTACAGACTCGGAATAGGAAACCAAACTGTTGTGTTAAGTTTTCTTTACATAGCAAGATTGTACAAAGCCTTAATGGAAACTGAACTCTAGGTCTTCCTATCGTCTTTATTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGGCCAGGCCCAGACTGGGATTCCAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGT
  5   1   2       add Neu  5g3  in                   TNeu053g24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           aaaaacgcagcgtaaaaacgccacgtgtggcatcagcctAACATAGCAAGATTGTACAAAGCCTTAATGGAAACTGAACTCTAGGTCTTCCTATCGTCTTTATTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCA
  5   1   3   22   nb Gas7 5g                              XZG10673.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGAACTCTAGGTCTTCCTATCGTCTTTATTTTATATAAAAATTTTTGGGCAAAAGATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAA
  5   1   3        nb Gas8 5g3  in                          st57e21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACTCTAGGTCTTCCTATCGTCTTTATTTTATATAAAAAATTTTGGGCAAAAGATTAATTTATTGCTCCATGTGACCAGTGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGT
  5   1   3        nb Gas8 5g3  in                          st59e21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCTAGGTCTTCCTATCGTCNTTATTTTATATAAGAAATTTTGGGCAAAAGATTAATTTATTGCTCCATGGTGACCAGNGGCTGCCCCTCTAGTTGGAAGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACGGTTTTATAGAACATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTANAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGNGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACANAGACCTAANCAGCACCCCCATAGGCCCAATAAATAGTGACCNCGCATCANTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACNGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACNTGTATATGTGTAAACAAGAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATT
  5   1   3        nb Gas8 5g3  in                          st26h17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCAGCTGCAGTCAAACTAAGGCTACTTTGTCAGATTGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTAGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACNAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTA
  5   1   3   14   nb Gas6 5g3  in                         ANBT1280.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGACATGCACATTGGTATCATTTGTTTACAGTTTTATAGAATATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATANGCTGTTCATTCGTTCACAAA
  5   1   3        nb Neu  5x3                       TNeu047b16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATAGTTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTNTACGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTA
  5   1   2       ext Neu  5g3  in                   TNeu118k03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTG
  3   1   2       ext Neu  5g3  in                    TNeu118k03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTACTTCTTGGTTATTGGGGGTTCTGTAAGAGATTAAAGGAAACTTCACCACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTACGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTGAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Neu  5g3  in                    TNeu053g24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTCTGTAAGAGATTAAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCAAGGGGCTTGATTAGGGTTTCCATGTCTTTCAATGTACTCGGGTGGGGAGAATAAAGAAGTTTGATTTTTTTCTTTTTAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8 5g3  in                          st26h17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGGAAACTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGT
  5   1   3        nb Gas8 5g3  in                          st55f07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTCACACAATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGNTCATTCG
  5   1   3        nb Gas8 5g3  in                          st34c01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAATATGAACTAANAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAAT
  5   1   3        nb Gas8 5g3  in                          st33c01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATATGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACAC
  3   1   3        nb Gas8 5g3  in                          st33c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTT
  3   1   3        nb Gas8 5g3  in                          st55f07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTAAAAATGTAAATATTATATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACT
  3   1   3        nb Gas8 5g3  in                          st57e21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATCTAGAGCAGAGATGTCCAACTTCTTTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTT
  3   1   3        nb Gas8 5g3  in                          st34c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTATGCAGTGGGCNAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACA
  3   1   3        nb Gas6 5g3  in                         ANBT1280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTATGCAGTGGGCAAATTATCCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTG
  3   1   3        nb Gas8 5g3  in                          st59e21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCAGTGGGCAAATTATCCACAATAANGCCTAGGGGTCAGATCATAATAAAATGATGTCANTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCNCTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTNCAGATTGCCAGTCCAGNCCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATNCATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATNCATTATATAANGTAGGNAAAAAAAAGCATACCTGNTTATCNGTTAACANGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATGTATGCGTGGCTTGGTTNTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGT
  5   1   2       ext Neu  5g3  in                   TNeu088h17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCGGGCAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTGATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCGGAGCGTGACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCGACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTGAACAAAAAGAAAGCTCATCAACAATGTGATTTCTTACGGGTGTGTATACATTATATAATGTGGGTGAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTGCGTAGCATCCTGCAGCAGTGAAATCTATGCGT
  3   1   4      seed Gas7 5g3  in                         XZG27412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTGATTTTTTTCTTTTT
  3   1   2       ext Neu  5g3  in                    TNeu088h17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCAATAATGCCTAGGGGTCAGATCATAATAAAATGATGTCATTAATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTACGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATNTTAATAAAGAATAAAGAAGTTTGATAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8 5g3  in                          st15e02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGG
  3   1   3        nb Gas8 5g3  in                          st16e02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTATGCCAGGCCCAGACTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACT
  3   1   3        nb Gas8 5g3  out                         st17d02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTATGCCAGGCCCAGACTGGGANTCAAAATAGGCCCTGNCATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGNTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCAT
  5   1   3        nb Neu  5x3                       TNeu027i22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGGATTCAAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTACGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTG
  5   1   3        nb Gas8 5g3  in                          st15e02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGGATTCAAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTGAAAAAAAAAA
  5   1   3        nb Gas8 5g3  in                          st16e02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTGAAAAAAAAAA
  5   1   3        nb Gas8 5x3  out                         st17e02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATAGGCCCTGACATTTTGAGTACACAAAGACCTAAACAGCACCCCCATAGGCCCAATAAATAGTGACCACGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCANATATAGACACTTTANGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTANGGTTTCCATGTCTTTCAATGTAATTATTTAATAAANAATAAAGAAGTTTG
  3   1   3        nb Gas8 5g3  in                          st51k12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTT
  3   1   3        nb Gas8 5g3  in                          st51l12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGT
  3   1   3        nb Gas8 5g3  in                          st52l12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCATCACTAGTGCCTGTCAATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACANT
  3   1   2       add Gas1 5g3  in                     NISC_mq10a08.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAATGGCATTTTCAGCAGCCCCTTTTCCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTTTACAGCTTTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTTTTACGGGGGTATATCCCTTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATTTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATTTATGCGTGGCTTGGTTTTGCCCCCTAAAAGGCAAACCAAGTATAAACAAGTATGAACCAAATATAGGCCCTTTAAGAGTGTAAATCCTTATGTTTGGGGCCCTGCCCCAAATCTGTACTTGTAGGGGCTGTATTATAAATATAGTATATTTGATCCATACCCTGAAATATAGGCTGTTCATTCGTTCCCAAAAAGCAAGACATTTGTGTTTTTACTCCCTGCCCTTGATTAGGGTTTCCATGTTTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTGGaaaaaaaaaaaaaaaaaaccaaaaaaaaaaaaaaaaaaaaaaG
  5   1   3        nb Gas8 5g3  in                          st51k12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAANAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGA
  5   1   3        nb Gas8 5g3  in                          st51l12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTNANANAAAAA
  5   1   3        nb Gas8 5g3  in                          st52l12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGCATTTTACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTAA
  3   1   2       add Gas  FL   in                    TGas108b24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAGCAGCCCCTTTACCAGAACCTACAGATTGCCAGTCCAGACCTGCCTCAAGCGGAGAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTGATAAAAAAAAAAAAAAAAAA
  5   1   2       ext Neu                            TNeu039b15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ANAGGCAACAAGCTCTACAGCTCTACTCAGGGACACTCATGTGCATACATGTATATGTGTAAACAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACATTATATAATGTAGGTAAAAAAAACATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGTTTTTGCCGCCTAAAAGACAAACCAAGTATAAACAAGTATGAACCAAATATAGACACTTTAAGAGTGTAAATCCTTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATTATAAATATAGTATATTTGATCCATACACTGAAATATAGGCTGTTCATTCGTTCACAAAAAGCAAGACATTTGTGTTTTTACTCACTGCACTTGATTAGGGTTTCCATGTCTTTCAATGTAATTATTTAATAAAGAATAAAGAAGTTTAAAAAAAAAAAAAAAAAAAAAAAAAGCGGCCGCGTCGACACTAG
  5   1   3        nb Gas8      out                         st56f07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTACAGCTCTACTCAGGGACACTCNTGTGCCTACNTGTATNTGTGTANANAAAAAGAAAGCTCATCAACAATGTCATTTCTTACGGGTGTATATACGTTATATAATGNAGGTAAAAAAAAGCATACCTGCTTATCTGTTAACATGAAGTGTCCGTAGCATCCTGCAGCAGTGAAATCTATGCGTGGCTTGGTTTTGCCGCCTAANAGACAAACCAAGTATAAACAAGTATGANCCAGATATAGACACTTTAAGAGTGTAAATCCNTATGTCTGGGGCACTGCACCAAATCTGTACTTGTAGGTGCTGTATNAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)